Overview

Brief Summary

The eight or nine species of hammerhead sharks (family Sphyrnidae) are easily recognized as a group by the mallet-shaped lateral expansions of the head. Hammerheads are closely related to the requiem sharks (family Carcharhinidae). All but one hammerhead species are placed in the genus Sphyrna; the Winghead Shark (Eusphyra blochii) is usually placed by itself in a distinct genus, Eusphyra.

The rather small and almost T-shaped Winghead Shark has narrow, unusually long wing-like head extensions that make the head nearly half as wide as the body is long. Total body length (TL) is ~100 to 150 cm, with males apparently maturing at ~108 cm TL and females maturing by ~120 cm (males are reportedly immature at 79 cm and mature at 132 cm; pregnant females are reported from 104 to 144 cm). Young are ~32 to 50 cm TL at birth.

These poorly known sharks of the tropical Indo-west Pacific are benthopelagic (i.e., occurring near the bottom or in mid-waters) and coastal. They are found in shallow waters of the continental and insular shelves. Winghead Sharks are viviparous (live-bearing) with a yolk-sac placenta. Compagno (1984) reported brood size as 6 to 11 young (most commonly 6); Castro et al. (1999) reported brood size as 6 to 25 (mean=12). Compagno et al. (1984) inferred from circumstantial evidence that the gestation period is probably around eight months, but noted the need for confirmation; Castro et al. (1999) reported the gestation period as probably around 10 or 11 months, with an annual reproductive cycle. According to Compagno (1984), the diet of the Winghead Shark is not reported, but probably consists of small fishes, cephalopods, and crustaceans. This species is not known to attack people.

Winghead Sharks are found from the Persian Gulf to Pakistan, India, Sri Lanka, Bangladesh, Burma, Malaysia, Thailand, Vietnam, China, Taiwan, the Philippines, and Indonesia to northern Australia (Queensland and Northern Territory). They are common in the fisheries of India, Pakistan, Malaysia, and Thailand (Compagno 1984).

(Compagno 1984, 1998; Castro et al. 1999; Musick and McMillan 2002; Carrier et al. 2004; Nelson 2006)

  • Carrier, J.C., Musick, J.A., and M.R. Heithaus. 2004. Biology of Sharks and their Relatives. CRC Press, Boca Raton, Florida.
  • Castro, J.I., Brudek, R.L., and C.M. Woodley. 1999. A preliminary evaluation of the status of shark species. FAO Fisheries Technical Paper No. 380. FAO, Rome.
  • Compagno, L.J.V. 1984. FAO Species Catalogue. Volume 4. Sharks of the World. An annotated and illustrated catalogue of shark species known to date. Part 2. Carcharhiniformes. FAO Fisheries Synopsis No. 125, Vol. 4, Part. 2: 251-655.
  • Compagno, L.J.V. 1998. Sphyrnidae: hammerhead and bonnethead sharks. Pp. 1361-1366 in FAO species identification guide for fishery purposes.The living marine resourcesof the Western Central Pacific. Volume 2. Cephalopods, crustaceans, holothurians and sharks (K.E. Carpenter and K.E. Niem, V.H., eds.). FAO, Rome. Online">http://www.fao.org/docrep/009/w7192e/w7192e00.htm">Online version
  • Musick, J.A. and B. McMillan. 2002. The Shark Chronicles: A Scientist Tracks the Consummate Predator. Henry Holt and Company, New York.
  • Nelson, J. 2006. Fishes of the World. John Wiley and Sons, Hoboken, New Jersey.
  • Stevens, J.D. and J.M. Lyle. 1989. Biology of three hammerhead sharks (Eusphyra blochii, Sphyrna mokarran, and S. lewini) from northern Australia. Australian Journal of Marine and Freshwater Research 40:129-146.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found in shallow water on continental and insular shelves (Ref. 244). Enters estuaries (Ref. 4832). Feeds mainly on small teleost fishes but also takes crustaceans and cephalopods (Ref. 13562). Viviparous (Ref. 50449), with 6 to 25 pups in a litter (Ref. 6871). Has a remarkable wing-shaped head which is nearly or quite half of its body length, the function of which is uncertain, maybe for maneuvering or for increasing the surface area of some of the sense organs (Ref. 244). Probably harmless to people (Ref. 13562). Caught commonly, but in low numbers, by inshore gillnet fisheries. Particularly common in catches off Kalimantan (Ref.58048). Probably a common fisheries species where it occurs (Ref. 13562). Meat utilized for human consumption; liver is a source of vitamin oil (Ref. 244). Offal probably utilized for fishmeal (Ref. 13562). Reported to reach 300 cm TL (Ref. 58784).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs on and near continental shelf waters of the Indo-West Pacific from the Arabian Gulf though south Asian, Indonesia and northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Persian Gulf to the Philippines, north to China, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1860 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

186 cm TL (male/unsexed; (Ref. 6871))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Grey or grey-brown above, paler below. Expanded lateral blades of head very narrow and wing-like, with a series of small bumps along edges in front of nostrils; width across head 40 or 50% of total length. Nostrils enormously expanded, each nearly 2 times the mouth head (Ref 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A unique species of hammerhead with an extremely large hammer. The young are born at approximately 45 cm, maturity occurs at around 110 cm, and they reach a maximum size of 186 cm (Stevens and Lyle 1989). Mature females produce litters of 6-11 every year after a gestation period of 8 to 11 months (Compagno 1984). There are no age and growth data available for this species. As a consequence it is difficult to predict the productivity of its life history. The diet is composed of teleost fishes, crustaceans and cephalopods.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; amphidromous (Ref. 51243); brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 24 - 33.5
  Temperature range (°C): 27.788 - 27.788
  Nitrate (umol/L): 0.276 - 0.276
  Salinity (PPS): 34.631 - 34.631
  Oxygen (ml/l): 4.509 - 4.509
  Phosphate (umol/l): 0.217 - 0.217
  Silicate (umol/l): 2.864 - 2.864

Graphical representation

Depth range (m): 24 - 33.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Terranova Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudanisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449), with 6 to 25 in a litter after a gestation period of 8 (Ref.58048) -11 months (Ref. 6871). Size at birth between 32 and 45 cm TL (Ref. 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eusphyra blochii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGAATAGTTGGTACTGCCCTAAGTCTTTTAATTCGAGCTGAACTTGGACAACCAGGATCTCTCTTAGGAGATGATCAGATTTATAATGTAATTGTAACCGCTCACGCTTTCGTAATAATCTTTTTCATGGTTATACCAATTATAATTGGTGGTTTTGGGAATTGGCTAGTTCCTCTAATAATTGGCGCACCAGACATAGCCTTCCCACGAATAAATAACATAAGCTTTTGGCTTCTTCCACCATCATTTCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGGGCAGGTACTGGTTGAACAGTTTACCCCCCATTAGCTAGCAACTTAGCCCATGCCGGACCATCCGTTGACCTAGCTATCTTCTCTCTTCACTTAGCTGGTGTCTCATCAATCTTAGCCTCAATTAATTTTATCACAACTATTATCAACATAAAACCCCCAGCTATCTCCCAATATCAAACACCCTTATTTGTTTGATCTATCCTTGTAACTACTATTCTACTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTTACAGACCGCAACCTTAATACTACATTCTTTGATCCTGCAGGAGGAGGAGATCCAATCCTTTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eusphyra blochii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Simpfendorfer, C.A. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S., Cavanagh, R.D. & Kyne, P.M. (Shark Red List Authority)

Contributor/s

Justification
This highly distinctive Indo-west Pacific continental shelf species is fished throughout its range. In southern Asia and Indonesia it is subjected to a range of fisheries and is probably heavily exploited. There are no scientific data on its status, and biological data are incomplete, but based on anecdotal accounts and market surveys the population is assumed to have declined and is assessed as Near Threatened. In the future it may reach a level that would warrant a Vulnerable listing.

In Australia it is only a small component of commercial catches, the population is considered to be relatively healthy and is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are no data available on population numbers for any part of the range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is heavily exploited in some parts of its range, especially in the Gulf of Thailand, India and Indonesia (L. Compagno, pers. comm., William White, Murdoch University, pers. comm). Anecdotal reports indicate that in these areas the populations have been impacted by fishing and in the near future may require a listing as Vulnerable based on population decline. Within Australian waters it is only lightly exploited by gillnet and longline fishing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Winghead shark

The winghead shark (Eusphyra blochii) is a species of hammerhead shark, and part of the family Sphyrnidae. Reaching a length of 1.9 m (6.2 ft), this small brown to gray shark has a slender body with a tall, sickle-shaped first dorsal fin. Its name comes from its exceptionally large "hammer", or cephalofoil, which can be as wide as half of the shark's total length. The function of this structure is unclear but may relate to the shark's senses. The wide spacing of its eyes grant superb binocular vision, while the extremely long nostrils on the leading margin of the cephalofoil may allow for better detection and tracking of odor trails in the water. The cephalofoil also provides a large surface area for its ampullae of Lorenzini and lateral line, with potential benefits for electroreception and mechanoreception respectively.

Inhabiting the shallow coastal waters of the western Indo-Pacific, the winghead shark feeds on small bony fishes, crustaceans, and cephalopods. It gives birth to live young, with the developing embryos receiving nourishment through a placental connection. Females produce annual litters of 6–25 pups; depending on region, birthing may occur from February to June after a gestation period of 8–11 months. This harmless species is widely fished for meat, fins, liver oil, and fishmeal. The International Union for Conservation of Nature (IUCN) has assessed it as Near Threatened, as it is thought to have declined in some parts of its range due to over-exploitation.

Taxonomy[edit]

In 1785, German naturalist Marcus Elieser Bloch described a shark that he referred to Squalus zygaena (a synonym of Sphyrna zygaena, the smooth hammerhead). French zoologist Georges Cuvier, as a brief footnote to the account of S. zygaena in his 1817 Le Règne animal distribué d'après son organisation, pour servir de base à l'histoire naturelle des animaux et d'introduction à l'anatomie comparée, observed that Bloch's specimen (which he labeled "z. nob. Blochii") was not a smooth hammerhead but rather a different species. Although Cuvier did not propose a proper binomial name, his colleague Achille Valenciennes interpreted it as such in 1822 when he described another specimen of the same species in detail, calling it Zygaena Blochii nobis and attributing the name to Cuvier.[3][4]

In 1862, Theodore Gill placed the winghead shark in its own genus Eusphyra, derived from the Greek eu ("good") and sphyra ("hammer").[5][6] However, subsequent authors did not accept Eusphyra and preferred to keep this species with the other hammerheads in the genus Sphyrna. Eusphyra was resurrected by Henry Bigelow and William Schroeder in 1948, and came into wider usage after additional taxonomic research was published by Leonard Compagno in 1979 and 1988. Nevertheless, some sources still refer to this species as Sphyrna blochii.[4][7] Other common names for the winghead shark include arrowhead, arrow headed hammerhead shark, and slender hammerhead.[6]

Phylogeny[edit]



Eusphyra blochii





Sphyrna mokarran



Sphyrna zygaena





Sphyrna lewini





Sphyrna tudes



Sphyrna media





Sphyrna tiburo



Sphyrna corona







Phylogenetic tree of hammerhead sharks based on mitochondrial and nuclear DNA.[8]

The traditional view of hammerhead shark evolution is that species with smaller cephalofoils evolved first from a requiem shark ancestor, and later gave rise to species with larger cephalofoils. Under this interpretation, the winghead shark is the most derived hammerhead as it has the most extreme cephalofoil morphology. However, molecular phylogenetic research based on isozymes, mitochondrial DNA, and nuclear DNA have found the opposite pattern, with the winghead shark as the most basal member of the hammerhead family. This result supports the counterintuitive idea that the first hammerhead shark to evolve had a large cephalofoil. It also supports the separation of Eusphyra from Sphyrna by keeping the latter monophyletic (including all descendants of a single ancestor). The winghead shark lineage is estimated to have diverged from the rest of the hammerheads some 15–20 million years ago during the Miocene.[7][8][9]

Description[edit]

True to its name, the winghead shark's cephalofoil consists of a pair of long, narrow, and gently swept-back blades. The width of the cephalofoil is equal to 40–50% of the shark's total length. The front of the cephalofoil has a slight indentation in the middle and a gentle bump on each side in front of the nostrils. Each nostril is roughly twice as long as the width of the mouth and extends along almost the entire leading margin of each blade. The circular eyes, located at the forward outer corners of the cephalofoil, are equipped with protective nictitating membranes. The relatively small, arched mouth contains 15–16 upper and 14 lower tooth rows on each side, and sometimes also a single row of tiny teeth at the upper and/or lower symphyses (jaw midpoints). The teeth are small and smooth-edged, with angled triangular cusps. There are five pairs of gill slits, with the fifth pair over the pectoral fin origins.[2][4][10][11]

The body is slim and streamlined, with a very tall, narrow, and falcate (sickle-shaped) first dorsal fin that originates over the bases of the rather small pectoral fins. The second dorsal fin is much smaller and originates over the aft third of the anal fin base. The anal fin is about half again as long as the second dorsal fin. There is a lengthwise groove on the caudal peduncle at the dorsal origin of the caudal fin. The upper caudal fin lobe is longer than the lower lobe, and bears a notch in the trailing margin near the tip.[2][11] The skin is covered by overlapping dermal denticles, each with three horizontal ridges leading to marginal teeth.[12] This species is brownish gray to gray above and off-white below, and lacks fin markings.[2] It grows up to 1.9 m (6.2 ft) long.[10]

Distribution and habitat[edit]

The winghead shark is found in the tropical western Indo-Pacific, from the Persian Gulf eastward across South and Southeast Asia to New Guinea and northern Queensland. Its range extends as far north as Taiwan and as far south as the Montebello Islands off Western Australia.[4][2] This species inhabits shallow waters close to shore and has been known to enter estuaries.[6]

Biology and ecology[edit]

Illustration of a winghead shark from Fauna of British India (1889), showing the remarkably wide cephalofoil. The function of this structure is yet unclear.

Several non-exclusive hypotheses have been proposed to explain the extreme size of the winghead shark's cephalofoil. The placement of the eyes at the ends of the cephalofoil provides a binocular field of view of 48°, the most of any hammerhead and four times that of a requiem shark; this species thus has excellent depth perception, which may aid in hunting.[13] This species also has proportionately the longest nostrils among the hammerheads; longer nostrils contain more chemosensory receptors and can sample more water at a time, increasing the chances of detecting an odor molecule. A winghead shark 1 m (3.3 ft) long is theoretically capable of sampling over 2,300 cm3 (140 cu in) of water per second. Another potential olfactory benefit of the cephalofoil is increased separation between the midpoints of the left and right nostrils, which enhances the shark's ability to resolve the direction of a scent trail.[14] Finally, the cephalofoil may increase the shark's ability to detect the electric fields and movements of its prey, by providing a larger surface area for its electroreceptive ampullae of Lorenzini and mechanoreceptive lateral line.[4] The lateral blades seem too large to function in maneuvering, which has been suggested for other hammerheads.[15]

The winghead shark usually hunts close to the sea floor. Its diet consists mainly of small bony fishes, followed by crustaceans and cephalopods.[2][16] Known parasites of this species include the tapeworms Callitetrarhynchus blochii,[17] Heteronybelinia heteromorphi,[18] Otobothrium carcharidis, O. mugilis,[19] Phoreiobothrium puriensis,[20] and Phyllobothrium blochii,[21] the nematodes Hysterothylacium ganeshi,[22] Pseudanisakis sp.,[23] Raphidascaroides blochii,[24] and Terranova sp.,[23] the copepod Caligus furcisetifer,[25] and the protozoan Eimeria zygaenae.[26]

Life history[edit]

The winghead shark is viviparous like the rest of its family, with the developing young sustained to term by a placental connection to the mother. Adult females have a single functional ovary, on the right, and two functional uteruses. Compartments form inside the uteruses during pregnancy, one for each embryo. In the waters around Mumbai, the mating season is in July and August during the monsoon.[27] The males bite at the sides of the females as a prelude to copulation. Females can reproduce every year; the litter size ranges from 6 to 25 pups, and increases with the size of the female. The gestation period lasts 8–9 months off western India, and 10–11 months off northern Australia.[2][16][28] Pregnant females have been reported to quarrel with each other.[4]

Initially, the embryo is nourished by yolk and develops in a similar fashion to other sharks. At a length of 4.0–4.5 cm (1.6–1.8 in), the cephalofoil and the fins begin to form. When the embryo is 12–16 cm (4.7–6.3 in) long, the yolk supply begins to run low and folds appear on the yolk sac and uterine wall, which will later interlock to form the placenta. At this stage, the embryo has most of the features of an adult, albeit rudimentary and colorless. The blades of the cephalofoil are folded back along the body, and there are long external gill filaments protruding from the gill slits. At a length of 20–29 cm (7.9–11.4 in), the placenta has formed; the first teeth, dermal denticles, and skin pigmentation appear on the embryo, and the external gills are much reduced in size. By the time the embryo is 30 cm (12 in) long, it resembles a miniature version of the adult.[27][28]

Birthing takes place in May and June off Mumbai and Parangipettai, in March and April in the Gulf of Mannar, and in February and March off northern Australia. The pups emerge tail-first, and their cephalofoils remain folded until after birth to facilitate passage through the cloaca.[16][27][28] The newborns measure 32–47 cm (13–19 in) in length.[10] Sexual maturity is reached at around 1.0–1.1 m (3.3–3.6 ft) long for males and 1.1–1.2 m (3.6–3.9 ft) long for females.[10][28] The maximum lifespan is at least 21 years.[29]

Human interactions[edit]

Harmless to humans, the winghead shark is caught throughout its range using gillnets, seines, stake nets, longlines, and hook-and-line. The meat is sold fresh, the fins are exported to Asia for shark fin soup, the liver is a source of vitamin oil, and the offal is processed into fishmeal.[2][4] This species is taken in large numbers in some areas, such as in the Gulf of Thailand and off India and Indonesia, and there is anecdotal evidence that its population has suffered as a result. The International Union for Conservation of Nature (IUCN) has listed the winghead shark as Near Threatened, and noted that it may soon be Vulnerable in heavily fished regions. This species is only infrequently caught in Australian waters, where it has been assessed regionally as Least Concern by the IUCN.[1]

References[edit]

  1. ^ a b Simpfendorfer, C.A. (2003). "Eusphyra blochii". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  2. ^ a b c d e f g h Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. p. 288. ISBN 0674034112. 
  3. ^ Cuvier, G. (1816). Le Règne Animal distribué d'après son organisation pour servir de base à l'histoire naturelle des animaux et d'introduction à l'anatomie comparée. Deterville. p. 127. 
  4. ^ a b c d e f g Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization of the United Nations. pp. 540–541. ISBN 9251013845. 
  5. ^ Gill, T.N. (1862). "Analytical synopsis of the order of Squali; and revision of the nomenclature of the genera". Annals of the Lyceum of Natural History of New York 7: 371–408. 
  6. ^ a b c Froese, R.; Pauly, D., ed. (2011). "Eusphyra blochii, Winghead shark". FishBase. Retrieved May 18, 2013. 
  7. ^ a b Martin, R.A. (1998). "Recent Changes in Hammerhead Taxonomy". ReefQuest Centre for Shark Research. Retrieved May 18, 2013. 
  8. ^ a b Lim, D.D.; Motta, P.; Mara, K.; Martin, A.P. (2010). "Phylogeny of hammerhead sharks (Family Sphyrnidae) inferred from mitochondrial and nuclear genes". Molecular Phylogenetics and Evolution 55 (2): 572–579. doi:10.1016/j.ympev.2010.01.037. PMID 20138218. 
  9. ^ Cavalcanti, M.J. (2007). "A Phylogenetic Supertree of the Hammerhead Sharks (Carcharhiniformes: Sphyrnidae)". Zoological Studies 46 (1): 6–11. 
  10. ^ a b c d Last, P.R.; White, W.T.; Caire, J.N.; Dharmadi; Fahmi; Jensen, K.; Lim, A.P.F.; Manjaji-Matsumoto, B.M.; Naylor, G.J.P.; Pogonoski, J.J.; Stevens, J.D.; Yearsley, G.K. (2010). Sharks and Rays of Borneo. CSIRO Publishing. pp. 134–135. ISBN 978-1-921605-59-8. 
  11. ^ a b Randall, J.E. (1995). Coastal Fishes of Oman. University of Hawaii Press. p. 38. ISBN 0824818083. 
  12. ^ Mello, W.C.; de Carvalho, J.J.; Brito, P.M.M. (2013). "Microstructural morphology in early dermal denticles of hammerhead sharks (Elasmobranchii: Sphyrnidae) and related taxa". Acta Zoologica 94 (2): 147–153. doi:10.1111/j.1463-6395.2011.00547.x. 
  13. ^ McComb, D.M.; Tricas, T.C.; Kajiura, S.M. (2009). "Enhanced visual fields in hammerhead sharks". Journal of Experimental Biology 212 (24): 4010–4018. doi:10.1242/jeb.032615. 
  14. ^ Kajiura, S.M.; Forni, J.B.; Summers, A.P. (2005). "Olfactory morphology of carcharhinid and sphyrnid sharks: Does the cephalofoil confer a sensory advantage?". Journal of Morphology 264 (3): 253–263. doi:10.1002/jmor.10208. PMID 15549717. 
  15. ^ Nakaya, K. (1995). "Hydrodynamic function of the head in the hammerhead sharks (Elasmobranchii: Sphyrnidae)". Copeia 1995 (2): 330–336. doi:10.2307/1446895. 
  16. ^ a b c Stevens, J.D.; Lyle, J.M. (1989). "Biology of three hammerhead sharks (Eusphyra blochii, Sphyrna mokarran and S. lewini) from Northern Australia". Australian Journal of Marine and Freshwater Research 40 (2): 129–146. doi:10.1071/MF9890129. 
  17. ^ Pramanik, P.B.; Manna, B. (2006). "Callitetrarhynchus blochii new species (Cestoidea: Lacistorhynchidae) from Sphyrna blochii Cuvier, 1817 from Bay of Bengal at Digha coast, India". Journal of Natural History 2 (2): 10–15. 
  18. ^ Palm, H.W. (1999). "Nybelinia Poche, 1926, Heteronybelinia gen. nov. and Myxonebelinia gen. nov. (Cestoda: Trypanorhyncha) in the collections of The Natural History Museum, London". Bulletin of the Natural History Museum, London (Zoology series) 65 (2): 133–153. 
  19. ^ Schaeffner, B.C.; Beveridge, I. (2013). "Redescriptions and new records of species of Otobothrium Linton, 1890 (Cestoda: Trypanorhyncha)". Systematic Parasitology 84 (1): 17–55. doi:10.1007/s11230-012-9388-1. PMID 23263940. 
  20. ^ Srivastav, A.K.; Capoor, V.N. (1982). "On a new cestode, Phoreiobothrium puriensis n. sp". Indian Journal of Helminthology 34 (1–2): 82–85. 
  21. ^ Srivastav, A.K.; Srivastava, B.K. (1988). "On a new cestode, Phyllobothrium blochii sp. n. (Phyllobothriidae, Cestoda) from the elasmobranch fish, Zygaena blochii (Cuvier) (Carchariidae, Euselachii) from Puri, Orissa (India)". Helminthologia 25: 89–94. 
  22. ^ Lakshmi, I.R.; Sreeramulu, K. (2007). "Hysterothylacium ganeshi n. sp (Nematoda-Anisakidae) from the intestine of Shark, Sphyrna blochii (Cuvier)". Geobios 34 (1): 29. 
  23. ^ a b Arthur, J.J.R.; Ahmed, A.T.A. (2002). Checklist of the Parasites of Fishes of Bangladesh (FAO Fisheries Technical Paper 369/1). Food and Agriculture Organization of the United Nations. p. 44. ISBN 9251048541. 
  24. ^ Bruce, N.L.; Cannon, L.R.G.; Adlard, R. (1994). "Synoptic checklist of ascaridoid parasites (Nematoda) from fish hosts". Invertebrate Taxonomy 8 (3): 583–674. doi:10.1071/IT9940583. 
  25. ^ Margolis, L.; Kabata, Z.; Parker, R.R. (1975). "Catalogue and synopsis of Caligus, a genus of Copepoda (Crustacea) parasitic on fishes". Bulletin of the Fisheries Research Board of Canada 192: 1–117. 
  26. ^ Chakravarty, M.; Mandal, A.K. (1961). "A new coccidium, Eimeria zygaenae n. sp. from hammer headed shark, Zygaena blochii". Proceedings of the 48th Indian Science Congress (Roorkee) (Part III): abstract 93. 
  27. ^ a b c Appukuttan, K.K. (1978). "Studies on the developmental stages of hammerhead shark Sphyrna (Eusphyrna) blochii from the Gulf of Mannar". Indian Journal of Fisheries 25 (1–2): 41–52. 
  28. ^ a b c d Devadoss, P. (1988). "Observations on the breeding and development of some sharks". Journal of the Marine Biological Association of India 30 (1–2): 121–131. 
  29. ^ Smart, J.J.; Harry, A.V.; Tobin, A.J.; Simpfendorfer, C.A. (2012). "Overcoming the constraints of low sample sizes to produce age and growth data for rare or threatened sharks". Aquatic Conservation: Marine and Freshwater Ecosystems 23 (1): 124–134. doi:10.1002/aqc.2274. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!