Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Cod is a cold-water species which prefers water temperatures around 10°C. It is a large fish. Cod can grow up to more than 1.5 meters long. However, due to overfishing, such large fish are rarely found in the North Sea nowadays. Cod have a typical chin barbel, a kind of beard, which they use to search for food in the sea floor. These fish are sometimes referred to as the vacuum cleaners of the sea bottom because they eat virtually everything. You usually find them close to the bottom, but they also swim higher up in the water column. Young cod are called codling.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Like the herring, there are various races of cod, which differ in their growth rates, distribution and times of spawning. Most cod spawn between the months of January and April and a female, if she is large enough, can release up to five million eggs. Depending on the temperature, the eggs hatch in two to four weeks and the young cod drift in the open ocean, feeding on small crustaceans. Atlantic cod will eat a wide variety of prey, ranging from other fish (up to the size of herring) to worms; they also take swimming crabs, shrimps and prawns.  The different races of this fish vary in the ages and weights attained before they become sexually mature. The migratory cod found off the coasts of Newfoundland, Iceland and Norway mature at around eight to 12 years old when they may weigh up to eight kilogrammes. Coastal cod mature more rapidly and may be able to reproduce at the age of three years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cod is probably the best-known fish caught commercially in UK waters. In appearance, the head is rather disproportionately large for the body, with the upper jaw protruding over the lower. The colour of the body can vary depending on the habitat in which the fish is found, but ranges from reddish or greenish where the water is populated by algae, and pale grey where the fish is found in deep water or near a sandy bottom. The cod has a barbel on the end of its chin and, in common with several other members of the family, three dorsal and two anal fins. The tail fluke is square-ended, and the lateral line is noticeable and extends from the point of the gill covers to the centre of the tail root.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Widely distributed in a variety of habitats, from the shoreline down to the continental shelf. Juveniles prefer shallow (less than 10-30 m depth) sublittoral waters with complex habitats, such as seagrass beds, areas with gravel, rocks, or boulder, which provide protection from predators (Refs. 89383, 89384). Adults are usually found in deeper, colder waters. During the day, form schools and swim about 30-80 m above the bottom, dispersing at night to feed (Ref. 1371, 89385). Omnivorous; feed at dawn or dusk on invertebrates and fish, including young cod. (Ref. 1371). Migrate between spawning, feeding and overwintering areas, mostly within the boundaries of the respective stocks. Migrations >200 km are rare occurrences (Refs. 89386, 89387). Marketed fresh, dried or salted, smoked and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Mature Gadus morhua grow to approximately 120 cm in length, weighing around 12 kg, however larger fish have been recorded. Age of maturity varies regionally but is usually between one and fifteen years. Colour is variable depending on habitat but most are spotted with white bellies. Atlantic cod are commonly found on sandy bottoms and are often mottled brown in appearance. This is a heavy and powerful fish with three dorsal and two anal fins, all slightly rounded, and either a square or rounded tail fin. The upper jaw overhangs the lower and the long chin barbel is equal to the eye in diameter. A prominent curved, white (or very pale) lateral line makes this species easy to identify. Mainly demersal, although pelagic under certain conditions.Atlantic cod is one of the UKs most popular commercial species and as a result has been fished extensively in UK waters. They can often be found in large, dense shoals, making them an easy target for fishermen. Extensive over fishing has resulted in this once prolific species becoming commercially rare.

Atlantic cod are productive breeders. Spawning occurs between February and April when 3 to 6 million buoyant eggs are released, often forming great swarms that can be transported miles by ocean currents before hatching after 12 days. The larval stage of this species is also planktonic and will be carried by currents for up to 2 months before settling on the seabed where the Atlantic cod spend most of their life (Dipper, 2001).

Young Gadus morhua feed mainly on copeopods but become increasingly dependant on fish as they age, eating the likes of herring, capelin, haddock and even other cod (Dipper, 2001; Wheeler, 1969).

 Sub-species Gadus morhua morhua is the most common, and is found from both the western and eastern north Atlantic. Gadus morhua callarias is a low salinity non-migratory race found in the Baltic, and Gadus morhua marisalba occurs in the White Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The cod is a relatively large and stout bodied fish with a large head and long chin barbel. It has three dorsal fins and two anal fins which are all rounded in outline. The colour can vary from greenish-grey with orange-brown or grey mottling. It has a conspicuous white lateral line. Adult fish can grow to approximately 1.7m although most are less than 1.2m. The large head, stout body, mottled coloration and distinctive white lateral line distinguish the cod from other members of the cod family.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Atlantic (including Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, Birkenfels (shipwreck), British Isles, Davis Strait, Dutch Exclusive Economic Zone, European waters (ERMS scope), FAO fishing area 21, Grevelingen, Gulf of Maine, Gulf of St. Lawrence, Hudson Strait, Irish Exclusive economic Zone, North West Atlantic, Oostduinkerke, Oosterschelde, Polish Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic and Arctic: Ungava Bay in Canada along the North American coast to Cape Hatteras; North Carolina in the western Atlantic. East and west coast of Greenland; around Iceland; from Barents Sea including the region around Bear Island along the European coast to Bay of Biscay (Ref. 88171).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gadus morhua is commonly known as Atlantic cod and can be found along the eastern and northern coasts of North America, along the coasts of Greenland, and from the Bay of Biscay north to the Arctic Ocean, including the Atlantic waters around Iceland, the North Sea, and the Barents Sea.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

southern Baffin Island to Cape Hatteras
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic (including Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Atlantic: The range extends from northern Labrador to Nantucket Shoals and from West Greenland, Davis Strait, Resolution Island and Hudson Strait in the west. Cod are taken as far south as the northern part of the North Carolina coast during winter. Eastern North Atlantic: The range extends from Nova Zembla, Spitzbergen, and Bear Island in the north to the northern part of the Bay of Biscay in the south, also into the Baltic up to Finland.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Atlantic cod range from the north and eastern coast of North America, around the southern tip of Greenland across the north Atlantic to the waters around Iceland, the Faroes, the North Sea and the Barents Sea. It is found all around the British coast, reaching south to the Bay of Biscay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 44 - 55; Analspines: 0; Analsoft rays: 33 - 45; Vertebrae: 51 - 55
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Atlantic cod reach a maximum length of 150 to 200 cm. On average, cod weigh 40 kg and the greatest recorded weight is 96 kg. The color of Atlantic cod varies with respect to the enviroment in which the fish lives. Water with large volumes of algae will yield a red to greenish skin color. A pale grey color is more prevalent for fish found on the ocean floor or on sandy bottoms. The Atlantic cod has 1 chin barbel, 3 dorsal fins, and 2 anal fins. It also has a pronounced lateral line from the gills to the tail (Wildscreen and U.K. Charity 2004). The coloring of cod is often shaded from top to bottom. The dorsal area of the fish may be a rich brown to green and fade to silver towards the ventral side. Some cod may have brown/red spots on the sides and back.

Range mass: 96 (high) kg.

Average mass: 40 kg.

Range length: 200 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 96.0 kg (Ref. 9988); max. reported age: 25 years (Ref. 173)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 200 cm TL (male/unsexed); max. weight: 96 kg .
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Protruding upper jaw, a conspicuous barbel on the lower jaw, and light lateral line, curved above the pectoral fins. Predorsal distance is less than one third of total length; body depth about 1/5 of total length. Color varies from brownish to greenish or gray dorsally and on upper sides, becoming pale and silvery ventrally. Peritoneum silvery.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 600m.

Habitat: benthopelagic. This species is widely distributed in a variety of habitats from the shoreline to well down the continental shelf. Two stocks are recognized in the brackish Baltic Sea. Cod feeds at dawn or dusk on invertebrates and fish, including young cod. Forms schools during the day. Spawns once a year. Marketed fresh, dried/salted, smoked and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 600 m (Ref. 1371), usually 150 - 200 m (Ref. 54441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic cod are marine benthopelagic fish, living near the bottom and in the open ocean (Riede 2004). Cod also inhabit brackish waters. Cod can be found in a wide range of habitats within the ocean, from the shoreline down to the continental shelf. They can be found at depths of 500 to 600 meters in coastal waters and are also numerous in open ocean waters. These fish are located in a temperate climate with a range in temperature from 0 to 20 degrees Celsius. Geographically the majority of the population lies within a latitude of 80 to 35 degrees north (Frimodt 1995).

Range depth: 600 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found from the shoreline to the edge of the continental slope.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 470642 specimens in 1 taxon.
Water temperature and chemistry ranges based on 253450 samples.

Environmental ranges
  Depth range (m): -9 - 975
  Temperature range (°C): -2.072 - 15.532
  Nitrate (umol/L): 1.139 - 26.300
  Salinity (PPS): 6.094 - 35.639
  Oxygen (ml/l): 0.573 - 8.544
  Phosphate (umol/l): 0.223 - 3.328
  Silicate (umol/l): 0.987 - 72.643

Graphical representation

Depth range (m): -9 - 975

Temperature range (°C): -2.072 - 15.532

Nitrate (umol/L): 1.139 - 26.300

Salinity (PPS): 6.094 - 35.639

Oxygen (ml/l): 0.573 - 8.544

Phosphate (umol/l): 0.223 - 3.328

Silicate (umol/l): 0.987 - 72.643
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Cod prefer cold temperate waters and can be found from the shoreline down to depths of 600 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 600m.
From 1 to 600 meters.

Habitat: benthopelagic. This species is widely distributed in a variety of habitats from the shoreline to well down the continental shelf. Two stocks are recognized in the brackish Baltic Sea. Cod feeds at dawn or dusk on invertebrates and fish, including young cod. Forms schools during the day. Spawns once a year. Marketed fresh, dried/salted, smoked and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; brackish; marine; depth range 1 - 600 m. Found over a wide range of habitats. Forms schools during the day.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic cod can be found in coastal waters with depths of 500 to 600 metres, and in the open ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The cod occurs in a wide variety of habitats from the shore down to depths of 600m. Divers usually encounter cod near rocky areas or around wrecks. They feed on a range of crustaceans, worms, brittle-stars and small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Opportunistic predator that forages mainly at dawn and dusk (Refs. 1371, 46189). Larvae feed mainly on zooplankton while juveniles prey predominantly on benthic crustaceans; adults feed mainly on zoobenthos and fish (Refs. 5743, 9604, 26813) including juvenile cod. Fish prey becomes more common in the diet with increasing body size (Refs. 1371, 89387). Adults may cover large distances during the feeding period (Ref. 89387). Young cod are also preyed upon by different fish species and octopus. Adult cod are prey items of top predators like sharks, rays, whales, dolphins, seals, and sea birds (Refs. 9023, 9581, 26954, 43651, 45735).In the Baltic it grows up to 5 kg weight in 7-8 years; in the North Sea it reaches 8 kg in the same time span . Natural mortality for adults of both stocks is assumed to be around M=0.2, resulting in a mean adult life expectancy and mean duration of the reproductive phase of 5 years (Ref. 88171).Parasites of the species include protozoans (trypanosome), myxosporidians, monogeneid, trematodes, cestodes, nematodes, acanthocephalan, hirudinid and copepods (Ref. 5951).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The diet of Atlantic cod is best described as opportunistic because they feed on anything they are capable of capturing. At all life stages, however, they eat primarily other animals. During the larval stage they feed on smaller organisms such as zooplankton. Juveniles feed on shrimp and other small crustaceans. Adult Atlantic cod consume squid, mussels, clams, tunicates, comb jellies, brittle stars, sand dollars, sea cucumbers, and polychaetes, and are also cannibalistic. The choice of prey included in the diet seems to play a role in determining the skin color of cod. Those that feed on crustaceans tend to appear more brownish in color whereas a blue-green pigment may be the result of a diet consisting primarily of fish.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: phytoplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Omnivorous, feeds at dawn or dusk on invertebrates and fish.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The main role that Atlantic cod have in the ecosystem is their involvement in the food chain. Atlantic cod feed upon a variety of organisms such as invertebrates, crustaceans, and zooplankton. Larger marine organisms (i.e. sharks, seals) prey upon and consume Atlantic cod. The interplay between predators and prey is the key way in which cod influence their ecosystem. No information concerning specific relationships (mutualism, parasitism, etc.) was available.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Atlantic cod populations respond differently to predators depending on what region of the Atlantic Ocean they occupy. Atlantic cod are susceptible to being consumed by large marine mammals (harp and harbor seals) and sharks. In the northwest Atlantic Ocean most of the large predatory fish have been removed and cod (and similar species) act as dominant predators in this region. In other parts of the Atlantic Ocean with large harp seal populations the number of Atlantic cod has been greatly reduced due to consumption by seals.  Cod larvae are vulnerable to smaller predators such as zooplankton. Juveniles are preyed on by species such as dogfish, squid, and halibut. Cannibalistic behavior becomes apparent as adult Atlantic cod readily consume juveniles. Although adult Atlantic cod have relatively few predators compared to their young, they still must be on the lookout for large marine animals. The greatest predatory threats to cod are those that lurk above the surface. Humans are responsible for drastically lowering Atlantic cod populations through well-developed fisheries. The economy of several regions is dependent upon these fisheries and the great demand for large numbers of Atlantic cod has resulted in overfishing and reduced cod stocks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Ulcer (l.). Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ulcer (e.). Others
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tumor of skin. Neoplasia (tumors of unknown origin)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleistophora disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lernaeocera Disease (l.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clavella Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black spot Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ascaridatosis (adult and juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is limited information available on the communication among cod. Atlantic cod are hypothesized to communicate through the production of sound via drumming muscles. Sound production is correlated with mate selection during spawning season. It is hypothesized that the degree to which males are able to produce acoustic sound is positively associated with the overall fitness of the males, with those having larger drumming muscles producing greater sound waves and out-competing others.

Communication Channels: acoustic

Perception Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Spawning occurs in winter and beginning of spring, where big schools are formed. Spawning sites are in offshore waters, at or near the bottom, in 50-200 m depth and 0-12 °C (preferred range 0-6°C) (Refs. 1371, 89387). May form spawning aggregations in the water column when bottom temperatures are unsuitable (Ref. 1371). Different spawning areas may be used in subsequent years (Ref. 89387). Embryo development lasts about 14 days (at 6°C) and larval phase lasts about 3 months(at 8°C). Fecundity ranges from 2.5 million eggs in a 5 kg female to a record of 9 million eggs in a 34 kg female. Reported number of batches spawned in an experiment is 8 - 22 (Ref. 5513). Sex ratio is nearly 50%, with slight predominance of females. Classified as a determinate multiple spawner (Ref. 40290). Older and larger cod had been found to produce larger eggs with neutral buoyancy at lower salinities. This can be crucial to egg and larval survival (Refs. 31930, 38384). Larvae are pelagic up to 2.5 months before settling on the bottom (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Atlantic cod pass through a series of four life history stages as they develop. Initially they begin as pelagic eggs which are located in harbors, bays, and offshore banks. The eggs are associated with an incubation temperature around 2 to 8.5 degrees Celsius. The eggs are buoyant and remain close to the surface waters. Studies have shown that egg mortality is independent of temperature but increases at lower salinities. Next, the larval stage takes place. Larvae are located in pelagic waters and their growth is correlated with the volume of zooplankton which can feed upon the sac larvae at this stage. During the third stage, juveniles occur in coastal and offshore waters in the summer and deeper waters in the winter. They are tolerant of temperature changes from 6 to 20 degrees Celsius and they often use vegetation as a predator avoidance strategy. The final stage is adulthood. They live at temperatures less than 10 degrees Celsius and primarily inhabit the ocean floor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Atlantic cod can reach a maximum lifespan in excess of 20 years, with a minimum lifespan of a few hours/days (shortly after the eggs are released). Within the last 100 years typical lifespans have changed drastically as a result of commercial cod fisheries. Most recently, fisheries have begun harvesting younger fish.

Range lifespan

Status: wild:
0 to 20 years.

Average lifespan

Status: wild:
16.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

There is a limited amount of information on Atlantic cod spawning behavior which may suggest complex mating systems. Researchers are aware that mating behavior in Atlantic cod can include reproductive strategies such as sound production by males and mate selection by females. Although these behaviors have been observed, the causes and consequences of such behavior, and their specific interplay within the mating systems continue to be studied. Atlantic cod are considered "batch-spawners", as females only release 5 to 25% of their total egg complement at any time.

One study on the acoustic sound production of Atlantic cod provides some insight into possible mating behaviors. Drumming muscles are present in both males and females, yet males tend to have more pronounced muscles. The mass of the drumming muscles increases in males prior to spawning and larger males have larger muscles. This suggests that the amplitude of sound production might be a determinant in the success of spawning and selection by females. Observations of Atlantic cod behavior support the hypothesis that females are responsible for mate selection. The biology of the drumming muscles in males, as well as the circling behavior of numerous males around prospective females supports the female selection hypothesis. It is worth noting that dominance hierarchies can also be established. Males with greater body sizes and those who were successful in spawning sometimes appear to dominate the population and act aggressively towards “lesser” males.

Recent research suggests that anthropogenic noise pollution in the water (via oil/gas exploration and drilling) could pose a threat to the success of sound production and the role it plays in the reproduction process.

Mating System: polygynandrous (promiscuous)

Many stocks of cod exhibit migratory behavior during their reproduction season due to seasonal variations in water temperature. Typically, a cod population moves into warmer waters during winter and early spring to begin spawning. Although spawning can occur year round, peak spawning levels occur in the winter and spring. As the population moves inshore it may disperse temporarily to feed if large amounts of prey are present. Cod spawn annually, and spawning takes place within a three month period. Cod employ a ventral mount position in which a male uses his pelvic fins to clasp onto a female and then position himself properly beneath her. Cod spawn in dense concentrations of more than 1 fish per cubic meter and multiple pairs of fish can be observed spawning in the same water column. Spawning occurs near the ocean bottom in temperatures between 5 to 7 degrees Celsius. The eggs that are produced are pelagic, and drift (often towards the surface) for approximately 2 to 3 weeks before hatching and reaching the larval stage. There is some debate as to the age of sexual maturity for cod. Age and size at maturity often vary amongst different populations with northeastern populations maturing around 5 to 7 years and southern populations maturing between 2 to 3 years. A recent finding suggests that cod are moving towards a reduction in age and size for sexually mature fish. In 1959 the median age of maturity was 6.3 years for females and 5.4 years for males. In 1979 the age of maturity was listed as 2.8 years for both sexes. Now, the median age of sexual maturity is between 1.7 to 2.3 years and corresponds to a length of 32 to 41 cm.

Breeding interval: Spawning takes place once a year for a duration of 3 weeks to 3 months.

Breeding season: Breeding csn occur year round; peak spawning recorded in winter/spring months.

Range number of offspring: 9 million (high) .

Average time to hatching: 2 to 3 weeks.

Range age at sexual or reproductive maturity (female): 1.7 to 5.4 years.

Range age at sexual or reproductive maturity (male): 1.7 to 7 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is no indication that any parental involvement exists on the behalf of either females or males after the eggs are released. The high mortality rate of the offspring (eggs) is attributed, in part, to the lack of parental care. The reproductive strategy of high fecundity levels may be a response to the absence of protection the eggs receive once released into the water. Although the survival rate is low, the sheer number of eggs produced is huge.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cod spawn at or near the bottom when temperatures are between 0 and 12°C. Eight to 22 batches have been spawned under experimental conditions. Sex ratio is nearly 50%, with slightly more females than males.
  • Bigelow, H.B. and Schroeder, W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Kjesbu, O.S., H. Kryvi, S. Sundby and P. Solemdal, 1992.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gadus morhua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATTCGAGCAGAGCTAAGTCAACCTGGTGCACTTCTTGGTGAT---GATCAAATTTATAATGTGATCGTTACAGCGCACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTTGGGAACTGACTCATTCCTCTAATGATCGGTGCACCAGATATAGCTTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTTCCTCCATCTTTCCTGCTCCTTTTAGCATCCTCTGGTGTAGAAGCTGGGGCTGGAACAGGCTGAACTGTCTATCCACCTTTAGCCGGAAACCTCGCTCATGCTGGGGCATCTGTTGATCTCACTATTTTTTCTCTTCATCTAGCAGGGATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCTCCGGCAATTTCACAGTACCAAACACCCCTATTTGTTTGAGCAGTACTAATTACAGCTGTGCTTCTACTATTATCTCTCCCCGTCTTAGCAGCTGGTATCACAATACTTCTAACTGACCGTAATCTTAATACTTCTTTCTTTGACCCTGCTGGAGGAGGTGATCCCATTTTATACCAACACTTATTCTGATTCTTCGGGCATCCCGAAGTTTATATTCTTATTTTACCCGGCTTCGGAATAATTTCCCACATCGTAGCATACTACTCAGGTAAAAAAGAACCCTTCGGGTATATGGGTATAGTCTGAGCTATGATGGCTATTGGCCTCCTTGGCTTTATTGTATGAGCCCATCACATGTTTACAGTCGGAATGGACGTAGACACACGTGCTTACTTTACATCTGCAACTATAATTATTGCCATTCCAACAGGTGTAAAAGTCTTTAGCTGATTAGCAACTTTACATGGGGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gadus morhua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 91
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1bd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sobel, J.

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic cod was listed as a vulnerable species in 1996. In the early 1990’s many cod populations collapsed in areas where commercial fishing was intense. The collapse is attributed to overfishing, and specifically to the commercial fishing of older/larger cod which resulted in a smaller population of fertile females and the harvesting of young fish before they have had a chance to mature and reproduce. The prosperity that fishermen enjoyed prior to the collapse lured many into the commercial fisheries and as a result the cod population was negatively affected.

Some efforts have been made to help certain cod populations rebound. Moratoriums and fishing regulations were placed in regions of Canada but were unsuccessful in maintaining or increasing population size. The main deterrent in properly managing cod stocks relates to the geographic range which the cod occupy. Cod are found throughout the waters of the Atlantic, and since these are international waters it makes it difficult for any one region to impose certain regulations. Research shows that populations can easily fall below the “Safe Biological Limits,” which represent the number of fish needed to maintain a proper population. Biologists argue that regulation alone will not be enough to keep the cod population at a sustainable level, but it is a start. Suggestions such as no-catch zones in areas of spawning and along migration routes may be helpful if enacted. As cod stocks move towards critically low levels, it is apparent that serious conservation efforts must be put into place to prevent the devastation of this important fish species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not subject to specific protection, but listed by the International Council for the Exploration of the Seas (ICES) as below Safe Biological Limits (SBL).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A1bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In Canada, threats to persistence include fishing (now halted), predation by fish and seals, and natural and fishing-induced changes to the ecosystem; Cod in Arctic waters, which occur mostly in a few coastal salt lakes, are sensitive to human activities, and poorly regulated fishing is a potential threat (COSEWIC, May 2003, http://www.cosewic.gc.ca/htmlDocuments/Detailed_Species_Assessment_e.htm).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Atlantic cod is a fish in crisis. The fish stocks in the Irish Sea have fallen drastically within the last few years. Recent figures compiled and published by the European Environment Agency (EEA) warn that the risk of a collapse of the fish stock in the North Sea is high, and that populations are now outside safe biological limits. The spawning stock biomass (the breeding population of the fish) hit an historic low figure during 2001, and during February and April that year, much of the North Sea was closed to fishing fleets as part of an emergency plan to protect young cod. It is also thought that the spawning stock biomass for the North Sea has been below the 'biomass precautionary approach reference point' - the critical level for sustaining the population - for almost two decades, and this warning also applies to waters adjacent to the North Sea. Throughout its range, the harvesting of young fish before they have been able to reproduce successfully is a serious threat to Atlantic cod.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The Atlantic cod is listed in the UK Biodiversity Grouped Action Plan for commercial marine fish. Being a species that is found in international waters, it has proved very difficult to impose restrictions on the number of fish that can be harvested from the sea without reducing fish stocks below the important Safe Biological Figure (SBF) limits. The International Council for the Exploration of the Sea (ICES) released figures for the North East Atlantic and Baltic in 2001, which show cod are still being overfished within six of the nine sea areas of the study. Currently, cod caught in Icelandic waters are the only stock regarded as being sustainably fished. In January of 2003, the European Union (EU) revised its Common Fisheries Policy (CFP), but whether this will lead to improvements in the way the fishing industry is regulated remains to be seen. Although the fish that are landed in port are controlled through the rules governing total allowable catch (TAC), the regulations do not limit the numbers of fish actually caught. A boat's crew, having checked the catch and finding either bycatch (non-target fish or other animals) or fish below the legal size, will simply jettison those fish overboard. Most of them will be dead. Many marine biologists argue that regulation alone will not be enough to maintain fish stocks at a sustainable level. The present status of the Atlantic cod stock seems to support this statement. Perhaps the only hope for the future of this fish, and the other commercial species, is the imposition of no-catch zones, including some of the principal migration routes, and areas where fish can spawn undisturbed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Although Atlantic cod have been an economic asset to humans, they can also create problems for economies based solely on cod fisheries. Those who depend upon the success of cod fisheries as a source of income can be hurt financially if fisheries fail. The collapse of the cod fisheries in the 1990’s took a toll on the economies of New England and Canada. In this case, the stocks were not managed properly and resulted in a 96% decrease in population size since 1850. Fishermen who rely on the cod population to make a living are left with financial burdens when the stock collapses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Atlantic cod provide an extremely important fishery in many regions especially in the northwest Atlantic. The success of this commercial fishery has been the main source of economic wealth for areas such as New England and Canada, with Atlantic cod even being labeled “Newfoundland currency”. Up until the 1990’s, Atlantic cod was not only an economic mainstay for many people but also a dominant member of the food chain within the waters of the Atlantic. Atlantic cod is marketed widely, primarily for human consumption. The flesh is mild and Atlantic cod are a popular table fish. The liver of Atlantic cod is also processed to produce cod liver oil which is used as a vitamin supplement.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic Cod with Miso

I hope that you will give this recipe a try, because it’s definitely worth the time and effort.

There are essentially only 4 ingredients that you will need to marinate the fish.

Combine 1/4 cup sake, 1/4 cup mirin, 4 tbsp of miso paste, and 3 tbsp of sugar.

Take 4 pieces of cod and put it into a ziploc bag with the miso marinade. Leave it in the fridge overnight.

When it's ready to be cooked, sear both sides of the cod on a skillet until you see the highlights of sugar caramelization.

The fish goes into a 400-degree oven for about 7-10 minutes.

We wanted to add a side of vegetables with our fish, so we made honey-ginger carrots. Julienne the carrots and blanch them in boiling water for about 5-7 minutes until soft. Melt 2 tbsp of butter together with 1 tbsp honey and 1 tbsp minced ginger. Then add the carrots and mix together.

Place the cod on a bed of honey-ginger carrots and drizzle with some of the marinade (heat the marinade in the skillet first since it touched raw fish).

You will be amazed at how delicate and refreshing the flavors are. This is surely one of my favorite fish recipes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eli E. Agbayani

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Wikipedia

Atlantic cod

The Atlantic cod (Gadus morhua) is a well-known benthopelagic food fish belonging to the family Gadidae. It is also commercially known as cod, codling or haberdine.[2]

In the western Atlantic Ocean, cod has a distribution north of Cape Hatteras, North Carolina, and around both coasts of Greenland; in the eastern Atlantic, it is found from the Bay of Biscay north to the Arctic Ocean, including the Baltic Sea, the North Sea, Sea of the Hebrides,[3] areas around Iceland and the Barents Sea.

It can grow to 2 meters in length and weigh up to 96 kilograms (210 lb). It can live for 25 years and sexual maturity is generally attained between ages two and four,[4] but can be as late as eight years in the northeast Arctic.[5] Colouring is brown to green, with spots on the dorsal side, shading to silver ventrally. A lateral line is clearly visible. Its habitat ranges from the shoreline down to the continental shelf.

Several cod stocks collapsed in the 1990s (declined by >95% of maximum historical biomass) and have failed to recover even with the cessation of fishing.[6] This absence of the apex predator has led to a trophic cascade in many areas.[6] Many other cod stocks remain at risk. The "Atlantic cod" is labelled VU (vulnerable) on the IUCN Red List of Threatened Species.[7]

Contents

Lifecycle [edit]

Atlantic cod juvenile

Adult cod form spawning aggregations from late winter to spring.[8][9] Females release their eggs in batches,[10] and males compete to fertilize them.[11][12][13] Fertilized eggs drift with ocean currents and develop into larvae. Age of maturation varies between cod stocks, from ages two to four in the west Atlantic,[14] but as late as eight years in the northeast Arctic.[5] Cod can live for 13 years or more.[15]

Parasites [edit]

Atlantic cod act as intermediate, paratenic or definitive hosts to a large number of parasite species: 107 taxa listed by Hemmingsen and MacKenzie (2001)[16] and seven new records by Perdiguero-Alonso et al. (2008).[16] The predominant groups of cod parasites in the northeast Atlantic were trematodes (19 species) and nematodes (13 species), including larval anisakids, which comprised 58.2% of the total number of individuals.[16] Parasites of Atlantic cod include copepods, digeneans, monogeneans, acanthocephalans, cestodes, nematodes, myxozoans and protozoans:[16]

Fisheries [edit]

Global capture of all Atlantic cod in tonnes reported by the FAO, 1950–2010[17]
Capture of Atlantic cod 1950-2005, (FAO)

Northwest Atlantic cod [edit]

The northwest Atlantic cod has been regarded as heavily overfished throughout its range, resulting in a crash in the fishery in the United States and Canada during the early 1990s.

Newfoundland's northern cod fishery can be traced back to the 16th century. On average, about 300,000 tonnes of cod were landed annually until the 1960s, when advances in technology enabled factory trawlers to take larger catches. By 1968, landings for the fish peaked at 800,000 tonnes before a gradual decline set in. With the reopening of the limited cod fisheries in 2006, nearly 2,700 tonnes of cod were hauled in. In 2007, offshore cod stocks were estimated at one per cent of what they were in 1977.[18]

Technologies that contributed to the collapse of Atlantic cod include engine-powered vessels and frozen food compartments aboard ships. Engine-powered vessels had larger nets, greater range, and better navigation. The capacity to catch fish became limitless. In addition, sonar technology gave an edge to catching and detecting fish. Sonar was originally developed during WWII to locate enemy submarines, but was later applied to locating schools of fish. These new technologies, as well as bottom trawlers that destroyed entire ecosystems, contributed to the collapse of Atlantic cod. They were vastly different from old techniques used, such as hand lines and long lines.[19]

The fishery has yet to recover, and may not recover at all because of a possibly stable change in the food chain. Atlantic cod was a top-tier predator, along with haddock, flounder and hake, feeding upon smaller prey, such as herring, capelin, shrimp and snow crab.[6] With the large predatory fish removed, their prey have had population explosions and have become the top predators, affecting the survival rates of cod eggs and fry.

Atlantic cod are demersal fish which prefer sea bottoms with coarse sediments [20]

In the winter of 2011-2012, the cod fishery succeeded in convincing NOAA to postpone for one year the planned 82% reduction in catch limits. Instead the limit will be reduced by 22%. The fishery brought in $15.8 million in 2010, coming second behind Georges Bank haddock among the region’s 20 regulated bottom-dwelling groundfish. Data released in 2011 indicated that even closing the fishery would not allow populations to rebound by 2014 to levels required under federal law. Restrictions on cod effectively limit fishing on other groundfish species with which the cod swim, such as flounder and haddock.[21]

Cod populations or stocks can differ significantly both in appearance and biology. For instance, the cod stocks of the Baltic Sea are adapted to low-salinity water. Organisations such as the Northwest Atlantic Fishery Organization (NAFO) and ICES divide the cod into management units or stocks; however, these units are not always biologically distinguishable stocks. Some major stocks/management units on the Canadian/US shelf (see map of NAFO areas) are the Southern Labrador-Eastern Newfoundland stock (NAFO divisions 2J3KL), the Northern Gulf of St. Lawrence stock (NAFO divisions 3Pn4RS), the Northern Scotian Shelf stock (NAFO divisions 4VsW), which all lie in Canadian waters, and the Georges Bank and Gulf of Maine stocks in United States waters. In the European Atlantic, the numerous separate stocks are on the shelves of Iceland, the coast of Norway, the Barents Sea, the Faroe Islands, off western Scotland, the North Sea, the Irish Sea, the Celtic Sea and in the Baltic Sea.

Northeast Atlantic cod [edit]

Estimated biomass of the Atlantic cod northeast Arctic stock, 1959-2008 in million tonnes [22]

The northeast Atlantic has the world's largest population of cod. By far, the largest part of this population is the northeast Arctic cod, as it is labelled by the ICES, or the Arcto-Norwegian cod stock, also referred to as skrei, a Norwegian name meaning something like "the wanderer", distinguishing it from coastal cod. The northeast Arctic cod is found in the Barents Sea area. This stock spawns in March and April along the Norwegian coast, about 40% around the Lofoten archipelago. Newly hatched larvae drift northwards with the coastal current while feeding on larval copepods. By summer, the young cod reach the Barents Sea where they stay for the rest of their life, until their spawning migration. As the cod grow, they feed on krill and other small crustaceans and fish. Adult cod primarily feed on fish such as capelin and herring. The northeast Arctic cod also shows cannibalistic behaviour. Estimated stock size was 2.26 million tonnes in 2008.

The North Sea cod stock is primarily fished by European Union member states and Norway. In 1999, the catch was divided among Denmark (31%), Scotland (25%), the rest of the United Kingdom (12%), the Netherlands (10%), Belgium, Germany and Norway (17%). In the 1970s, the annual catch rose to between 200,000 and 300,000 tons. Due to concerns about overfishing, catch quotas were repeatedly reduced in the 1980s and 1990s. In 2003, ICES stated there is a high risk of stock collapse if then current exploitation levels continued, and recommended a moratorium on catching Atlantic cod in the North Sea during 2004. However, agriculture and fisheries ministers from the Council of the European Union endorsed the EU/Norway Agreement and set the total allowable catch (TAC) at 27,300 tons. Seafood sustainability guides, such as the Monterey Bay Aquarium's Seafood Watch, often recommend environmentally conscious customers not purchase Atlantic cod.

The stock of northeast Arctic cod was more than a million tons following World War II, but declined to a historic minimum of 118,000 tons in 1987. The catch reached a historic maximum of 1,343,000 tons in 1956, and bottomed out at 212,000 tons in 1990. Since 2000, the spawning stock has increased quite quickly, helped by low fishing pressure. However, there are worries about a decreased age at first spawning (often an early sign of stock collapse), combined with the level of discards and unreported catches. The total catch in 2003 was 521,949 tons, the major fishers being Norway (191,976 tons) and Russia (182,160 tons).

See also [edit]

References [edit]

This article incorporates CC-BY-2.0 text from the reference.[16]

  1. ^ J. Sobel (1996). "Gadus morhua". IUCN Red List of Threatened Species. Version 2.3. International Union for Conservation of Nature. Retrieved July 5, 2011. 
  2. ^ Atlantic Cod. Seafood Portal.
  3. ^ C.Michael Hogan, (2011) Sea of the Hebrides. Eds. P. Saundry & C.J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC.
  4. ^ O’Brien, L., J. Burnett, and R. K. Mayo. (1993) Maturation of Nineteen Species of Finfish off the Northeast Coast of the United States, 1985-1990. NOAA Tech. Report. NMFS 113, 66 p.
  5. ^ a b ICES (2007), Arctic Fisheries Working Group Report, Section 03, Table 3.5, International Council for the Exploration of the Sea (accessed 2008/12/11)
  6. ^ a b c Kenneth T. Frank, Brian Petrie, Jae S. Choi, William C. Leggett (2005). "Trophic Cascades in a Formerly Cod-Dominated Ecosystem". Science 308 (5728): 1621–1623. doi:10.1126/science.1113075. PMID 15947186. 
  7. ^ J. Sobel (1996). "Gadus morhua". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved February 5, 2010. 
  8. ^ K. M. Brander (1994). "The location and timing of cod spawning around the British Isles". ICES Journal of Marine Science 51 (1): 71–89. doi:10.1006/jmsc.1994.1007. 
  9. ^ Kai Wieland, Astrid Jarre-Teichmann & Katarzyna Horbowa (2000). "Changes in the timing of spawning of Baltic cod: possible causes and implications for recruitment". ICES Journal of Marine Science 57 (2): 452–464. doi:10.1006/jmsc.1999.0522. 
  10. ^ Scott, Beth E.; Marteinsdottir, Gudrun; Begg, Gavin A.; Wright, Peter J.; Kjesbu, Olav Sigurd (2005). "Effects of population size/age structure, condition and temporal dynamics of spawning on reproductive output in Atlantic cod (Gadus morhua)". Ecological Modelling 191 (3-4): 383–415. doi:10.1016/j.ecolmodel.2005.05.015. 
  11. ^ J. A. Hutchings, T. D. Bishop, C. R. McGregor-Shaw (1999). "Spawning behaviour of Atlantic cod, Gadus morhua: evidence of mate competition and mate choice in a broadcast spawner". Canadian Journal of Fisheries and Aquatic Sciences 56 (1): 97–104. doi:10.1139/cjfas-56-1-97. 
  12. ^ J. T. Nordeide; Folstad (2000). "Is cod lekking or a promiscuous group spawner?". Fish and Fisheries 1 (1): 90–93. doi:10.1046/j.1467-2979.2000.00005.x. 
  13. ^ D. Bekkevold, M. M. Hansen & V. Loeschcke (2002). "Male reproductive competition in spawning aggregations of cod". Molecular Ecology 11 (1): 91–102. doi:10.1046/j.0962-1083.2001.01424.x. PMID 11903907. 
  14. ^ O'Brien, L., J. Burnett, and R. K. Mayo. (1993) Maturation of Nineteen Species of Finfish off the Northeast Coast of the United States, 1985-1990. NOAA Tech. Report. NMFS 113, 66 p.
  15. ^ ICES (2007), Arctic Fisheries Working Group Report, Section 03, International Council for the Exploration of the Sea (accessed 2008/12/11)
  16. ^ a b c d e Perdiguero-Alonso D., Montero F. E., Raga J. A. & Kostadinova A. (2008). "Composition and structure of the parasite faunas of cod, Gadus morhua L. (Teleostei: Gadidae), in the North East Atlantic". Parasites & Vectors 2008, 1: 23. doi:10.1186/1756-3305-1-23
  17. ^ Gadus morhua (Linnaeus, 1758) FAO, Species Fact Sheet. Retrieved April 2012.
  18. ^ "N.L. funds cod fishery research on 15th anniversary of moratorium". CBC News. July 2, 2007. 
  19. ^ Freedman, Bill. "Atlantic Cod and its fishery". Codfishes: Atlantic Cod and its fishery, 2008. 3 November 2008 Free Site Search Engine
  20. ^ Atlantic cod NOAA FishWatch. Retrieved 5 November 2012.
  21. ^ "Cod Fishermen’s Alarm Outlasts Reprieve on Catch Limits". The New York Times. 12 February 2012. 
  22. ^ Arctic Fisheries Working Group of ICES, published in the ICES Report AFWG CM 2009, ACOM:2. The estimation method was standard VPA.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: DNA data for western North Atlantic populations reveal weak population genetic structuring that may reflect the recent age of populations rather than extensive gene flow among populations (Pogson et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!