Overview

Brief Summary

Biology

Like the herring, there are various races of cod, which differ in their growth rates, distribution and times of spawning. Most cod spawn between the months of January and April and a female, if she is large enough, can release up to five million eggs. Depending on the temperature, the eggs hatch in two to four weeks and the young cod drift in the open ocean, feeding on small crustaceans. Atlantic cod will eat a wide variety of prey, ranging from other fish (up to the size of herring) to worms; they also take swimming crabs, shrimps and prawns.  The different races of this fish vary in the ages and weights attained before they become sexually mature. The migratory cod found off the coasts of Newfoundland, Iceland and Norway mature at around eight to 12 years old when they may weigh up to eight kilogrammes. Coastal cod mature more rapidly and may be able to reproduce at the age of three years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Mature Gadus morhua grow to approximately 120 cm in length, weighing around 12 kg, however larger fish have been recorded. Age of maturity varies regionally but is usually between one and fifteen years. Colour is variable depending on habitat but most are spotted with white bellies. Atlantic cod are commonly found on sandy bottoms and are often mottled brown in appearance. This is a heavy and powerful fish with three dorsal and two anal fins, all slightly rounded, and either a square or rounded tail fin. The upper jaw overhangs the lower and the long chin barbel is equal to the eye in diameter. A prominent curved, white (or very pale) lateral line makes this species easy to identify. Mainly demersal, although pelagic under certain conditions.Atlantic cod is one of the UKs most popular commercial species and as a result has been fished extensively in UK waters. They can often be found in large, dense shoals, making them an easy target for fishermen. Extensive over fishing has resulted in this once prolific species becoming commercially rare.

Atlantic cod are productive breeders. Spawning occurs between February and April when 3 to 6 million buoyant eggs are released, often forming great swarms that can be transported miles by ocean currents before hatching after 12 days. The larval stage of this species is also planktonic and will be carried by currents for up to 2 months before settling on the seabed where the Atlantic cod spend most of their life (Dipper, 2001).

Young Gadus morhua feed mainly on copeopods but become increasingly dependant on fish as they age, eating the likes of herring, capelin, haddock and even other cod (Dipper, 2001; Wheeler, 1969).

 Sub-species Gadus morhua morhua is the most common, and is found from both the western and eastern north Atlantic. Gadus morhua callarias is a low salinity non-migratory race found in the Baltic, and Gadus morhua marisalba occurs in the White Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cod is probably the best-known fish caught commercially in UK waters. In appearance, the head is rather disproportionately large for the body, with the upper jaw protruding over the lower. The colour of the body can vary depending on the habitat in which the fish is found, but ranges from reddish or greenish where the water is populated by algae, and pale grey where the fish is found in deep water or near a sandy bottom. The cod has a barbel on the end of its chin and, in common with several other members of the family, three dorsal and two anal fins. The tail fluke is square-ended, and the lateral line is noticeable and extends from the point of the gill covers to the centre of the tail root.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cod is a relatively large and stout bodied fish with a large head and long chin barbel. It has three dorsal fins and two anal fins which are all rounded in outline. The colour can vary from greenish-grey with orange-brown or grey mottling. It has a conspicuous white lateral line. Adult fish can grow to approximately 1.7m although most are less than 1.2m. The large head, stout body, mottled coloration and distinctive white lateral line distinguish the cod from other members of the cod family.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This is an epibenthic-pelagic species (Ref. 58426). It is widely distributed in a variety of habitats, from the shoreline down to the continental shelf. Cod form schools during the day. Cod are omnivorous; they feed at dawn or dusk on invertebrates and fish, including young cod. Cod spawn once a year, in batches (Ref. 51846). The most important stocks are the Norwegian Arctic stock in the Barents Sea and the Icelandic stock. The populations around Greenland and Newfoundland have declined dramatically (Ref. 35388). Results of a 30-yr time-series analysis of a heavily exploited population supports the hypothesis that size-selective fishing induces genetic changes in growth -- small size-at-age continued despite little fishing for over a decade and good conditions for growth (Ref. 81225; 81226). Older and larger cod had been found to produce larger eggs with neutral buoyancy which can be crucial to egg and larval survival (Refs. 31930; 38384). Cod is marketed fresh, dried or salted, smoked and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). Over 12 nucleotide substitutions in the 307 base pair region of the mitochondrial cytochrome b gene differentiate this species from Gadus ogac (Ref. 40214).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Gadus morhua is commonly known as Atlantic cod and can be found along the eastern and northern coasts of North America, along the coasts of Greenland, and from the Bay of Biscay north to the Arctic Ocean, including the Atlantic waters around Iceland, the North Sea, and the Barents Sea.

Biogeographic Regions: atlantic ocean (Native )

  • 2005. "Wikipedia: Encyclopedia" (On-line). Accessed October 13, 2005 at http://en.wikipedia.org/wiki/Atlantic_cod.
  • Wildscreen, U.K. Charity, 2004. "ArKive: Gadus Morhua" (On-line). Accessed October 11, 2005 at http://www.arkive.org/species/ARK/fish/Gadus_morhua/more_info.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

southern Baffin Island to Cape Hatteras
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Birkenfels (shipwreck), British Isles, Davis Strait, Dutch Exclusive Economic Zone, European waters (ERMS scope), FAO fishing area 21, Grevelingen, Gulf of Maine, Gulf of St. Lawrence, Hudson Strait, Irish Exclusive economic Zone, North West Atlantic, Oostduinkerke, Oosterschelde, Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Atlantic: The range extends from northern Labrador to Nantucket Shoals and from West Greenland, Davis Strait, Resolution Island and Hudson Strait in the west. Cod are taken as far south as the northern part of the North Carolina coast during winter. Eastern North Atlantic: The range extends from Nova Zembla, Spitzbergen, and Bear Island in the north to the northern part of the Bay of Biscay in the south, also into the Baltic up to Finland.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Atlantic cod range from the north and eastern coast of North America, around the southern tip of Greenland across the north Atlantic to the waters around Iceland, the Faroes, the North Sea and the Barents Sea. It is found all around the British coast, reaching south to the Bay of Biscay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This species is widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest to Northeast Atlantic: Cape Hatteras to Ungava Bay along the North American coast; east and west coast of Greenland; around Iceland; coasts of Europe from the Bay of Biscay to the Barents Sea, including the region around Bear Island.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Atlantic cod reach a maximum length of 150 to 200 cm. On average, cod weigh 40 kg and the greatest recorded weight is 96 kg. The color of Atlantic cod varies with respect to the enviroment in which the fish lives. Water with large volumes of algae will yield a red to greenish skin color. A pale grey color is more prevalent for fish found on the ocean floor or on sandy bottoms. The Atlantic cod has 1 chin barbel, 3 dorsal fins, and 2 anal fins. It also has a pronounced lateral line from the gills to the tail (Wildscreen and U.K. Charity 2004). The coloring of cod is often shaded from top to bottom. The dorsal area of the fish may be a rich brown to green and fade to silver towards the ventral side. Some cod may have brown/red spots on the sides and back.

Range mass: 96 (high) kg.

Average mass: 40 kg.

Range length: 200 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 44 - 55; Analspines: 0; Analsoft rays: 33 - 45; Vertebrae: 51 - 55
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 200 cm TL (male/unsexed); max. weight: 96 kg .
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 96.0 kg (Ref. 9988); max. reported age: 25 years (Ref. 173)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Color varies from brownish to greenish or gray dorsally and on upper sides, becoming pale and silvery ventrally. Lateral line light, curving upward to above the pectoral fin. Predorsal distance less than 1/3 of total length, body depth about 1/5 of total length. Peritoneum silvery.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Atlantic cod are marine benthopelagic fish, living near the bottom and in the open ocean (Riede 2004). Cod also inhabit brackish waters. Cod can be found in a wide range of habitats within the ocean, from the shoreline down to the continental shelf. They can be found at depths of 500 to 600 meters in coastal waters and are also numerous in open ocean waters. These fish are located in a temperate climate with a range in temperature from 0 to 20 degrees Celsius. Geographically the majority of the population lies within a latitude of 80 to 35 degrees north (Frimodt 1995).

Range depth: 600 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; brackish water

  • Riede, K. 2004. Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt:Federal Agency for Nature Conservation, 808 05 081: 329. Accessed October 13, 2005 at http://www.fishbase.org/Summary/SpeciesSummary.php?id=69.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found from the shoreline to the edge of the continental slope.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 470642 specimens in 1 taxon.
Water temperature and chemistry ranges based on 253450 samples.

Environmental ranges
  Depth range (m): -9 - 975
  Temperature range (°C): -2.072 - 15.532
  Nitrate (umol/L): 1.139 - 26.300
  Salinity (PPS): 6.094 - 35.639
  Oxygen (ml/l): 0.573 - 8.544
  Phosphate (umol/l): 0.223 - 3.328
  Silicate (umol/l): 0.987 - 72.643

Graphical representation

Depth range (m): -9 - 975

Temperature range (°C): -2.072 - 15.532

Nitrate (umol/L): 1.139 - 26.300

Salinity (PPS): 6.094 - 35.639

Oxygen (ml/l): 0.573 - 8.544

Phosphate (umol/l): 0.223 - 3.328

Silicate (umol/l): 0.987 - 72.643
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Cod prefer cold temperate waters and can be found from the shoreline down to depths of 600 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 600m.
From 1 to 600 meters.

Habitat: benthopelagic. This species is widely distributed in a variety of habitats from the shoreline to well down the continental shelf. Two stocks are recognized in the brackish Baltic Sea. Cod feeds at dawn or dusk on invertebrates and fish, including young cod. Forms schools during the day. Spawns once a year. Marketed fresh, dried/salted, smoked and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; brackish; marine; depth range 1 - 600 m. Found over a wide range of habitats. Forms schools during the day.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Atlantic cod can be found in coastal waters with depths of 500 to 600 metres, and in the open ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The cod occurs in a wide variety of habitats from the shore down to depths of 600m. Divers usually encounter cod near rocky areas or around wrecks. They feed on a range of crustaceans, worms, brittle-stars and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 600 m (Ref. 1371), usually 150 - 200 m (Ref. 54441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Atlantic cod is best described as opportunistic because they feed on anything they are capable of capturing. At all life stages, however, they eat primarily other animals. During the larval stage they feed on smaller organisms such as zooplankton. Juveniles feed on shrimp and other small crustaceans. Adult Atlantic cod consume squid, mussels, clams, tunicates, comb jellies, brittle stars, sand dollars, sea cucumbers, and polychaetes, and are also cannibalistic. The choice of prey included in the diet seems to play a role in determining the skin color of cod. Those that feed on crustaceans tend to appear more brownish in color whereas a blue-green pigment may be the result of a diet consisting primarily of fish.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: phytoplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds mainly on zoobenthos and fish (Refs. 5743, 9604, 26813); such as redfish, capelin, sand lance, alewives, Atlantic and Arctic cod, cunner, flounders, haddock, hake, mackerel, shannies, snakeblenny, sculpins and silversides. Food also includes copepods, amphipods, barnacle larvae, crustaceans (euphausiids, mysids, shrimps, small lobsters, spider crabs and hermit crabs), tunicates, comb jellies, brittle stars, sand dollars, sea cucumbers and marine worms (Ref. 5951). Cannibalism has been observed even in young-of-the-year and large-scale consumption of its own young begins upon reaching 28-30 cm length (Ref. 44941). Young cod is preyed upon by larger cod, squid and pollock, while the larger cod is eaten by marine mammals (harbor, grey and harp seals). Parasites of the species include 5 protozoans (trypanosome), 2 myxosporidians, 1 monogeneid, 5 trematodes, 2 cestodes, 6 nematodes, 1 acanthocephalan, 1 hirudinid and 6 copepods (Ref. 5951).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Omnivorous, feeds at dawn or dusk on invertebrates and fish.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The main role that Atlantic cod have in the ecosystem is their involvement in the food chain. Atlantic cod feed upon a variety of organisms such as invertebrates, crustaceans, and zooplankton. Larger marine organisms (i.e. sharks, seals) prey upon and consume Atlantic cod. The interplay between predators and prey is the key way in which cod influence their ecosystem. No information concerning specific relationships (mutualism, parasitism, etc.) was available.

  • Campbell, D. 2005. "Atlantic Cod" (On-line). Marinebio.org. Accessed October 18, 2005 at http://marinebio.org/species.asp?id=206.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Atlantic cod populations respond differently to predators depending on what region of the Atlantic Ocean they occupy. Atlantic cod are susceptible to being consumed by large marine mammals (harp and harbor seals) and sharks. In the northwest Atlantic Ocean most of the large predatory fish have been removed and cod (and similar species) act as dominant predators in this region. In other parts of the Atlantic Ocean with large harp seal populations the number of Atlantic cod has been greatly reduced due to consumption by seals.  Cod larvae are vulnerable to smaller predators such as zooplankton. Juveniles are preyed on by species such as dogfish, squid, and halibut. Cannibalistic behavior becomes apparent as adult Atlantic cod readily consume juveniles. Although adult Atlantic cod have relatively few predators compared to their young, they still must be on the lookout for large marine animals. The greatest predatory threats to cod are those that lurk above the surface. Humans are responsible for drastically lowering Atlantic cod populations through well-developed fisheries. The economy of several regions is dependent upon these fisheries and the great demand for large numbers of Atlantic cod has resulted in overfishing and reduced cod stocks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Ulcer (l.). Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lernaeocera Disease (l.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clavella Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ulcer (e.). Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tumor of skin. Neoplasia (tumors of unknown origin)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleistophora disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black spot Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ascaridatosis (adult and juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is limited information available on the communication among cod. Atlantic cod are hypothesized to communicate through the production of sound via drumming muscles. Sound production is correlated with mate selection during spawning season. It is hypothesized that the degree to which males are able to produce acoustic sound is positively associated with the overall fitness of the males, with those having larger drumming muscles producing greater sound waves and out-competing others.

Communication Channels: acoustic

Perception Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Atlantic cod pass through a series of four life history stages as they develop. Initially they begin as pelagic eggs which are located in harbors, bays, and offshore banks. The eggs are associated with an incubation temperature around 2 to 8.5 degrees Celsius. The eggs are buoyant and remain close to the surface waters. Studies have shown that egg mortality is independent of temperature but increases at lower salinities. Next, the larval stage takes place. Larvae are located in pelagic waters and their growth is correlated with the volume of zooplankton which can feed upon the sac larvae at this stage. During the third stage, juveniles occur in coastal and offshore waters in the summer and deeper waters in the winter. They are tolerant of temperature changes from 6 to 20 degrees Celsius and they often use vegetation as a predator avoidance strategy. The final stage is adulthood. They live at temperatures less than 10 degrees Celsius and primarily inhabit the ocean floor.

  • Fahay, M., P. Berrien, D. Johnson, W. Morse. 1999. Atlantic Cod (Gadus Morhua) Life History and Habitat Characteristics. National Ocean and Atomospheric Administration Technical Memorandum, 122-152: 1-35. Accessed October 13, 2005 at http://www.nefsc.noaa.gov/nefsc/publications/tm/tm124/tm124.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

First sexual maturity happens at 4-5 years of age. Spawning occurs in winter and beginning of spring (off the coasts of Norway and in the North Sea), where big school is formed. Embryo development lasts about 14 days (at 6°C) and larval phase lasts about 3 months(at 8 C). Usually cod spawn at or near the bottom when temperatures and oxygen conditions are suitable. Temperature range for spawning is between 0 and 12 °C. Fecundity ranges from 2.5 million eggs in a 5 kg female to a record of 9 million eggs in a 34 kg female. Reported number of batches spawned in an experiment is 8 - 22 (Ref. 5513). Sex ratio is nearly 50%, with slight predominance of females. Classified as a determinate multiple spawner (Ref. 40290). Older and larger cod had been found to produce larger eggs with neutral bouyancy which can be crucial to egg and larval survival (Refs. 31930; 38384).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO Species Catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10).x+442p. Rome: FAO. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Atlantic cod can reach a maximum lifespan in excess of 20 years, with a minimum lifespan of a few hours/days (shortly after the eggs are released). Within the last 100 years typical lifespans have changed drastically as a result of commercial cod fisheries. Most recently, fisheries have begun harvesting younger fish.

Range lifespan

Status: wild:
0 to 20 years.

Average lifespan

Status: wild:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is a limited amount of information on Atlantic cod spawning behavior which may suggest complex mating systems. Researchers are aware that mating behavior in Atlantic cod can include reproductive strategies such as sound production by males and mate selection by females. Although these behaviors have been observed, the causes and consequences of such behavior, and their specific interplay within the mating systems continue to be studied. Atlantic cod are considered "batch-spawners", as females only release 5 to 25% of their total egg complement at any time.

One study on the acoustic sound production of Atlantic cod provides some insight into possible mating behaviors. Drumming muscles are present in both males and females, yet males tend to have more pronounced muscles. The mass of the drumming muscles increases in males prior to spawning and larger males have larger muscles. This suggests that the amplitude of sound production might be a determinant in the success of spawning and selection by females. Observations of Atlantic cod behavior support the hypothesis that females are responsible for mate selection. The biology of the drumming muscles in males, as well as the circling behavior of numerous males around prospective females supports the female selection hypothesis. It is worth noting that dominance hierarchies can also be established. Males with greater body sizes and those who were successful in spawning sometimes appear to dominate the population and act aggressively towards “lesser” males.

Recent research suggests that anthropogenic noise pollution in the water (via oil/gas exploration and drilling) could pose a threat to the success of sound production and the role it plays in the reproduction process.

Mating System: polygynandrous (promiscuous)

Many stocks of cod exhibit migratory behavior during their reproduction season due to seasonal variations in water temperature. Typically, a cod population moves into warmer waters during winter and early spring to begin spawning. Although spawning can occur year round, peak spawning levels occur in the winter and spring. As the population moves inshore it may disperse temporarily to feed if large amounts of prey are present. Cod spawn annually, and spawning takes place within a three month period. Cod employ a ventral mount position in which a male uses his pelvic fins to clasp onto a female and then position himself properly beneath her. Cod spawn in dense concentrations of more than 1 fish per cubic meter and multiple pairs of fish can be observed spawning in the same water column. Spawning occurs near the ocean bottom in temperatures between 5 to 7 degrees Celsius. The eggs that are produced are pelagic, and drift (often towards the surface) for approximately 2 to 3 weeks before hatching and reaching the larval stage. There is some debate as to the age of sexual maturity for cod. Age and size at maturity often vary amongst different populations with northeastern populations maturing around 5 to 7 years and southern populations maturing between 2 to 3 years. A recent finding suggests that cod are moving towards a reduction in age and size for sexually mature fish. In 1959 the median age of maturity was 6.3 years for females and 5.4 years for males. In 1979 the age of maturity was listed as 2.8 years for both sexes. Now, the median age of sexual maturity is between 1.7 to 2.3 years and corresponds to a length of 32 to 41 cm.

Breeding interval: Spawning takes place once a year for a duration of 3 weeks to 3 months.

Breeding season: Breeding csn occur year round; peak spawning recorded in winter/spring months.

Range number of offspring: 9 million (high) .

Average time to hatching: 2 to 3 weeks.

Range age at sexual or reproductive maturity (female): 1.7 to 5.4 years.

Range age at sexual or reproductive maturity (male): 1.7 to 7 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is no indication that any parental involvement exists on the behalf of either females or males after the eggs are released. The high mortality rate of the offspring (eggs) is attributed, in part, to the lack of parental care. The reproductive strategy of high fecundity levels may be a response to the absence of protection the eggs receive once released into the water. Although the survival rate is low, the sheer number of eggs produced is huge.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Committee on the Status of Endangered Wildlife in Canada (COSEWIC). Assessment and Update Report on Gadus Morhua (Atlantic Cod). xi + 76pp. Ottawa: COSEWIC. 2003. Accessed October 17, 2005 at http://www.sararegistry.gc.ca/virtual_sara/files/cosewic/sr_atlantic_cod_e.pdf.
  • Fahay, M., P. Berrien, D. Johnson, W. Morse. 1999. Atlantic Cod (Gadus Morhua) Life History and Habitat Characteristics. National Ocean and Atomospheric Administration Technical Memorandum, 122-152: 1-35. Accessed October 13, 2005 at http://www.nefsc.noaa.gov/nefsc/publications/tm/tm124/tm124.pdf.
  • Rowe, S., J. Hutchings. 2004. The function of sound production by Atlantic Cod as inferred from patterns in variation of drumming muscle mass. Canadian Journal of Zoology, 82: 1391-1398. Accessed October 17, 2005 at http://article.pubs.nrc-cnrc.gc.ca/ppv/RPViewDoc?_handler_=HandleInitialGet&journal=cjz&volume=82&calyLang=eng&articleFile=z04-119.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cod spawn at or near the bottom when temperatures are between 0 and 12°C. Eight to 22 batches have been spawned under experimental conditions. Sex ratio is nearly 50%, with slightly more females than males.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Gadus morhua

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GTENK033-11|PRJNA41391|Gadus morhua| ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTA---AGCCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTTCTTGGTGAT---GATCAAATTTATAATGTGATCGTTACAGCGCACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTTGGGAACTGACTTATTCCTCTAATG---ATCGGTGCACCAGATATAGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTTCCTCCATCTTTCCTGCTCCTTTTAGCATCCTCTGGTGTAGAAGCTGGGGCTGGAACAGGCTGAACTGTCTATCCACCTTTAGCCGGAAACCTCGCTCATGCTGGGGCATCTGTTGATCTC---ACTATTTTTTCTCTTCATCTAGCAGGGATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCTCCGGCAATTTCACAGTACCAAACACCCCTATTTGTTTGAGCAGTACTAATTACAGCTGTGCTTCTACTATTATCTCTCCCCGTCTTAGCAGCT---GGTATCACAATACTTCTAACTGACCGTAATCTTAATACTTCTTTCTTTGACCCTGCTGGAGGAGGTGATCCCATTTTATACCAACACTTATTCTGATTCTTCGGGCATCCCGAAGTTTATATTCTTATTTTACCCGGCTTCGGAATAATTTCCCACATCGTAGCATACTACTCAGGTAAAAAA---GAACCCTTCGGGTATATGGGTATAGTCTGAGCTATGATGGCTATTGGCCTCCTTGGCTTTATTGTATGAGCCCATCACATGTTTACAGTCGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gadus morhua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 67
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1bd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sobel, J.

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Atlantic cod was listed as a vulnerable species in 1996. In the early 1990’s many cod populations collapsed in areas where commercial fishing was intense. The collapse is attributed to overfishing, and specifically to the commercial fishing of older/larger cod which resulted in a smaller population of fertile females and the harvesting of young fish before they have had a chance to mature and reproduce. The prosperity that fishermen enjoyed prior to the collapse lured many into the commercial fisheries and as a result the cod population was negatively affected.

Some efforts have been made to help certain cod populations rebound. Moratoriums and fishing regulations were placed in regions of Canada but were unsuccessful in maintaining or increasing population size. The main deterrent in properly managing cod stocks relates to the geographic range which the cod occupy. Cod are found throughout the waters of the Atlantic, and since these are international waters it makes it difficult for any one region to impose certain regulations. Research shows that populations can easily fall below the “Safe Biological Limits,” which represent the number of fish needed to maintain a proper population. Biologists argue that regulation alone will not be enough to keep the cod population at a sustainable level, but it is a start. Suggestions such as no-catch zones in areas of spawning and along migration routes may be helpful if enacted. As cod stocks move towards critically low levels, it is apparent that serious conservation efforts must be put into place to prevent the devastation of this important fish species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not subject to specific protection, but listed by the International Council for the Exploration of the Seas (ICES) as below Safe Biological Limits (SBL).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: In Canada, threats to persistence include fishing (now halted), predation by fish and seals, and natural and fishing-induced changes to the ecosystem; Cod in Arctic waters, which occur mostly in a few coastal salt lakes, are sensitive to human activities, and poorly regulated fishing is a potential threat (COSEWIC, May 2003, http://www.cosewic.gc.ca/htmlDocuments/Detailed_Species_Assessment_e.htm).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Atlantic cod is a fish in crisis. The fish stocks in the Irish Sea have fallen drastically within the last few years. Recent figures compiled and published by the European Environment Agency (EEA) warn that the risk of a collapse of the fish stock in the North Sea is high, and that populations are now outside safe biological limits. The spawning stock biomass (the breeding population of the fish) hit an historic low figure during 2001, and during February and April that year, much of the North Sea was closed to fishing fleets as part of an emergency plan to protect young cod. It is also thought that the spawning stock biomass for the North Sea has been below the 'biomass precautionary approach reference point' - the critical level for sustaining the population - for almost two decades, and this warning also applies to waters adjacent to the North Sea. Throughout its range, the harvesting of young fish before they have been able to reproduce successfully is a serious threat to Atlantic cod.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A1bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The Atlantic cod is listed in the UK Biodiversity Grouped Action Plan for commercial marine fish. Being a species that is found in international waters, it has proved very difficult to impose restrictions on the number of fish that can be harvested from the sea without reducing fish stocks below the important Safe Biological Figure (SBF) limits. The International Council for the Exploration of the Sea (ICES) released figures for the North East Atlantic and Baltic in 2001, which show cod are still being overfished within six of the nine sea areas of the study. Currently, cod caught in Icelandic waters are the only stock regarded as being sustainably fished. In January of 2003, the European Union (EU) revised its Common Fisheries Policy (CFP), but whether this will lead to improvements in the way the fishing industry is regulated remains to be seen. Although the fish that are landed in port are controlled through the rules governing total allowable catch (TAC), the regulations do not limit the numbers of fish actually caught. A boat's crew, having checked the catch and finding either bycatch (non-target fish or other animals) or fish below the legal size, will simply jettison those fish overboard. Most of them will be dead. Many marine biologists argue that regulation alone will not be enough to maintain fish stocks at a sustainable level. The present status of the Atlantic cod stock seems to support this statement. Perhaps the only hope for the future of this fish, and the other commercial species, is the imposition of no-catch zones, including some of the principal migration routes, and areas where fish can spawn undisturbed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although Atlantic cod have been an economic asset to humans, they can also create problems for economies based solely on cod fisheries. Those who depend upon the success of cod fisheries as a source of income can be hurt financially if fisheries fail. The collapse of the cod fisheries in the 1990’s took a toll on the economies of New England and Canada. In this case, the stocks were not managed properly and resulted in a 96% decrease in population size since 1850. Fishermen who rely on the cod population to make a living are left with financial burdens when the stock collapses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Atlantic cod provide an extremely important fishery in many regions especially in the northwest Atlantic. The success of this commercial fishery has been the main source of economic wealth for areas such as New England and Canada, with Atlantic cod even being labeled “Newfoundland currency”. Up until the 1990’s, Atlantic cod was not only an economic mainstay for many people but also a dominant member of the food chain within the waters of the Atlantic. Atlantic cod is marketed widely, primarily for human consumption. The flesh is mild and Atlantic cod are a popular table fish. The liver of Atlantic cod is also processed to produce cod liver oil which is used as a vitamin supplement.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic Cod with Miso

I hope that you will give this recipe a try, because it’s definitely worth the time and effort.

There are essentially only 4 ingredients that you will need to marinate the fish.
Combine 1/4 cup sake, 1/4 cup mirin, 4 tbsp of miso paste, and 3 tbsp of sugar.

Take 4 pieces of cod and put it into a ziploc bag with the miso marinade. Leave it in the fridge overnight.
When it's ready to be cooked, sear both sides of the cod on a skillet until you see the highlights of sugar caramelization.

The fish goes into a 400-degree oven for about 7-10 minutes.

We wanted to add a side of vegetables with our fish, so we made honey-ginger carrots. Julienne the carrots and blanch them in boiling water for about 5-7 minutes until soft. Melt 2 tbsp of butter together with 1 tbsp honey and 1 tbsp minced ginger. Then add the carrots and mix together.

Place the cod on a bed of honey-ginger carrots and drizzle with some of the marinade (heat the marinade in the skillet first since it touched raw fish).

You will be amazed at how delicate and refreshing the flavors are. This is surely one of my favorite fish recipes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eli E. Agbayani

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Wikipedia

Atlantic cod

The Atlantic cod (Gadus morhua) is a well-known demersal food fish belonging to the family Gadidae. It is also commercially known as cod, codling or haberdine.[2]

In the western Atlantic Ocean, cod has a distribution north of Cape Hatteras, North Carolina, and around both coasts of Greenland; in the eastern Atlantic, it is found from the Bay of Biscay north to the Arctic Ocean, including the Baltic Sea, the North Sea, Sea of the Hebrides,[3] areas around Iceland and the Barents Sea.

It can grow to 2 meters in length and weigh up to 96 kilograms (210 lb). It can live for 25 years and sexual maturity is generally attained between ages two and four,[4] but can be as late as eight years in the northeast Arctic.[5] Colouring is brown to green, with spots on the dorsal side, shading to silver ventrally. A lateral line is clearly visible. Its habitat ranges from the shoreline down to the continental shelf.

Several cod stocks collapsed in the 1990s (declined by >95% of maximum historical biomass) and have failed to recover even with the cessation of fishing.[6] This absence of the apex predator has led to a trophic cascade in many areas.[6] Many other cod stocks remain at risk. The "Atlantic cod" is labelled VU (vulnerable) on the IUCN Red List of Threatened Species.[7]

Contents

Lifecycle

Atlantic cod juvenile

Adult cod form spawning aggregations from late winter to spring.[8][9] Females release their eggs in batches,[10] and males compete to fertilize them.[11][12][13] Fertilized eggs drift with ocean currents and develop into larvae. Age of maturation varies between cod stocks, from ages two to four in the west Atlantic,[14] but as late as eight years in the northeast Arctic.[5] Cod can live for 13 years or more.[15]

Parasites

Atlantic cod act as intermediate, paratenic or definitive hosts to a large number of parasite species: 107 taxa listed by Hemmingsen and MacKenzie (2001)[16] and sevev new records by Perdiguero-Alonso et al. (2008).[16] The predominant groups of cod parasites in the northeast Atlantic were trematodes (19 species) and nematodes (13 species), including larval anisakids, which comprised 58.2% of the total number of individuals.[16] Parasites of Atlantic cod include copepods, digeneans, monogeneans, acanthocephalans, cestodes, nematodes, myxozoans and protozoans:[16]

Fisheries

Global capture of all Atlantic cod in tonnes reported by the FAO, 1950–2010[17]
Capture of Atlantic cod 1950-2005, (FAO)

Northwest Atlantic cod

The northwest Atlantic cod has been regarded as heavily overfished throughout its range, resulting in a crash in the fishery in the United States and Canada during the early 1990s.

Newfoundland's northern cod fishery can be traced back to the 16th century. On average, about 300,000 tonnes of cod were landed annually until the 1960s, when advances in technology enabled factory trawlers to take larger catches. By 1968, landings for the fish peaked at 800,000 tonnes before a gradual decline set in. With the reopening of the limited cod fisheries in 2006, nearly 2,700 tonnes of cod were hauled in. In 2007, offshore cod stocks were estimated at one per cent of what they were in 1977.[18]

Technologies that contributed to the collapse of Atlantic cod include engine-powered vessels and frozen food compartments aboard ships. Engine-powered vessels had larger nets, larger engines, and better navigation. The capacity to catch fish became limitless. In addition, sonar technology gave an edge to catching and detecting fish. Sonar was originally developed during WWII to locate enemy submarines, but was later applied to locating schools of fish. These new technologies, as well as bottom trawlers that destroyed entire ecosystems, contributed to the collapse of Atlantic cod. They were vastly different from old techniques used, such as hand lines and long lines.[19]

The fishery has yet to recover, and may not recover at all because of a possibly stable change in the food chain. Atlantic cod was a top-tier predator, along with haddock, flounder and hake, feeding upon smaller prey, such as herring, capelin, shrimp and snow crab.[6] With the large predatory fish removed, their prey have had population explosions and have become the top predators, affecting the survival rates of cod eggs and fry.

In the winter of 2011-2012, the cod fishery succeeded in convincing NOAA to postpone for one year the planned 82% reduction in catch limits. Instead the limit will be reduced by 22%. The fishery brought in $15.8 million in 2010, coming second behind Georges Bank haddock among the region’s 20 regulated bottom-dwelling groundfish. Data released in 2011 indicated that even closing the fishery would not allow populations rebound by 2014 to levels required under federal law. Restrictions on cod effectively limit fishing on other groundfish species with which the cod swim, such as flounder and haddock.[20]

Cod populations or stocks can differ significantly both in appearance and biology. For instance, the cod stocks of the Baltic Sea are adapted to low-salinity water. Organisations such as the Northwest Atlantic Fishery Organization (NAFO) and ICES divide the cod into management units or stocks; however, these units are not always biologically distinguishable stocks. Some major stocks/management units on the Canadian/US shelf (see map of NAFO areas) are the Southern Labrador-Eastern Newfoundland stock (NAFO divisions 2J3KL), the Northern Gulf of St. Lawrence stock (NAFO divisions 3Pn4RS), the Northern Scotian Shelf stock (NAFO divisions 4VsW), which all lie in Canadian waters, and the Georges Bank and Gulf of Maine stocks in United States waters. In the European Atlantic, the numerous separate stocks are on the shelves of Iceland, the coast of Norway, the Barents Sea, the Faroe Islands, off western Scotland, the North Sea, the Irish Sea, the Celtic Sea and in the Baltic Sea.

Northeast Atlantic cod

Estimated biomass of the Atlantic cod northeast Arctic stock, 1959-2008 in million tonnes [21]

The northeast Atlantic has the world's largest population of cod. By far, the largest part of this population is the northeast Arctic cod, as it is labelled by the ICES, or the Arcto-Norwegian cod stock, also referred to as skrei, a Norwegian name meaning something like "the wanderer", distinguishing it from coastal cod. The northeast Arctic cod is found in the Barents Sea area. This stock spawns in March and April along the Norwegian coast, about 40% around the Lofoten archipelago. Newly hatched larvae drift northwards with the coastal current while feeding on larval copepods. By summer, the young cod reach the Barents Sea where they stay for the rest of their life, until their spawning migration. As the cod grow, they feed on krill and other small crustaceans and fish. Adult cod primarily feed on fish such as capelin and herring. The northeast Arctic cod also shows cannibalistic behaviour. Estimated stock size was 2.26 million tonnes in 2008.

The North Sea cod stock is primarily fished by European Union member states and Norway. In 1999, the catch was divided among Denmark (31%), Scotland (25%), the rest of the United Kingdom (12%), the Netherlands (10%), Belgium, Germany and Norway (17%). In the 1970s, the annual catch rose to between 200,000 and 300,000 tons. Due to concerns about overfishing, catch quotas were repeatedly reduced in the 1980s and 1990s. In 2003, ICES stated there is a high risk of stock collapse if then current exploitation levels continued, and recommended a moratorium on catching Atlantic cod in the North Sea during 2004. However, agriculture and fisheries ministers from the Council of the European Union endorsed the EU/Norway Agreement and set the total allowable catch (TAC) at 27,300 tons. Seafood sustainability guides, such as the Monterey Bay Aquarium's Seafood Watch, often recommend environmentally conscious customers not purchase Atlantic cod.

The stock of northeast Arctic cod was more than a million tons following World War II, but declined to a historic minimum of 118,000 tons in 1987. The catch reached a historic maximum of 1,343,000 tons in 1956, and bottomed out at 212,000 tons in 1990. Since 2000, the spawning stock has increased quite quickly, helped by low fishing pressure. However, there are worries about a decreased age at first spawning (often an early sign of stock collapse), combined with the level of discards and unreported catches. The total catch in 2003 was 521,949 tons, the major fishers being Norway (191,976 tons) and Russia (182,160 tons).

See also

References

This article incorporates CC-BY-2.0 text from the reference.[16]

  1. ^ J. Sobel (1996). "Gadus morhua". IUCN Red List of Threatened Species. Version 2.3. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8784. Retrieved July 5, 2011. 
  2. ^ Atlantic Cod. Seafood Portal.
  3. ^ C.Michael Hogan, (2011) Sea of the Hebrides. Eds. P. Saundry & C.J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC.
  4. ^ O’Brien, L., J. Burnett, and R. K. Mayo. (1993) Maturation of Nineteen Species of Finfish off the Northeast Coast of the United States, 1985-1990. NOAA Tech. Report. NMFS 113, 66 p.
  5. ^ a b ICES (2007), Arctic Fisheries Working Group Report, Section 03, Table 3.5, International Council for the Exploration of the Sea (accessed 2008/12/11)
  6. ^ a b c Kenneth T. Frank, Brian Petrie, Jae S. Choi, William C. Leggett (2005). "Trophic Cascades in a Formerly Cod-Dominated Ecosystem". Science 308 (5728): 1621–1623. doi:10.1126/science.1113075. PMID 15947186. 
  7. ^ J. Sobel (1996). "Gadus morhua". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8784. Retrieved February 5, 2010. 
  8. ^ K. M. Brander (1994). "The location and timing of cod spawning around the British Isles". ICES Journal of Marine Science 51 (1): 71–89. doi:10.1006/jmsc.1994.1007. http://icesjms.oxfordjournals.org/cgi/content/abstract/51/1/71. 
  9. ^ Kai Wieland, Astrid Jarre-Teichmann & Katarzyna Horbowa (2000). "Changes in the timing of spawning of Baltic cod: possible causes and implications for recruitment". ICES Journal of Marine Science 57 (2): 452–464. doi:10.1006/jmsc.1999.0522. http://icesjms.oxfordjournals.org/cgi/content/abstract/57/2/452. 
  10. ^ Scott, Beth E.; Marteinsdottir, Gudrun; Begg, Gavin A.; Wright, Peter J.; Kjesbu, Olav Sigurd (2005). "Effects of population size/age structure, condition and temporal dynamics of spawning on reproductive output in Atlantic cod (Gadus morhua)". Ecological Modelling 191 (3-4): 383–415. doi:10.1016/j.ecolmodel.2005.05.015. 
  11. ^ J. A. Hutchings, T. D. Bishop, C. R. McGregor-Shaw (1999). "Spawning behaviour of Atlantic cod, Gadus morhua: evidence of mate competition and mate choice in a broadcast spawner". Canadian Journal of Fisheries and Aquatic Sciences 56 (1): 97–104. doi:10.1139/cjfas-56-1-97. http://article.pubs.nrc-cnrc.gc.ca/ppv/RPViewDoc?issn=1205-7533&volume=56&issue=1&startPage=97. 
  12. ^ J. T. Nordeide; Folstad (2000). "Is cod lekking or a promiscuous group spawner?". Fish and Fisheries 1 (1): 90–93. doi:10.1046/j.1467-2979.2000.00005.x. 
  13. ^ D. Bekkevold, M. M. Hansen & V. Loeschcke (2002). "Male reproductive competition in spawning aggregations of cod". Molecular Ecology 11 (1): 91–102. doi:10.1046/j.0962-1083.2001.01424.x. PMID 11903907. 
  14. ^ O'Brien, L., J. Burnett, and R. K. Mayo. (1993) Maturation of Nineteen Species of Finfish off the Northeast Coast of the United States, 1985-1990. NOAA Tech. Report. NMFS 113, 66 p.
  15. ^ ICES (2007), Arctic Fisheries Working Group Report, Section 03, International Council for the Exploration of the Sea (accessed 2008/12/11)
  16. ^ a b c d e Perdiguero-Alonso D., Montero F. E., Raga J. A. & Kostadinova A. (2008). "Composition and structure of the parasite faunas of cod, Gadus morhua L. (Teleostei: Gadidae), in the North East Atlantic". Parasites & Vectors 2008, 1: 23. doi:10.1186/1756-3305-1-23
  17. ^ Gadus morhua (Linnaeus, 1758) FAO, Species Fact Sheet. Retrieved April 2012.
  18. ^ "N.L. funds cod fishery research on 15th anniversary of moratorium". CBC News. July 2, 2007. http://www.cbc.ca/canada/newfoundland-labrador/story/2007/07/02/cod-moratorium.html?ref=rss. 
  19. ^ Freedman, Bill. "Atlantic Cod and its fishery". Codfishes: Atlantic Cod and its fishery, 2008. 3 November 2008 Free Site Search Engine
  20. ^ "Cod Fishermen’s Alarm Outlasts Reprieve on Catch Limits". The New York Times. 12 February 2012. http://www.nytimes.com/2012/02/12/us/cod-fishermens-alarm-outlasts-reprieve-on-catch-limits.html. 
  21. ^ Arctic Fisheries Working Group of ICES, published in the ICES Report AFWG CM 2009, ACOM:2. The estimation method was standard VPA.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: DNA data for western North Atlantic populations reveal weak population genetic structuring that may reflect the recent age of populations rather than extensive gene flow among populations (Pogson et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!