Overview

Brief Summary

WhyReef - Lifestyle

The tiger shark is a loner and travels long distances, swimming up to 50 miles (80 km) a day at speeds over 20 mph (32 km/hr). During the day, it is sluggish and spends its time in deeper water. At night, you can find it hunting on the reef. Because it’s active at night, it is nocturnal.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Usually found near surface to depths of 140 m (Ref. 26938). Occurs on or adjacent to continental and insular shelves, frequenting river estuaries, off wharves and jetties in harbors, and in coral atolls and lagoons (Ref. 244). Bottom-associated, sometimes pelagic (Ref. 58302). Also off oceanic islands far from other islands and continental land masses (Ref. 244). Makes excursions in the open ocean, but is not a truly oceanic species (Ref. 244). Nocturnal feeder on other sharks, rays, bony fishes, marine mammals, tortoises, seabirds, sea snakes, squids, gastropods, crustaceans, detritus (Ref. 9997), also including toxic or armored fish species such as Lactoria cornuta or Diodon hystrix, porpoises, whales, sea turtles, cephalopods, domestic animals and humans (Ref. 37816). It also feeds on carrion and garbage, including cans, pieces of metal and burlap bags (Ref. 26938). Second only to Carcharodon carcharias in recorded attacks on humans with at least 27 documented attacks sourced to it . One specimen, reportedly taken off Indo-China, weighed 3,110 kg and measured 740 cm (Ref. 9987). May be kept in an aquaria, but does not last for more than a few months (Ref. 244). Ovoviviparous (Ref. 50449). Up to 80 young of 51 to 104 cm are born per litter (Ref. 1602). Valued for its meat, fins, hide and liver oil (Ref. 9997) and also for its jaws and cartilage (Ref.58048). Often used for fishmeal (Ref. 9997). Utilized fresh, dried-salted, smoked and frozen (Ref. 9987). Species from the Persian Gulf and Oman Sea has a max size of 750 cm TL (Ref. 47613).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Galeocerdo cuvier (Peron & Lesueur in Lesueur, 1822)

Tiger shark


Head, and body stout but becoming very slender towards tail; snout very short, blunt and slightly rounded (its length 0.7-1.1 of distance between nostrils); long groove over top of mouth to under eye; spiracle a narrow slit behind large, round eye; mouth large, wide; characteristic cockscomb teeth (serrated, front edge convex, oblique tip with a deep notch on lower rear side); strong ridge on back between dorsal fins; origin of dorsal fin over posterior corner of pectoral fin; first dorsal fin not very large (height 7.5-9.3% of TL) tip pointed, rear edge concave; origin of second dorsal fin distinctly in front of anal fin origin; a low keel along each side of the narrow tail base; tail strongly asymmetric, with sharp pointed tip, large pointed lower lobe.



Adults grey with vertical bars on upper half of sides (sometimes faint or absent); young with large dark spots, some coalescing to form bars.


Size: attains > 550 cm (1 record to 740 cm).

Habitat: coastal pelagic, often in turbid areas, and estuaries, but also on reefs; retires to deeper water during the day, and feeds on shallow reefs at night.

Depth: 0-350 m.

Circumtropical; throughout our region.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

The tiger shark is the top predator on the reef. It has excellent vision and an even better sense of smell, which allow it to detect even the tiniest amount of blood in water. The tiger shark even has special cells called electroreceptors that help it sense movement in the water. It circles its prey and taps it before it attack with its rows of razor sharp teeth.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Cargados Carajos, Comores, Djibouti, Eritrea, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Red Sea, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas. Western Atlantic: Massachusetts, USA to Uruguay, including Gulf of Mexico and the Caribbean. Eastern Atlantic: Iceland to Angola. Indo-Pacific: Red Sea and East Africa to Hawaii and Tahiti, north to southern Japan, south to New Zealand. Eastern Pacific: southern California, USA to Peru, including the Revillagigedo, Cocos, and Galapagos islands. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Tiger Shark has a worldwide distribution in tropical and warm temperate seas. Randall (1992) described its distribution as follows: 'In the western Atlantic it ranges from Cape Cod to Uruguay, including the Gulf of Mexico, Bermuda and islands of the Caribbean; in the eastern Atlantic it is found on the West African coast from Morocco to Angola; it remains unknown from the Mediterranean Sea, but there are reports from Iceland and the United Kingdom (these were probably based on vagrants transported there during a warm year by the Gulf Stream) (Compagno 1984). It occurs throughout the Indo-Pacific region from the northern Red Sea to South Africa and east through the islands of Oceania and northern New Zealand (though not yet reported from Easter Island); in the eastern Pacific it ranges from southern California to Peru, including the Galapagos and Revillagigedo Islands.'

Little is known of the Tiger Shark's depth range. Clark and Kristof (1990) illustrate a female Tiger Shark of about 250 cm total length (TL) from a photograph taken from a submersible in 350 m of water off Grand Cayman. The species is also encountered in very shallow water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tiger sharks are found in many subtropical and tropical waters, primarily from 45°N to 32°S. Tiger sharks have been sighted from the eastern coast of North America to the eastern coast of Brazil. This includes the coasts of southern North America, Mexico, and Latin America along the Gulf of Mexico. Tiger sharks also populate the coasts of China, India, Africa, Japan, and many islands of the Pacific Ocean.

Biogeographic Regions: nearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: cosmopolitan

  • Driggers III, W., G. Ingram Jr., M. Grace, C. Gledhill, T. Henwood, C. Horton, C. Jones. 2008. Pupping areas and mortality rates of young tiger sharks Galeocerdo cuvier in the western North Atlantic Ocean. Aquatic Biology, 2: 161-170.
  • Kneebone, J., L. Natanson, A. Andrews, W. Howell. 2008. Using bomb radiocarbon analyses to validate age and growth estimates for the tiger shark, Galeocerdo cuvier, in the western North Atlantic. Marine Biology, 154/3: 423-434.
  • Simpfendorfer, C. 2005. "Galeocerdo cuvier" (On-line). The IUCN Red List of Threatened Species. Accessed September 23, 2010 at http://www.iucnredlist.org/apps/redlist/details/39378/0.
  • Wirsing, A., M. Heithaus, L. Dill. 2007. Fear factor: Do dugongs (Dugong dugon) trade food for safety from tiger sharks (Galeocerdo cuvier)?. Oecologia, 153/4: 1031-1040.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumglobal in tropical and warm temperate seas; in the Atlantic strays as far north as Iceland and Norway; north to Cape Cod, strays into Gulf of Maine
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Red Sea, Seychelles, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the warmer waters of all oceans; straying northward as far as Cape Cod on the US coast of the Atlantic.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Smith, C.L., 1997; Myers, R. F., 1999; Compagno, L. J. V. and V. H. Niem, 1998; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 350 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Tiger sharks are one of the largest carnivores in the ocean. Juveniles have tiger-like stripes, which fade as they grow older. Tiger sharks are blue or green in color with a light yellow or white under-belly. This speices has a large blunt nose on the end of a wedge-shaped head. Tiger sharks have serrated teeth, making it easy to tear flesh and crack the bones and shells of their prey. They have a heterocercal tail, meaning the dorsal lobe of the caudal fin is longer than the ventral lobe. Adults range from 3.25 to 4.25 m in length, although tiger sharks of 6 to 7.5 m in length have been documented. Female tiger sharks are on average 2.92 m in length and are smaller than males, which are on average 3.20 m in length. Adult tiger sharks typically weigh 385 to 635 kg, with largest sharks reaching 862 kg.

Range mass: 385 to 862 kg.

Range length: 3.25 to 7.5 m.

Average length: females 2.92 m; males 3.20 m.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • 2010. "Tiger Shark: Galeocerdo Cuvier" (On-line). National Geographic. Accessed September 23, 2010 at http://animals.nationalgeographic.com/animals/fish/tiger-shark.html.
  • Heithaus, M., A. Frid, A. Wirsing, L. Dill, J. Fourqurean, D. Burkholder, J. Thomson, L. Bejder. 2007. State-dependent risk-taking by green sea turtles mediates top-down effects of tiger shark intimidation in a marine ecosystem. Journal of Animal Ecology, 76/5: 837–844.
  • Pratt, Jr., H. 1988. Elasmobranch Gonad Structure: A Description and Survey. Copeia, 1988/3: 719-729.
  • Read, T. 2010. Mark-recapture of tiger shark (galeocerdo cuvier) in New Caledonia: A photo-identification approach. Coral Reef Initiatives for the Pacific: 2-23.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 740.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 7400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

750 cm TL (male/unsexed; (Ref. 58784)); max. published weight: 807.4 kg (Ref. 4699); max. reported age: 50 years (Ref. 4827)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 740.0 cm TL; max. weight: 807 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Smith, C.L., 1997; Myers, R. F., 1999; Compagno, L. J. V. and V. H. Niem, 1998; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A huge, vertical tiger-striped shark with a broad, bluntly rounded snout, long upper labial furrows, and a big mouth with large, saw-edged, cockscomb-shaped teeth; spiracles present; caudal keels low (Ref. 5578). Grey above with vertical dark grey to black bars and spots which appear faded in adults, white below (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found in both coastal and oceanic waters, including estuaries. Nocturnal feeder on mammals, tortoises, birds, sea snakes, squids, gastropods, crustaceans, and detritus. Ovoviviparous. One of the most common of the large sharks in the tropics, second only to @Carcharodon carcharias@ in recorded attacks on humans. At least 27 documented attacks are sourced to it. The 910 cm record unconfirmed. One specimen, reportedly taken off Indo-China, weighed 3,110 kg and measured 740 cm (Ref. 9987). May be caught using longlines (Ref. 5213). Valued for its meat and fins as well as its excellent hide; utilized fresh, dried-salted, smoked and frozen (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Galeocerdo cuvier
Catalog Number: USNM 231757
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Java, Batavia, Java, Indonesia, Pacific
  • Type: van Kampen, P. N. 1907. Bull. Dept Agric. Ind. Neerl. 8: 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 371 m (Ref. 58302), usually 0 - ? m (Ref. 55191)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Randall (1992) reviewed a large number of studies on the feeding behaviour of Tiger Sharks, including Norman and Fraser (1937), Springer (1938), Whitley (1940), Bigelow and Schroeder (1948), Gudger (1948a,b, 1949), Kauffman (1950), Ikehara (1960), Springer in Gilbert (1963), Gohar and Mazhar (1964), Clark and von Schmidt (1965), Randall (1967, 1980), Tester (1969), Fujimoto and Sakuda (1972), Bass et al. (1975), De Crosta et al. (1984) and Stevens (1984). He concluded that this species has probably the most diverse diet of any shark species. Prey includes numerous bony fish, sharks, rays, turtles, sea birds, seals, dolphins, sea snakes, cephalopods, crabs, lobsters, gastropods and jellyfish. They consume carrion and readily take baited hooks. Tiger Sharks also have a propensity to consume ?garbage? of human origin, including plastics, metal, sacks, kitchen scraps and almost any other item discarded in the sea.

The age and growth characteristics of Tiger Sharks have been investigated by a number of authors, most notably De Crosta et al. (1984) and Branstetter et al. (1987). Working in the north-west Hawaiian Islands De Crosta et al. (1984) estimated that a Tiger Shark with a precaudal length of 200 cm is about five years old and that one of 300 cm is about 15 years old. Branstetter et al. (1987) used similar techniques to De Crosta et al. (1984) to produce growth curves for Tiger Sharks from the coast of Virginia and the northern Gulf of Mexico. They estimated that initial growth was very fast, but that the rate of growth of very large animals is 5?10 cm year-1; thus, individuals of 400?450 cm TL would be 20?25 years of age. Branstetter et al. (1987) gave a maximum age of 45?50 years. Smith et al. (1998) estimated the intrinsic rate of increase of a tiger shark population at MSY to be 0.043 year-1. Randall (1992) summarised that the size at maturity of male Tiger Sharks is 226?290 cm TL and in females 250?350 cm TL.

The Tiger Shark is the only species of the family Carcharhinidae that is ovoviviparous. Litter sizes are large, with between 10?82 embryos reported from a single female. Mean litter sizes of 30?35 have been reported (Tester 1969, Bass et al. 1975, Simpfendorfer 1992). The size at birth is 51?90 cm TL (Randall 1992, Simpfendorfer 1992). Clark and von Schmidt (1965) gave the gestation period as 13?16 months. There have been few other estimates of gestation period. Mating is reported to take place in the Northern Hemisphere in spring, with pupping the following spring to summer. Mating occurs before full-term females have given birth to young, indicating that litters are produced every two years or less. In the Southern Hemisphere Stevens and McLoughlin (1991) and Simpfendorfer (1992) have reported pupping during summer. The young are very slender with a flexible body and caudal fin; they swim with an inefficient anguilliform motion. Branstetter et al. (1987) concluded that they are probably very vulnerable to predation at this stage, especially by sharks, including their own kind.

Tagging studies, particularly in the western Atlantic, have provided the best information on the movements of Tiger Sharks. Randall (1992) provided data from a range of studies that indicated that two patterns of movement are observed in tagging studies. The first of these is where the release and recapture positions are close together, suggesting that the individual may have remained in a relatively small area. The other pattern observed is where the individual is recaptured a long distance from the release site, often after a short period at liberty. The maximum reported distance between release and recapture for a Tiger Shark was approximately 3,430 km.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tiger sharks are a saltwater species. Although they prefer the sea grass ecosystems of the costal areas, they occasionally inhabit other areas due to prey availability. Tiger sharks spend approximately 36 % of their time in shallow coastlne habitats (Heithaus et al., 2002), generally at depths of 2.5 to 145 m. This species, however, has been documented several kilometers from the shallow areas and at depths up to 350 m. Females are observed in shallow areas more often than males. Tiger sharks have also been documented in river estuaries and harbors

Range depth: 2.5 to 350 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

  • 2010. "Tiger Shark (Galeocerdo cuvier)" (On-line). Accessed October 14, 2010 at http://www.arkive.org/tiger-shark/galeocerdo-cuvier/.
  • Heithaus, M., L. Dill, G. Marshall, B. Buhleier. 2002. Habitat use and foraging behavior of tiger sharks (Galeocerdo cuvier) in a seagrass ecosystem. Marine Biology, 140/2: 237-248.
  • Heithaus, M., I. Hamilton, A. Wirsing, L. Dill. 2006. Validation of a randomization procedure to assess animal habitat preferences: microhabitat use of tiger sharks in a seagrass ecosystem. Journal of Animal Ecology, 75/3: 666-676.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 683 specimens in 1 taxon.
Water temperature and chemistry ranges based on 604 samples.

Environmental ranges
  Depth range (m): 0 - 8290
  Temperature range (°C): 2.068 - 26.525
  Nitrate (umol/L): 0.171 - 31.613
  Salinity (PPS): 34.202 - 36.558
  Oxygen (ml/l): 2.718 - 6.202
  Phosphate (umol/l): 0.083 - 2.007
  Silicate (umol/l): 0.777 - 59.370

Graphical representation

Depth range (m): 0 - 8290

Temperature range (°C): 2.068 - 26.525

Nitrate (umol/L): 0.171 - 31.613

Salinity (PPS): 34.202 - 36.558

Oxygen (ml/l): 2.718 - 6.202

Phosphate (umol/l): 0.083 - 2.007

Silicate (umol/l): 0.777 - 59.370
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 350m.
Recorded at 350 meters.

Habitat: pelagic. Tiger shark.  (Peron & Lesueur, 1822)  Vivaparous 23 - 46 pups. Attains 4.1 metres in our area; pups born at about 70 cm. Scavenger / Predator noted for indiscriminate feeding habits. The fearsome teeth, enormous size ( up to 5.5 metres in some areas ) and powerful jaws make it a formidable predator easily able to bite through the bony shell of a turtle or cut a large shark in half. Their usual food is sharks, rays and various other fishes. They also consume sea birds, marine mammals and a variety of the miscellaneous rubbish that man dumps in the sea. May attack man and is greatly feared by men wrecked beyond the reefs, but is more likely to feed upon humans already dead from other causes. A tropical species found in all major oceans; ranges south to Natal ( chiefly juveniles and adolescents ) and rarely to the Cape. An embryo from a large female caught at Cape St. Francis is in the Natal museum. A great deal of excitement was caused when these sharks were discovered sleeping in caves on the east coast of Mexico as it was always maintained that most streamlined sharks had to keep swimming to pass water through their gills to allow the required oxygen to be extracted. As far as is known these sharks have not been found sleeping in any other area and there is a theory that fresh water seeps into these caves causing a narcotic effect on the sharks which makes them extremely docile and approachable by divers. It is further theorised that the high freshwater content may loosen or kill parasites on the body of the shark.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine; depth range 0-350 m. Usually found near surface to depth of 140 m. on or adjacent to continental and insular shelves. Has been seen in river estuaries, off wharves and jetties, in coral atolls and lagoons, and off oceanic island far from other islands and continental land masses.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Smith, C.L., 1997; Myers, R. F., 1999; Compagno, L. J. V. and V. H. Niem, 1998; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Near Surface, Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Estuary, Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Tiger sharks travel along the continental shelf and farther offshore in rather random fashion. Found worldwide in tropical and temperate seas; a carnivore, pelagic species, occasionally advancing into coastal waters (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The diet of tiger sharks includes mollusks, birds, snakes, crustaceans, sea turtles, and dugongs. Serrated teeth give this species the ability to penetrate the shells of sea turtles. Tiger sharks often scavenge dead or injured whales, and large tiger sharks can survive several weeks without feeding. This species most likely relies on stealth rather than strength and speed to catch prey. They are well camouflaged, allowing them to get within striking range of prey. If prey flee, tiger sharks may back off, not taking part in high-speed pursuits. However, tiger sharks are capable of short bursts of speed once their prey are within range.

Animal Foods: birds; mammals; reptiles; fish; carrion ; mollusks; other marine invertebrates

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nocturnal feeder on other sharks and bony fishes, marine mammals, tortoises, seabirds, sea snakes, squids, gastropods, crustaceans, and carrion.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Smith, C.L., 1997; Myers, R. F., 1999; Compagno, L. J. V. and V. H. Niem, 1998; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes, sharks/rays, sea snakes/mammals/turtles/birds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As top predators in their ecosystem, it is possible that tiger sharks control populations of prey species, although this has not been verified. Tiger sharks also serve as a host for remoras, which are small suckerfish. Tiger sharks and remoras share a commensal relationship: remoras attach to tiger sharks near the underbelly, and use the shark for transportation and protection. Remoras also feed on materials dropped by tiger sharks. Recently, copepods, specifically sea louse, have been discovered around the eyes of tiger sharks in Australia.

Commensal/Parasitic Species:

  • Dill, L., M. Heithaus, C. Walters. 2003. Behaviorally Mediated Indirect Interactions in Marine Communities and Their Conservation Implications. Ecology, 84/5: 1151-1157.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tiger sharks are some of the largest predators in the ocean and have few species feed on them. Some juvenile tiger sharks, however, fall prey to other sharks. Female tiger sharks gives birth in a nursery, which provides protection during the birthing process and to pups in the absence of parents. The coloration of tiger sharks provides camouflage against predators as well. Humans also fish for tiger sharks.

Known Predators:

Anti-predator Adaptations: cryptic

  • Cressey, R., . Lachner. 1970. The parasitic copepod diet and life history of diskfishes (Echeneidae). Copeia, 1970/2: 310-318.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Galeocerdo cuvier preys on:
Phoebastria nigripes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Menu

The tiger shark is most certainly NOT a picky eater. It eats everything: lobsters, octopi, crabs, squids, fish, poisonous fish, sharks, turtles, sea snakes, sea birds, dolphins, whales, and even other tiger sharks! But it doesn’t stop there; it also eats non-sea animals and even trash. Here are some strange things that have been found in its stomach: chickens, dogs, cows, deer, humans, bottles, plastic bags, coal, coats, drums, and a chicken coop! When it has too much non-living junk in its stomach, it throws up and looks for more food. Meat is a tiger sharks preferred meal, but because it will eat anything, it is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tiger sharks rely on electromagnetic receptors to perceive their environment and to hunt prey. Sensing organs called Ampullae of Lorenzini, located on the end of their nose, are filled with a jelly-like substance that reads electromagnetic signals. These signals are sent from the pores to the sensory nerve, and then to the brain. While hunting, tiger sharks uses this ability to detect electromagnetic signals given off by fish. Tiger sharks also use these organs to sense changes in water pressure and temperature (Plessis, 2010). Members of this species also have a lateral line on both sides of the body that runs from the gill line to the base of the tail. The lateral line reads the vibrations in the water from the movement of other animals nearby. Ampullae of Lorenzini and lateral lines also help detect electromagnetic signals from other sharks. While communally feeding on carcasses, sharks give off signals signifying dominance and thus the order in which they feed.

Communication Channels: visual ; electric

Perception Channels: tactile ; vibrations ; electric ; magnetic

  • Kalmijn, A. 2000. Detection and processing of electromagnetic and near-field acoustic signals in elasmobranch fishes. Philosophical Transactions: Biological Sciences, 355/1401: 1135-1141.
  • Plessis, A. 2010. "Sharks- Electroreception" (On-line). Accessed September 23, 2010 at http://www.sharks.org.za/electroreception.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Ovoviviparous (Ref. 4805, 6871) with 10-82 in a litter (Ref. 26346). Mating takes place even before gravid females have given birth (Ref. 244). Distinct pairing with embrace (Ref. 205). Gestation period: 13-16 months. Size at birth between 51 (Ref. 244) and 104 (Ref. 9997) cm TL; born at about 51-76 cm TL (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Embryos of tiger sharks are fertilized internally. A yolk sac forms around the embryos to provide necessary nutrients during the 13 to 16 month gestation period. As the yolk begins to run out near the end of the gestation period, the embryo draws nutrients directly from the mother. At birth, tiger sharks are fully developed and independent. They are born with tiger-like stripes on their back and a lightly colored yellow or white belly which allows them to blend in with the environment. These stripes fade as the juveniles reach adulthood, which is around 6 to 8 years. Males reach maturity earlier than females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of tiger sharks in the wild is 27 years, though some may live to 50 years of age. Tiger sharks in captivity do not live as long, a maximum of 17 to 20 years. In captivity, this species tends to die of starvation rather than old age, as food that is already dead is less appealing to tiger sharks.

Range lifespan

Status: wild:
50 (high) years.

Range lifespan

Status: captivity:
20 (high) years.

Average lifespan

Status: wild:
27 years.

Typical lifespan

Status: captivity:
17 (high) years.

  • Branstetter, S., J. Musick, J. Colvocoresses. 1987. A comparison of the age and growth of the tiger shark, galeocerdo-cuvieri, from off virginia and from the northwestern Gulf-of-Mexico. Fishery Bulletin, 85/2: 269-279.
  • Garcia, V., L. Lucifora, R. Myers. 2008. The importance of habitat and life history to extinction risk in sharks, skates, rays and chimaeras. Proceedings of the Royal Society B: Biological Sciences, 275/1630: 83-89.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Tiger sharks are polygynandrous, meaning males and females have multiple mates; they do not pair-bond at any time. Not much is known regarding the the behaviors of finding, attracting, and defending mates of tiger sharks.

Mating System: polygynandrous (promiscuous)

Male tiger sharks reach sexual maturity when they reach an average length of 292 cm, whereas females reach sexual maturity when 330 to 345 cm in length. Females mate once every three years. Breeding seasons differ in the northern and southern hemispheres. In the northern hemisphere, females delay fertilization until March or May in order to give birth between May and June of the following year. In the southern hemisphere, females delay mating until November or January in order to give birth between February and March of the following year. Tiger sharks are one of the few species that are ovoviviparous. Females give birth to 10 to 80 pups per litter after a gestation period of 16 months. Many of these pups will not survive to adulthood. Pups weigh 3 to 6 kg at birth.

Male tiger sharks have diametric testes, which are capable of synthesizing a larger amount of sperm than radial or compound testes. The females have external ovaries that appear on the epigonal organ, which is a primary lymphoid tissue in elasmobranchs.

Breeding interval: every three years

Breeding season: Northern Hemisphere: March-May to April-June of following year. Southern Hemisphere: November-December

Range number of offspring: 3 to 80.

Average number of offspring: 35-55.

Range gestation period: 13 to 16 months.

Range birth mass: 3 to 6 kg.

Range time to independence: 1 (low) minutes.

Average age at sexual or reproductive maturity (female): 8 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (Internal ); ovoviviparous ; delayed fertilization

Average age at sexual or reproductive maturity (male)

Sex: male:
1825 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2555 days.

Female tiger sharks typically gives birth in a nursery, which provides protection during birth and to the young directly after birth. Tiger sharks are born independent, and mothers do not help their pups to find food, shelter or to survive. Males play no role in the lives of their offspring. Pups, however, are born with traits that help them survive without parents, including camouflage patterning, teeth to help capture prey, and speed to avoid predators.

Parental Investment: no parental involvement; pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Driggers III, W., G. Ingram Jr., M. Grace, C. Gledhill, T. Henwood, C. Horton, C. Jones. 2008. Pupping areas and mortality rates of young tiger sharks Galeocerdo cuvier in the western North Atlantic Ocean. Aquatic Biology, 2: 161-170.
  • Gruber, S., A. Myrberg, Jr.. 1977. Approaches to the Study of the Behavior of Sharks. American Zoologist, 17/2: 471-486.
  • Pratt, Jr., H. 1988. Elasmobranch Gonad Structure: A Description and Survey. Copeia, 1988/3: 719-729.
  • Whitney, N., G. Crow. 2007. Reproductive biology of the tiger shark (Galeocerdo cuvier) in Hawaii. Marine Biology, 151/1: 63-70.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ovoviviparous, large litter, up to 80 young, usually near 40,born at 60-80 cm TL. Gestation period may be 16 months.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Smith, C.L., 1997; Myers, R. F., 1999; Compagno, L. J. V. and V. H. Niem, 1998; Whiteheat, P. J. P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Galeocerdo cuvier

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 180 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCTCTAAGTCTTCTAATTCGAGCTGAACTCGGACAACCAGGATCACTCTTAGGGGACGATCAAATCTATAATGTAATCGTAACTGCCCATGCTTTCGTAATAATCTTTTTTATAGTTATACCAATCATAATTGGTGGCTTCGGAAATTGACTAGTTCCGTTAATAATTGGTGCACCAGATATAGCTTTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTTCTTCTTCTACTAGCCTCTGCTGGAGTAGAGGCTGGAGCAGGTACTGGTTGAACAGTTTATCCTCCATTAGCTAGTAACCTAGCTCATGCTGGACCATCTGTTGATTTAGCAATTTTCTCTCTTCACTTAGCTGGTGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACTATCATTAATATAAAACCCCCAGCTATCTCCCAATATCAAACACCATTATTTGTATGATCTATTCTTGTTACTACTATTCTCCTTCTTCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATACTACTTACAGACCGTAACCTTAATACTACATTCTTTGATCCAGCGGGTGGAGGAGATCCAATCCTTTATCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Galeocerdo cuvier

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 172
Specimens with Barcodes: 241
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 13 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Simpfendorfer, C.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

This large (>550 cm), omnivorous shark is common world wide in tropical and warm-temperate coastal waters. It is a relatively fast growing and fecund species. The Tiger Shark (Galeocerdo cuvier) is caught regularly in target and non-target fisheries. There is evidence of declines for several populations where they have been heavily fished, but in general they do not face a high risk of extinction. However, continued demand, especially for fins, may result in further declines in the future.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Currently, the total number of tiger sharks worldwide is unknown. However, they are listed as near threatened on the IUCN Red List. One major initiative to protect this species has been the limitation of the number of sharks taken by fisherman (i.e., one per vessel with a specific license).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Tiger sharks are caught in numerous fisheries world wide, both as target species and bycatch. Products utilised from Tiger Sharks include flesh, fins, skin, liver oil and cartilage. Although not considered of high quality, the mercury content of this shark's flesh is lower than other large carcharhinid species (Simpfendorfer pers. data). The fins, skin and liver oil from Tiger Sharks are all considered to be of high quality and can fetch good prices. The high value of products has increased commercial fishing pressure on this and similar species worldwide, especially since demand for high quality shark fins has increased. Catches of Tiger Sharks in directed shark fisheries have been documented for a number of areas including the western Atlantic (e.g., Kleijn 1974, Hoey and Casey 1986, Berkeley and Campos 1988, Bonfil 1994, GSAFDF 1996), Australia (Stevens et al. 1982, Lyle et al. 1984), India (Burman 1994), Papua New Guinea (Chapau and Opnai 1986), Brazil and Taiwan (Province of China) (Bonfil 1994). Commercial catches are also taken in many other areas but few records of their capture exist. Tiger Sharks are not typically the target species in these fisheries but are bycatch in fisheries targeting other shark species. Catches of Tiger Sharks in these fisheries are often not reported directly, but observer data on the species composition can be used to make estimates.

In the US East Coast/Gulf of Mexico shark fishery tiger sharks are the third most common large, coastal species caught in the fishery, accounting for 12?20% of the catch (GSAFDF 1996). However, they account for only 5% of the landed weight as they are considered of limited value since finning is not allowed in this fishery. Most of the individuals caught in this fishery are juveniles less than 150 cm FL, although large animals are also taken (S. Branstetter pers. comm.).

In northern Australia gillnet fisheries catch Tiger Sharks, although the mesh sizes used have precluded the capture of significant numbers (Lyle et al. 1984). In northern West Australia a number of fishers have used heavy drumlines to fish for large sharks. Tiger Sharks have been a major target of these fishers, with catches reaching 116 t (live weight) in 1994/95 (Simpfendorfer and Lenanton 1995). All operators who have targeted Tiger Sharks in this area have now ceased fishing.

Tiger Sharks are taken as bycatch in a variety of fisheries including tuna and swordfish longline fisheries (e.g., Anderson 1985, Berkeley and Campos 1988), particularly those operating on, or close to, the continental and insular shelves. They are also taken in trawl fisheries (e.g., squid, fish and crustacean trawl fisheries), although normally in small numbers. There are few records of Tiger Shark catches for these fisheries. Tiger Sharks are undoubtedly caught in tropical and subtropical artisanal fisheries. However, gear limitations in these fisheries probably precludes the capture of large numbers, especially of larger individuals. There are few published data on artisanal fishery captures and it is not possible to quantify catches or the impact that these may have on Tiger Shark populations.

Tiger Sharks are caught by recreational fishers. The species is one that has International Game Fish Association (IGFA) status, the current record being 596 kg. Catches have been documented off the east coast of the United States, Australia and South Africa (e.g., Stevens 1984, Anderson 1985, Casey and Hoey 1985, Pepperell 1992, Anon. 1994). Estimates of total catches of shark by recreational anglers off the east coast of the United States (including the Gulf of Mexico) in 1978 are 10,300 t (Casey and Hoey 1985) and in 1980 over 15,000 t (Anderson 1985). Estimates of the species composition of the recreational catch indicates that Tiger Sharks represent 0.8?2.1% of the catch. Based on these estimates of species composition, the recreational Tiger Shark catches in 1978 and 1980 would have been approximately 10?20 t and 15?30 t, respectively. More recently recreational catches have declined, and tagging and release has become more common. In Australian waters Pepperell (1992) estimated that Tiger Sharks represented approximately 10% of the sharks captured by IGFA associated clubs off the New South Wales coast during the 1970s. This increased to approximately 20% during the 1980s, due to increased targeting. Size composition data provided by Pepperell (1992) indicate that the bulk of the catch was 80?130 kg. Stevens (1984) estimated that Tiger Sharks comprised 17% of the recreational catch by anglers off New South Wales between 1979 and 1982, based on catch sampling.

Tiger Sharks are undoubtedly caught by recreational fishers in many countries, and not only those documented above. Recreational fishing is likely to account for significant mortality in Tiger Shark populations in coastal waters of some countries.

The large size, and propensity to occasionally attack humans, makes Tiger Sharks a target of shark control programmes, particularly those operating in tropical areas (e.g., Queensland (Paterson 1990) and Hawaii (Wetherbee et al. 1994)). However, they are also taken in other programmes (e.g., South Africa (Dudley and Cliff 1993) and New SouthWales (Reid and Krough 1992)). These control programmes use either large mesh gillnets and/or heavy lines to capture large, dangerous sharks. The theory behind the programmes is that fishing reduces the abundance of the large, dangerous sharks and so reduces the probability of attacks in areas where there has previously been relatively high records of shark attacks. There is conflicting evidence as to whether these control programmes are effective in reducing the abundance of Tiger Sharks. Evidence from Paterson (1990), Simpfendorfer (1992) and Dudley and Cliff (1993) indicates that Tiger Shark abundance has either remained steady, or even increased in ?meshed? areas. Catch rate data from Hawaii indicated that shark control programmes did reduce Tiger Shark abundance (Wetherbee et al. 1994). These data suggest that at best the use of shark control programmes to reduce population levels of Tiger Sharks may be of only limited value.

Tiger Shark populations face a variety of threats. These include not only a large range of directed and bycatch fisheries, but also problems such as the ingestion of human garbage. The high value of some products (especially fins) from Tiger Sharks has resulted in increased fishing pressures on this species in recent years. Musick et al. (1993) noted a precipitous decline in Tiger Sharks off Virginia, USA, due to both recreational and commercial harvesting between 1980 and 1992. There is anecdotal evidence that in areas where catches in commercial fisheries are high, abundance has been significantly reduced (e.g., Taiwan (POC) (Bonfil 1994)). There is some evidence from shark control programmes that localised catches of Tiger Sharks do not affect abundance.

The widespread distribution of this species increases the likelihood that it will survive increasing levels of exploitation in certain areas. Its growth and reproductive rates are also relatively high, making the levels of mortality that the Tiger Shark can survive higher than for many other species of shark. Additionally, juvenile survivorship increases where adult Tiger Shark populations have been depleted by fisheries and hence predation of young is lessened. However, the overall life history constraints to increased mortality applicable to all sharks must also be borne in mind when considering the conservation status of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

In some places, people take too many fish out of the reef to eat. This is called over-fishing. Tiger sharks can’t live in such places, because there is not enough food for them to eat!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation or management measures in place for the Tiger Shark. However, in the US Atlantic and Gulf of Mexico this species is managed under a Fisheries Management Program (FMP) introduced in 1993. It is included in the large coastal group which has an annual quota of 1,285 t. This group is dominated by Sandbar Shark (C. plumbeus) and the Blacktip Shark (C. limbatus). A new FMP was introduced in early 1999, placing Tiger Sharks in the ridgeback large coastal group which have a quota of 622 t and a minimum size of 137 cm fork length. A court placed an injunction on these new regulations pending further court action by commercial fishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Although very unlikely, tiger sharks enter shallow, populated areas of coast and attack humans on rare occasions.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tiger sharks are a popular gamefish, which are typically captured and released for sport. They are very strong, fast and perform aerial acts when hooked. Fishing for these sharks is tiring, as tiger sharks are not quickly or easily exhausted. In some states, permits such as a saltwater fishing license allow fishermen to collect the shark as a trophy.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tiger shark

The tiger shark, Galeocerdo cuvier, is a species of requiem shark and the only member of the genus Galeocerdo. Commonly known as sea tiger, the tiger shark is a relatively large macropredator, capable of attaining a length of over 5 m (16 ft).[3] It is found in many tropical and temperate waters, and it is especially common around central Pacific islands. Its name derives from the dark stripes down its body which resemble a tiger's pattern, which fade as the shark matures.[4]

The tiger shark is a solitary, mostly nocturnal hunter. Its diet includes a wide variety of prey, ranging from crustaceans, fish, seals, birds, squid, turtles, and sea snakes to dolphins and even other smaller sharks. The tiger shark is considered a near threatened species due to finning and fishing by humans.[2]

While the tiger shark is considered to be one of the sharks most dangerous to humans, the attack rate is low according to researchers.[5] The tiger is second on the list of number of recorded attacks on humans, with the great white shark being first.[6][7] They often visit shallow reefs, harbors and canals, creating the potential for encounter with humans.[4]

Contents

Taxonomy

The shark was first described by Peron and Lessueur in 1822, and was given the name Squalus cuvier.[3] Müller and Henle in 1837 renamed it Galeocerdo tigrinus.[6] The genus, Galeocerdo, is derived from the Greek galeos which means shark and the Latin cerdus which means the hard hairs of pigs.[6] It is often colloquially called the man-eater shark.[6]

The tiger shark is a member of the order Carcharhiniformes.[3] Members of this order are characterized by the presence of a nictitating membrane over the eyes, two dorsal fins, an anal fin, and five gill slits. It is the largest member of the Carcharhinidae family, commonly referred to as requiem sharks. This family includes some other well-known sharks, such as the blue shark, lemon shark and bull shark.[4]

Range and habitat

The tiger shark is often found close to the coast, mainly in tropical and subtropical waters throughout the world.[6] Along with the great white shark, Pacific sleeper shark, Greenland shark and sixgill shark, the tiger shark is among the largest extant sharks.[6] Its behavior is primarily nomadic, but is guided by warmer currents, and it stays closer to the equator throughout the colder months. It tends to stay in deep waters that line reefs, but it does move into channels to pursue prey in shallower waters. In the western Pacific Ocean, the shark has been found as far north as Japan and as far south as New Zealand.[3] A Tiger Shark tagged in the Caribbean has been tracked migrating Cape Cod, although Tiger Sharks are a tropical species during the summer the warm Gulf Stream brings the coast of Cape Cod to within the extreme north of its range.[citation needed]

Tiger sharks can be seen in the Gulf of Mexico, North American beaches and parts of South America. It is also commonly known in the Caribbean Sea. Other locations where tiger sharks are seen include Africa, People's Republic of China, Hong Kong, India, Australia and New Zealand.[4]

Certain tiger sharks have been recorded at depths just shy of 900 metres (3,000 ft)[6] but some sources claim they move into shallow water normally thought to be too shallow for a species of its size.[4] A recent study showed the average tiger shark would be recorded at 350 metres (1,100 ft), making it uncommon to see tiger sharks in shallow water. However, tiger sharks in Hawaii have been observed in depths as shallow as 10 ft and regularly observed in coastal waters at depths of 20 to 40 ft. They often visit shallow reefs, harbors and canals, creating the potential for encounters with humans.[8]

The tiger shark is known as tababa in Kiribati and Tuvaluan. They have been observed feeding in the tidal passages between the lagoon and ocean in Tarawa, Kiribati. Spring tides bring in plankton or animalcule, which attract small soft-shell crabs, which attract sardines, which attract the grey mullet, which attract the blue-backed trevally (rereba), which then attract the tiger shark (tababa).

Anatomy and appearance

Profile photo of shark, accompanied by remora, swimming just above a sandy seafloor
Juvenile tiger shark in the Bahamas

Size

One of the largest sharks living today, the tiger shark commonly attains a length of 3–4.2 m (9.8–13.8 ft) and weighs around 385–635 kg (850–1,400 lb).[6] Sometimes, an exceptionally large male tiger shark can grow up to 4.5 m (15 ft). Females are larger, and exceptionally big ones can reportedly measure over 5 m (16 ft). While on average smaller and, due to a more streamlined, slender build, typically weighing less, the largest tiger sharks can rival great white shark in length.[4] According to FishBase, the tiger shark can grow up to 7.5 m (25 ft) in length and 807.4 kg (1,780 lb) in weight.[3] Per Guinness World Records, one female specimen caught off Australia reportedly measured 5.5 m (18 ft) long and weighed an exceptional 1,524 kg (3,360 lb), although her weight is thought to have been bolstered by her pregnant state at the time.[9] A female caught in 1957 reportedly measured 7.4 m (24 ft) and weighing 3,110 kg (6,900 lb), although this very outsized shark is not known to have been confirmed.[10]

Biology

The skin of a tiger shark can typically range from blue to light green with a white or light yellow underbelly. The advantage of this is that when it is hunting for its prey, when prey looks at the shark from above, the shark will be camouflaged since the water below is darker. And when prey is below the shark and looks up, of course because of the sun, it is lighter so that the light underbelly will also camouflage the shark. Dark spots and stripes are most visible in young sharks and fade as the shark matures. Its head is somewhat wedge-shaped, which makes it easy to turn quickly to one side.[4][11] They have small pits on the snout which hold electro-receptors called the ampullae of Lorenzini which enable them to detect electric fields, including the weak electrical impulses generated by prey,which helps them to hunt.[12] Tiger sharks also have a sensory organ called a lateral line which extends on their flanks down most of the length of their sides. The primary role of this structure is to detect minute vibrations in the water. These adaptations allow the tiger shark to hunt in darkness and detect hidden prey.[13]

A reflective layer behind the tiger shark's retina called the tapetum lucidum allows light-sensing cells a second chance to capture photons of visible light, enhancing vision in low light conditions. A tiger shark generally has long fins to provide lift as the shark maneuvers through water, while the long upper tail provides bursts of speed. Tiger sharks normally swim using small body movements.[14] Its high back and dorsal fin act as a pivot, allowing it to spin quickly on its axis, though the shark's dorsal fins are distinctively close to its tail.[12]

Its teeth are specialized to slice through flesh, bone, and other tough substances such as turtle shells. Like most sharks, its teeth are continually replaced by rows of new teeth.[12]

Feeding

Tiger shark jaws

The tiger shark is an apex predator[15] and has a reputation for eating anything.[6] Young tiger sharks are found to prey largely on small fish as well as various small jellyfish, cephalopods and other mollusks. Around the time they attain 2.3 m (7.5 ft), or near sexual maturity, their prey selection expands considerably and much larger animals become regular prey.[16] Numerous fish, crustaceans, sea birds, sea snakes,[17] marine mammals (e.g. bottlenose dolphins,[18] spotted dolphins,[19] dugongs, seals and sea lions), and sea turtles (including the three largest species: the green,[16] the leatherback turtle[20] and the loggerhead turtles[21]) are regularly eaten by adult tiger sharks. The tiger shark also eats other sharks (including adult sandbar sharks), as well as rays, and will even eat conspecifics.[4][16]

Due to high risk of predatory attacks, dolphins often avoid regions inhabited by tiger sharks.[22] Tiger sharks may also attack injured or ailing whales and prey upon them. A group was documented attacking and killing an ailing humpback whale in 2006 near Hawaii.[23] The tiger shark also scavenges on dead whales. In one such documented incident, they were observed scavenging on a whale carcass alongside great white sharks, Carcharodon carcharias.[24]

The broad, heavily calcified jaws and nearly terminal mouth, combined with robust, serrated teeth, enable the tiger shark to take on these large prey.[22] In addition, excellent eyesight and acute sense of smell enable it to react to faint traces of blood and follow them to the source. The ability to pick up low-frequency pressure waves enables the shark to advance towards an animal with confidence, even in murky water.[14] The shark circles its prey and studies it by prodding it with its snout.[14] When attacking, the shark often eats its prey whole, although larger prey are often eaten in gradual large bites and finished over time.[14]

Notably, terrestrial mammals, including horses, goats, sheep, dogs, cats and rats, are fairly common in the stomach contents of tiger sharks around the coasts of Hawaii. While most are likely scavenged carcasses, a few may be ambushed in a similar method to the rare tiger shark attack on a human.[16] Because of its aggressive and indiscriminate feeding style, it often mistakenly eats inedible objects, such as automobile license plates, oil cans, tires, and baseballs.[4]

Swimming efficiency and stealth

All tiger sharks generally swim slowly, which, combined with cryptic coloration, may make them difficult for prey to detect them in some habitats. They are especially well camouflaged against dark backgrounds.[22] Despite their sluggish appearance, tiger sharks are one of the strongest swimmers of the carcharhinid sharks. Once the shark has come close, a speed burst allows it to reach the intended prey before it can escape.[22]

Reproduction

Males reach sexual maturity at 2.3 to 2.9 m (7.5 to 9.5 ft) and females at 2.5 to 3.5 m (8.2 to 11 ft).[12] Females mate once every 3 years.[4] They breed by internal fertilization. The male inserts one of his claspers into the female's genital opening (cloaca), acting as a guide for the sperm. The male uses its teeth to hold the female still during the procedure, often causing the female considerable discomfort. Mating in the Northern Hemisphere generally takes place between March and May, with birth between April and June the following year. In the Southern Hemisphere, mating takes place in November, December, or early January. The tiger shark is the only species in its family that is ovoviviparous; its eggs hatch internally and the young are born live when fully developed.[6]

The young develop inside the mother's body for up to 16 months. Litters range from 10 to 80 pups.[6] A newborn is generally 51 centimetres (20 in) to 76 centimetres (30 in) long.[6] This shark typically reaches maturity at lengths of 2 to 3 m (6.6 to 9.8 ft).[6][12] It is unknown how long tiger sharks live, but they can live longer than 12 years.[4]

Dangers and conservation

Photo of shark hung by its tail on the shore
A large tiger shark caught in Kaneʻohe Bay, Oʻahu in 1966

Although shark attacks are a relatively rare phenomenon, the tiger shark is responsible for a large percentage of fatal attacks and is regarded as one of the most dangerous shark species.[7][25] They are often found in river estuaries and harbors, as well as shallow water close to shore, where they are likely to encounter humans. The tiger shark also dwells in river mouths and other runoff-rich water.[6][12] On average, three to four shark attacks occur per year in Hawaii, and most attacks are not fatal. This attack rate is surprisingly low considering thousands of people swim, surf and dive in Hawaiian waters every day.[5] A tiger shark attack made headlines in October, 2003, when (then 13-year-old) American surfer Bethany Hamilton lost her arm near her shoulder.[26] A large tiger shark was killed and hung, and later measured; based on its size and bite pattern, it was presumed to be the shark which attacked Hamilton.

Between 1959 and 1976, 4,668 tiger sharks were culled in an effort to protect the tourism industry. Despite these efforts, attacks did not decrease. It is illegal to feed sharks in Hawaii, and interaction with them, such as cage diving, is discouraged.[27] South African shark behavioralist and shark diver, Mark Addison, demonstrated divers could interact and dive with them outside of a shark cage in 2007 Discovery Channel special.[28]

The tiger shark is captured and killed for its fins, flesh, and liver. It is caught regularly in target and nontarget fisheries. Several populations evidently have declined where they have been heavily fished, but in general, they do not face a high risk of extinction. Continued demand, though, especially for fins, may result in further declines in the future. Tiger sharks are considered a near threatened species due to excessive finning and fishing by humans according to International Union for Conservation of Nature.[2]

While shark fin has very few nutrients, shark liver has a high concentration of vitamin A which is used in the production of vitamin oils. In addition, the tiger shark is captured and killed for its distinct skin, as well as by big game fishers.[6]

In 2010, Greenpeace International added the tiger shark to its seafood red list, which is a list of fish commonly sold around the world, and which have a very high risk of being sourced from unsustainable fisheries.[29]

Mythology

The tiger shark is considered to be sacred na ʻaumakua (ancestor spirits) by some native Hawaiians who think their eyeballs have special seeing powers. This aligns with the general known facts about sharks and their highly developed senses.[5]

See also

For a topical guide to this subject, see Outline of sharks.

References

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera (Chondrichthyes entry)". Bulletins of American Paleontology 450: 560. ISBN 0877104506. Retrieved July 2011. 
  2. ^ a b c Simpfendorfer (2005). "Galeocerdo cuvier". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved July 2011. 
  3. ^ a b c d e Froese, Rainer, and Daniel Pauly, eds. (2011). "Galeocerdo cuvier" in FishBase. July 2011 version.
  4. ^ a b c d e f g h i j k Ritter, Erich K. (15 December 1999). "Fact Sheet: Tiger Sharks". Shark Info. Retrieved July 2011. 
  5. ^ a b c "Tiger Shark Research Program". Shark & Reef Fish Research. Hawaii Institute of Marine Biology. Retrieved July 2011. 
  6. ^ a b c d e f g h i j k l m n o Knickle, Craig. "Tiger Shark Biological Profile". Florida Museum of Natural History Icthyology Department. Retrieved July 2011. 
  7. ^ a b "ISAF Statistics on Attacking Species of Shark". International Shark Attack File. Florida Museum of Natural History University of Florida. Retrieved 2008-05-04. 
  8. ^ Lad, Kashmira. Habitat of a Tiger Shark. Buzzle. Retrieved July 2011.
  9. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  10. ^ Summary of Large Tiger Sharks Galeocerdo cuvier (Peron & LeSueur, 1822). Homepage.mac.com
  11. ^ Canadian Shark Research Laboratory, Tiger Shark – Centre for Marine Biodiversity. Marine Biodiversity. Retrieved July 2011.
  12. ^ a b c d e f Tiger shark, Galeocerdo cuvier MarineBio" Accessed July, 2011.
  13. ^ Tiger Shark – The Province of New Brunswick Canada. New Brunswick. Retrieved 2011-06-09.
  14. ^ a b c d "Tiger Shark". ladywildlife.com. Retrieved 2006-12-21. 
  15. ^ Heithaus, Michael R. (2001). "The biology of tiger sharks, Galeocerdo cuvier, in Shark Bay, Western Australia: sex ratio, size distribution, diet, and seasonal changes in catch rates". Environmental Biology of Fishes 61: 25–36. doi:10.1023/A:1011021210685. 
  16. ^ a b c d Lowe, Christopher G.; Wetherbee, Bradley M.; Crow, Gerald L.; Tester, Albert L. (1996). "Ontogenetic dietary shifts and feeding behavior of the tiger shark, Galeocerdo cuvier, in Hawaiian waters". Environmental Biology of Fishes 47 (2): 203. doi:10.1007/BF00005044. 
  17. ^ Heithaus, M. R.; Dill, L; Marshall, G. and Buhleier, B. (2004). "Habitat use and foraging behavior of tiger sharks (Galeocerdo cuvier) in a seagrass ecosystem". Marine Biology 140 (2): 237–248. doi:10.1007/s00227-001-0711-7. 
  18. ^ Heithaus, M. R.; Dill, L (2002). "Food availability and tiger shark predation risk influence bottlenose dolphin habitat use". Ecology 83 (2): 480–491. doi:10.1890/0012-9658(2002)083[0480:FAATSP]2.0.CO;2. 
  19. ^ Maldini, Daniela (2003). "Evidence of predation by a tiger shark (Galeocerdo cuvier) on a spotted dolphin (Stenella attenuata) off Oahu, Hawaii". Aquatic Mammals 29 (1): 84–87. doi:10.1578/016754203101023915. 
  20. ^ Tiger Sharks Killed for Eating Leatherback Turtles. Shark Defenders (2011-04-16). Retrieved on 2013-03-23.
  21. ^ Shark Bay Ecosystem Research Project. .fiu.edu. Retrieved on 2013-03-23.
  22. ^ a b c d Heithaus, Michael R. (2001). "Predator–prey and competitive interactions between sharks (order Selachii) and dolphins (suborder Odontoceti): a review". Journal of Zoology 253: 53–68. doi:10.1017/S0952836901000061. 
  23. ^ Office of National Marine Sanctuaries. "Humpback Whale Shark Attack: A Natural Phenomenon Caught on Camera". Retrieved July, 2011. 
  24. ^ Dudley, Sheldon F. J.; Michael D. Anderson-Reade, Greg S. Thompson, and Paul B. McMullen (2000). "Concurrent scavenging off a whale carcass by great white sharks, Carcharodon carcharias, and tiger sharks, Galeocerdo cuvier" (PDF). Fishery Bulletin 98: 646–649. Retrieved 4 May 2010. 
  25. ^ Ritter, Erich K. (15 February 1999). "Which shark species are really dangerous?". Shark Info. Retrieved July 2011. 
  26. ^ Hamilton, Bethany (2003). "About Me". Bethany's General Biography. BethanyHamilton.com. Retrieved July 2011. 
  27. ^ "Federal Fishery Managers Vote To Prohibit Shark Feeding". Western Pacific Regional Fishery Management Council. Retrieved July 2011. 
  28. ^ Donahue, Ann (30 July 2007). "Shark Week: 'Deadly Stripes: Tiger Sharks'". LA Times. Retrieved July 2011. 
  29. ^ Greenpeace International Seafood Red list. greenpeace.org
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!