Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The sand tiger shark is one of the best-studied of the shark species. They are the only sharks known to gulp air at the surface and store it in their stomach to provide buoyancy (2). These sharks generally mate between October and November and courtship can take a long time, with the male aggressively nipping his potential mate (3). Females are ovoviviparous, giving birth to two large pups every two years. Pups hatch out of their eggs within the oviduct of the mother's reproductive system, one in each oviduct, and then feed on eggs that the female continues to produce (6). Over nine months to a year, the pups grow within their mother feeding on hundreds to thousands of eggs (6) and, by the time they are born, measure up to a metre long (3). During the day they are found near caves and ledges (5), hovering just above the surface either singly or in small groups (3). These fairly docile sharks are sluggish and, despite a ferocious reputation, feed mainly on fish (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This stocky shark has a conical nose and a slightly flattened head (3). It is a dark brown or beige colour above, with blotches of darker colour, and paler underneath (4). The teeth of this species are especially distinctive, having a fang-like appearance and being visible even when the mouth is shut (5). There are two dorsal fins, which are a similar size to the anal fin; the upper lobe of the tail is larger than the lower one (3). Sharks have a sixth sense that enables them to detect electric currents, and the receptive pores are located on the under surface of the sand tiger's snout (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

[[ Carcharias taurus Rafinesque ZBK ]]

Records of the great white shark Carcharodon carcharias (Linnaeus) (Lamniformes: Lamnidae) in the Persian/Arabian Gulf (hereafter referred to as “The Gulf”) are limited to a single report from Kuwait, in the northwest Gulf, which has subsequently been noted in key references (e.g. Compagno, 2001). Khalaf (1987) recorded C. carcharias based on an observation of a mounted specimen in Kuwait Science and Natural History Museum on a visit there in March 1987. The specimen is reported as being a female C. carcharias of 3m in length, caught off Kuwait ’s coast and supplied to the museum on the 14th of April 1984. A black and white photograph of the anterior portion (from just posterior of the pelvic fins) was included in Khalaf’s account (Fig. 1 here), but no measurements or morphological data were presented.

The present authors examined the photograph and identified the specimen as Carcharias taurus Rafinesque ZBK (Lamniformes: Odontaspididae) based on the first dorsal fin origin being well behind the inner margins of the pectoral fins (cf. over the pectoral inner margins in C. carcharias ), the first dorsal fin insertion being about over the pelvic fin origin (cf. being well ahead of pelvic fin origin), a short flattened snout (cf. moderately long conical snout), moderately long gill openings not extending onto the dorsal surface (cf. long gill openings), and characteristic protruding teeth. The photograph presented did not allow for examination of the caudal region or for effective examination of colouration.

Carcharodon carcharias has been recorded from a wide range of habitats and with an extensive distribution ranging from the equatorial tropics to the sub-Arctic, and from the intertidal down to the continental slope (Compagno, 2001). Cliff et al. (2000), Compagno (2001), and Zuffa et al. (2002) report white sharks from the tropical Western Indian Ocean off Mozambique and Madagascar north to Tanzania and Kenya and including the Seychelles, Réunion and Mauritius. There is therefore no theoretical reason why this species should not occur in the Persian Gulf or the wider northwestern Indian Ocean, although the nearest confirmed record is from Sri Lanka and possibly the Red Sea (Compagno, 2001). In addition, there are unconfirmed, anecdotal records of white sharks from the Gulf of Aden coast of Yemen, Djibouti and northern Somalia (Conan Doyle, 1963).

Gubanov & Schleib (1980) reported C. taurus ZBK as sometimes being encountered in Kuwait waters, although Krupp et al., (2000) noted that there was no material provided to support this. Krupp et al., (2000) reported the first record of C. taurus ZBK from The Gulf supported by reference material based on a 2.98m specimen caught off Abu Halifa, Kuwait , in 1997. The C. taurus ZBK reported here predates this by thirteen years.

  • Alec B. M. Moore, Leonard J. V. Compagno, Ian K. Fergusson (2007): The Persian / Arabian Gulf's sole great white shark Carcharodon carcharias (Lamniformes: Lamnidae) record from Kuwait: misidentification of a sandtiger shark Carcharias taurus (Lamniformes: Odontaspididae). Zootaxa 1591, 67-68: 67-68, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:D4F73DD9-97B8-4F59-BCE3-1B56EB5C20C3
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A common littoral shark found inshore from the surf zone and in shallow bays to at least 191 m on the outer continental shelves (Ref. 13568). Often on or near the bottom but also occurs in midwater or at the surface (Ref. 247). Only shark known to gulp and store air in its stomach to maintain neutral buoyancy while swimming (Ref. 13568). Found singly or in small to large schools (Ref. 247). Feeds on bony fishes, small sharks, rays, squids, crabs, and lobsters (Ref. 5578). Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother as well as other siblings in the womb (uterine cannibalism) (Ref. 50449). Usually gives birth to 2 pups after a 9-12 months gestation period (Ref.58048). A migratory species in parts of its range, particularly in its northern and southern extremities where pronounced poleward migration occur in the summer and equatorial movements in autumn and winter (Ref. 247). Usually inoffensive and not aggressive when not provoked (Ref. 247) but has known to bite swimmers and be aggressive towards divers with speared fish (Ref. 6586). Utilized for fresh, frozen, smoked and dried for human consumption (Ref. 247); also for fishmeal, liver oil, fins, and hides for leather (Ref. 13568). Flesh highly appreciated in Japan (Ref. 36731).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nearly cosmopolitan in subtropical and temperate waters, generally at depths less than 60 m. Range includes the western North Atlantic (Nova Scotia to the northern Bahamas and Florida and Gulf of Mexico west to Texas; also Brazil to Argentina), the Atlantic coast of Europe to North Africa and the Mediterranean Sea, western Indian Ocean, and western Pacific Ocean; absent from the eastern Pacific Ocean (Castro 1983, Gilmore et al. 1983, Michael 1993, Hoese and Moore 1998). Perhaps the most common shark in coastal waters from Cape Cod, Massachusetts to Chesapeake Bay; free-swimming juveniles in the western Atlantic are restricted to temperate and warm-temperate waters, extending as far south as northern Florida Juveniles 109.3-157.7 cm total length have been recorded in neritic waters along the northern Florida coast and in the northern and northeastern Gulf of Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gulf of Maine to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Historically, the Grey Nurse Shark is regarded as having a broad inshore distribution, primarily in subtropical to warm temperate waters around the main continental landmasses, except in the eastern Pacific off North and South America (Compagno 1984a). In the Western Atlantic, this shark occurs from the Gulf of Maine to Florida (USA), in the northern Gulf of Mexico, around the Bahamas and at Bermuda, and also from southern Brazil to northern Argentina. In the eastern Atlantic it is found from the Mediterranean to the Canary Islands, at the Cape Verde Islands, along the coasts of Senegal and Ghana, and from southern Nigeria to Cameroon. In the western Indian Ocean it ranges from South Africa to southern Mozambique, but does not occur around Madagascar. This species has also been reported from the Red Sea and may occur as far east as India (where it appears to have been referred to as C. tricuspidatus; see Compagno 1984a). In the western Pacific, it has been reported from Japan and Australia, but not New Zealand (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea and Red Sea), but except eastern and central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea and Red Sea), but except eastern and central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumtropical: Except perhaps the eastern Pacific (Ref. 13568). Indo-West Pacific: Red Sea and off South Africa to Japan, Korea and Australia (Ref. 13568). Present in Arafura Sea (Ref. 9819). Western Atlantic: Gulf of Maine to Argentina. Old record from Bermuda, south Brazil (Ref. 26938). Eastern Atlantic: Mediterranean to Cameroon. Northwest Atlantic: Canada (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Grey nurse sharks, also called sand tiger sharks, can be found in the Atlantic, Indian, and Pacific Oceans in temperate and tropical waters. They are found in warm seas, except for the eastern Pacific. They occur from the Gulf of Maine to Argentina in the western Atlantic, the coast of Europe to north Africa in the eastern Atlantic, in the Mediterranean sea, from Australia to Japan in the west Pacific, and off the coasts of South Africa.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • Gilbert, P., R. Matheson, D. Rall. 1967. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press in cooperation with the American Institute of Biological Sciences.
  • Carrier, J., J. Musick, M. Helithaus. 2004. Biology of Sharks and Their Relatives. Boca Raton, London, New York, Washington, D.C.: CRC Press.
  • Cooper, P. 2006. "Sandtiger shark" (On-line). Ichthyology at the Florida Museum of Natural History: Biological Profiles. Accessed April 18, 2006 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/Sandtiger/Sandtiger.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal waters on both sides of the Atlantic; Maine to Florida and Brazil; Mediterranean, tropical West Africa, Canaries, and Cape Verdes; South Africa.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

A widespread range encompasses all subtropical and tropical oceans (6), with the possible exception of the eastern Pacific (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The dorsal side of grey nurse sharks is grey, the underside is a dirty white color. These are stout-bodied sharks with metallic brown or reddish colored spots on the sides. When a grey nurse shark pup is born it is typically between 115 and 150 cm. As they mature, grey nurse sharks can reach 5.5 meters, but an average size is 3.6 meters. Females are generally larger than males. Average weight is from 95 to 110 kg. A distinguishing characteristic of grey nurse sharks is that the anal fin and both dorsal fins are the same size. The tail is heterocercal, with a long, upper lobe and a shorter, lower lobe. These different lobes allow for great movement. The mouth bears razor like teeth and is long and slender, with pointed snout. Their elongated teeth are visible even when the mouth is closed, giving these sharks a menacing appearance. This has led many to believe that these are dangerous sharks, a reputation they don't deserve.

Range mass: 50 to 300 kg.

Average mass: 95-110 kg.

Range length: 6 (high) m.

Average length: 3.6 m.

Range basal metabolic rate: <190 to 311 cm^3 oxygen/hour.

Average basal metabolic rate: 239 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Hamlett, W. 1999. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press.
  • Office of Naval Research. Sensory Biology of Sharks, Skates, and Rays. N00014-76-C-0943. Arlington, Va: U.S. Government. 1979.
  • 2005. "Abyss Scuba Diving" (On-line). Accessed October 05, 2005 at http://teachit.acreekps.vic.edu.au/animals/greynurseshark.htm.
  • Bennett, M., C. Bansemer. 2004. "Investigation of grey nurse sharks in Queensland to fulfill action under the recovery plan for grey nurse sharks in Australia regarding impact of divers, and establishment of a photographic database" (On-line pdf). Investigation of grey nurse sharks in Queensland to fulfill action under the recovery plan for grey nurse sharks in Australia regarding impact of divers, and establishment of a photographic database. Accessed November 14, 2005 at http://gov.au/coasts/publications/pubs/grey-nurse-shark-project.pdf.
  • Department of the Environment and Heritage, Australia, 1999. "Nurse Sharks" (On-line). Department of the Environment and Heritage, Australia. Accessed October 06, 2006 at http://www.deh.gov.au/coasts/species/sharks/greynurse/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

320 cm TL (male/unsexed; (Ref. 5213)); max. published weight: 158.8 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 320 cm TL; max weight: 154 kg
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Lives mostly on or near the bottom, from the surf zone, in shallow bays, and around coral and rocky reefs down to at least 191 m depth on the outer shelves (Ref. 247). Migratory species which feeds on small fish, sharks, rays, squids, and on crabs and lobsters occasionally (Ref. 5213). Maybe solitary or forms small to large schools. Reproduction features ovophagy or uterine cannibalism. Only one of 16-23 egg cases survives. Inoffensive and unaggresive when not provoked (Ref. 247).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A shark with a short, pointed snout, small eyes, protruding spike-like teeth and small, equal-sized dorsal and anal fins; 1st dorsal fin closer to pelvic than to pectoral fins (Ref. 5578). Caudal fin with a pronounced subterminal notch and a short ventral lobe (Ref. 13575). Pale brown or grey, paler below, with dark spots that appear faded in adults; fins plain (Ref. 6586).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records of the great white shark Carcharodon carcharias (Linnaeus) (Lamniformes: Lamnidae) in the Persian/Arabian Gulf (hereafter referred to as “The Gulf”) are limited to a single report from Kuwait, in the northwest Gulf, which has subsequently been noted in key references (e.g. Compagno, 2001). Khalaf (1987) recorded C. carcharias based on an observation of a mounted specimen in Kuwait Science and Natural History Museum on a visit there in March 1987. The specimen is reported as being a female C. carcharias of 3m in length, caught off Kuwait ’s coast and supplied to the museum on the 14th of April 1984. A black and white photograph of the anterior portion (from just posterior of the pelvic fins) was included in Khalaf’s account (Fig. 1 here), but no measurements or morphological data were presented.

 

The present authors examined the photograph and identified the specimen as Carcharias taurus Rafinesque (Lamniformes: Odontaspididae) based on the first dorsal fin origin being well behind the inner margins of the pectoral fins (cf. over the pectoral inner margins in C. carcharias ), the first dorsal fin insertion being about over the pelvic fin origin (cf. being well ahead of pelvic fin origin), a short flattened snout (cf. moderately long conical snout), moderately long gill openings not extending onto the dorsal surface (cf. long gill openings), and characteristic protruding teeth. The photograph presented did not allow for examination of the caudal region or for effective examination of colouration.

 

Carcharodon carcharias has been recorded from a wide range of habitats and with an extensive distribution ranging from the equatorial tropics to the sub-Arctic, and from the intertidal down to the continental slope (Compagno, 2001). Cliff et al. (2000), Compagno (2001), and Zuffa et al. (2002) report white sharks from the tropical Western Indian Ocean off Mozambique and Madagascar north to Tanzania and Kenya and including the Seychelles, Réunion and Mauritius. There is therefore no theoretical reason why this species should not occur in the Persian Gulf or the wider northwestern Indian Ocean, although the nearest confirmed record is from Sri Lanka and possibly the Red Sea (Compagno, 2001). In addition, there are unconfirmed, anecdotal records of white sharks from the Gulf of Aden coast of Yemen, Djibouti and northern Somalia (Conan Doyle, 1963).

 

Gubanov & Schleib (1980) reported C. taurus as sometimes being encountered in Kuwait waters, although Krupp et al., (2000) noted that there was no material provided to support this. Krupp et al., (2000) reported the first record of C. taurus from The Gulf supported by reference material based on a 2.98m specimen caught off Abu Halifa, Kuwait , in 1997. The C. taurus reported here predates this by thirteen years.

License not applicable

Alec B. M. Moore

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Ranges from turbid coastal waters along shore to deeper waters of upper continental and insular slopes; usually found close to the bottom near shore, often in very shallow water (< 4 m) (Castro 1983). Common in neritic waters off northeastern Florida at 5-12 m depth. Nursery grounds are littoral, temperate waters, but do not include embayments or low salinity areas; young are exposed to predation by adult sharks of these areas (Gilmore et al. 1983). Common in temperate and tropical seas on or near coral and rocky reefs (Michael 1993). Often found amid large schools of smaller baitfish (which it occasionally eats).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

An inshore and offshore, littoral shark. This shark occurs in the surf zone off sandy and rocky beaches, in shallow bays, on offshore banks and reefs, in underwater caves, in troughs on sandy areas, and around coral and rocky reefs from the intertidal less than 1mdeep down to at least 191 m, with most at depths of 15 to 25 m. This species is often found near or on the bottom but also occurs in midwater or at the surface.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 0-191 m, often on or near the bottom.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The maximum size of this species has been given variously as ~3.2 m by Compagno (1984a), ~2.75 m and ~142 kg by Hutchins and Swainston (1986) and ~3.2 m and ~300 kg by Hutchins and Thompson (1983). Catch records from beach meshing in NSW, however, suggest that these sharks may grow to 4.3 m, though this maximum length is doubtful and may be due to a misidentification (Reid and Krough 1992).

Branstetter and Musick (1994) described the age and growth of C. taurus in the western North Atlantic based on banding patterns on vertebral centra and stated the maximum age to be 30?35 years. The largest (oldest) male examined (248 cm TL) from the south-eastern USA was 7.5 years old, and the largest (oldest) female examined (272 cm TL) was 10.5 years old. The hypothesis of double annual ring formation is currently being re-examined. If only one ring is deposited each year, the ages cited above would be approximately doubled (J. Musick pers. comm.). The oldest individuals recorded in aquaria were 13 years in Australia (Roughley 1955) and 16 years in South Africa (Govender et al. 1991).

The Grey Nurse Shark occurs either alone or in small to medium-sized aggregations of 20?80 individuals (Silvester 1977, Aitken 1991, Cliff unpubl.). These sharks are often observed hovering motionless just above the seabed in or near deep sandy-bottomed gutters or rocky caves, usually in the vicinity of inshore rocky reefs and islands. They are generally coastal, usually being found from the surf zone down to depths of around 25 m. However, they may also occasionally be found in shallow bays, around coral reefs and, very rarely, to depths of around 200 m on the continental shelf. They usually live near the bottom, but may also move throughout the water column (Compagno 1984a).

Males and females both mature at approximately 2 m in length off the south-eastern USA (Gilmore et al. 1983). They are ovoviviparous and usually only two pups are born per litter once every two years. This is because the remaining eggs and developing embryos are eaten by the largest and/or most advanced embryo in each horn of the uterus (a phenomenon known as adelphophagy or uterine cannibalism). The gestation period may last from 9?12 months and size at birth is relatively large, at about 1 m (Gilmore et al. 1983, Gilmore 1993).

Grey Nurse Shark populations off South Africa and the east coast of the USA are known to undertake complex size and sex segregated migrations. These have been documented by Bass et al. (1975c), Gilmore (1993) and Musick et al. (1993). In other parts of its range and particularly in south-eastern Australia, this species appears to undertake similar migrations.

The species feeds on a wide range of teleost fishes, as well as smaller sharks (Carcharhinidae and Triakidae), rays (Myliobatidae), squids, crabs and lobsters (Compagno 1984, Gelsleichter et al. 1999). Scott et al. (1974) reported that Grey Nurse Sharks in south-eastern Australia fed on shoals of Australian salmon (Arripidae) and other pelagic fish species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 191m.
Recorded at 191 meters.

Habitat: demersal. Ranges from the surf zone, in shallow bays, and around coral and rocky reefs down to at least 191 m depth on the outer shelves (Ref. 247). Often on or near the bottom but also occurs in midwater or at the surface (Ref. 247). A migratory species in parts of its range, particularly in its northern and southern extremities where pronounced poleward migration occur in the summer and equatorial movements in autumn and winter (Ref. 247). Feeds on small fish, sharks, rays, squids, and on crabs and lobsters occasionally (Ref. 5213). Solitary or forms small to large schools. Reproduction features ovophagy or uterine cannibalism. 2 pups per litter, born at 100 cm (Ref. 6586). Matures at about 220 cm (Ref. 6871). Usually inoffensive and unaggresive when not provoked (Ref. 247) but has known to bite swimmers (Ref. 6586).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 1 - 191 m (Ref. 247), usually 15 - 25 m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Grey nurse sharks are found in temperate and tropical waters. They are typically found in shallow waters, such as shallow bays, surf zones, and near coral or rocky reefs. They have been sighted in waters as deep as 191 meters, but will most likely be seen in the surf zone to a depth of 60 meters. They are usually found near the bottom of the water column.

Range depth: 2 to 191 m.

Average depth: 60 meters m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Other Habitat Features: estuarine

  • Leneaweaver III, H., R. Backus. 1970. Natural History of Sharks. United States of America (philidelphia and New York): J.B. Lippincott Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 64 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 6 - 1220
  Temperature range (°C): 4.436 - 26.008
  Nitrate (umol/L): 0.202 - 28.267
  Salinity (PPS): 33.239 - 36.529
  Oxygen (ml/l): 2.896 - 6.300
  Phosphate (umol/l): 0.106 - 1.657
  Silicate (umol/l): 0.942 - 25.103

Graphical representation

Depth range (m): 6 - 1220

Temperature range (°C): 4.436 - 26.008

Nitrate (umol/L): 0.202 - 28.267

Salinity (PPS): 33.239 - 36.529

Oxygen (ml/l): 2.896 - 6.300

Phosphate (umol/l): 0.106 - 1.657

Silicate (umol/l): 0.942 - 25.103
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; marine; depth range 0-191 m. Commonly found inshore to the outer continental shelf. Generally on or near the bottom, also occurs in midwater or at the surface. Maintains neutral buoyancy while swimming by gulping air and storing it in its stomach. Found singly or in schools.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits shallow coastal waters from the surf zone to a depth of 60 metres (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between nearshore waters (summer) deeper waters (winter) (Castro 1983). Female groups make coordinated seasonal coastal movements possibly for breeding, gestation, and eventually parturition (Gilmore et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Considered a voracious eater, feeding on many species (alewives, bluefish, flatfishes, mackerel, menhaden, invertebrates); its teeth are adapted for grasping smaller prey. Known to gather in groups of 3-4 to herd and prey on a school of fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Grey nurse sharks have a range of prey, including bony fish, rays, lobsters, crabs, squid, and other small sharks. Grey nurse sharks sometimes hunt cooperatively, chasing fish into small groups and then attacking them. Grey nurse sharks, like other sharks, have been known to attack at random during feeding frenzies, where a large number of prey is found together. In feeding frenzies sharks rely heavily on their electroreceptors, attacking everything in close vicinity.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on bony fishes, small sharks, rays, squid, crabs , and lobster.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Grey nurse sharks help to regulate prey populations. Different species of lampreys (Petromyzontidae) prey on these sharks in a parasitic relationship, whereby the lamprey attaches to the shark, and extracts blood and other nutrients through a wound. These sharks also have mutualistic relationships with pilotfish (Naucrates ductor), which clean their gills and, in exchange, get to eat the scraps of food left behind in the gills.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The only know predators of adult grey nurse sharks are humans. Human hunting has caused population declines, both as a result of shark fishing and persecution because their fierce appearance has caused them to be mistaken for other, more dangerous, species of sharks. They are also accidentally caught in commercial fishing nets. Young sharks are eaten by other sharks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Exact number of occurrences is unknown; likely to be many based upon wide distribution in the Atlantic Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Global abundance is unknown. Often common in warm temperate regions; common from Cape Cod to Delaware Bay during the warmer months. Although first reported from Texas in the 1960s, this species does not appear to be uncommon in the northwestern Gulf of Mexico (Hoese and Moore 1998). It is more common along the eastern coast of Florida than the eastern Gulf of Mexico (Gilmore et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

The causes of mortality are poorly known because they have low commercial value and are often difficult to obtain for study (Hoenig and Walsh 1983). Vertical lesions, specifically regions of swelling along the vertebral column, have been recorded from captured specimens (Hoenig and Walsh 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

feeds on a wide variety of bony fishes (teleosts), with elasmobranchs an important secondary prey; crustaceans, cephalopods, and marine mammals are also taken. Bony fish prey includes herring (Clupeidae), anchovies (Engraulidae), hake (Merluccidae), eels (Anguillidae), monkfish or anglers (Lophiidae), cusk eels (Ophidiidae), lizardfish (Synodontidae), sea catfish (Ariidae), croakers (Sciaenidae), Australian salmon (Arripidae), morwong (Cheilodactylidae), rock blackfish or opaleyes (Girellidae), bluefish, elf or taylor (Pomatomidae), mackerel and bonito (Scombridae),butterfishes (Stromateidae), snappers (Lutjanidae), wrasses (Labridae), mullet (Mugilidae), spadefish (Chaetodipteridae), sea robins (Triglidae), flatheads (Platycephalidae), duckbills (Percophidae), midshipmen (Batrachodidae), sea basses(Serranidae), porgies or sea bream (Sparidae), jacks (Carangidae), remoras (Echeneidae), flatfish (Pleuronectiformes) including soles (Soleidae), American soles (Achiridae), Atlantic flounders (Scophthalmidae), and righteye flounders (Paralichthyidae), and undoubtedly many others. Elasmobranch prey includes requiem sharks (Carcharhinidae), houndsharks (Triakidae), angel sharks (Squatinidae), skates (Rajidae) and their egg cases, and eagle rays (Aetobatus and Myliobatis, Myliobatidae). Invertebrate prey includes squid (Loliginidae), crabs, lobsters and hermit crabs (Paguridae). Plant material is rarely found in stomach contents, and presumably is accidentally ingested along with animal prey.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Feeds on bony fishes, small sharks, rays, squids, crabs and lobsters
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Communication among grey nurse sharks is not well understood. Sharks in general are sensitive to electrical and chemical cues.

Grey nurse sharks, and other species of sharks, have pores on their ventral surface. These pores are instrumental in detecting electrical fields, which help them to detect and locate prey and may help in navigating using the earth's magnetic field.

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed, then cannibalize siblings (adelphophagy) (Ref. 50449). Distinct pairing with embrace (Ref. 205). Eggs leave the ovaries, and while in transit in the oviducts are fertilized and enclosed in groups of 16 to 23 in egg cases. However, at some time between fertilization and birth only two (Ref. 5578, 6586) embryos of its group prevails, possibly by devouring its rivals, and proceeds to eat fertilized eggs and smaller potential siblings in utero until birth. According to Springer (1948) (Ref. 39565), it is evident that this species sends forth into the world not only large, well-developed, and even experienced young but may send them forth with a full stomach. The yolk sac is resorbed at a small size, less than 17 cm, and the umbilical scar may be lost. Gestation period may be from 8 to 9 months long. Size at birth 100 cm (Ref. 6586).Pratt (2001) (Ref. 49562) relates Gordon's (1993) (Ref. 51113) detailed account of the mating behavior of the sand tiger sharks as follows: "mating activities began when the two male C. taurus, having become reluctant to feed, increased their swimming speed, accompanied by clasper flexion and eventual interest in their female tank mates...aggressive displays such as snapping and stalking became frequent, mostly toward species of smaller Carcharhinus in the tank. The males did not become interested in the female until she slowed, moved to the sand area and started cupping her pelvic fins. The two males then became competitive toward each other, circling and tailing, until the alpha male forced the beta male out of the sand area. The female bit the male prior to copulation. She exhibited shielding behavior for several days and then resumed cupping and flaring. The female gradually changed her swimming position and began displaying the submissive behavior. The alpha male swam in increasingly larger circles and began splaying its claspers, then approached the female and exhibited tailing and nosing. Copulation occurred as the male bit into the right flank and trailing edge of the pectoral fin of the female. The male swam side by side with the female, copulating with the right clasper for one to two minutes. After copulation, the male showed little interest in the female." In captivity, males show aggression toward other species after copulation (Ref. 51113, 49562). Females avoid patrolling males by 'shielding' with pelvics close to the substrate (Ref. 51113, 49562). However, female acceptance of future male partner is indicated by a show of 'submissive' body, 'cupping' and 'flaring' of pelvic fins (Ref. 51113, 49562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

It takes a grey nurse shark pup between 6-9 months to develop in the uterus of a female. Young nurse sharks develop a jaw and teeth very early their development and some eat their siblings while still developing within their mother, a phenomenon known as intra-uterine cannibalism. It is uncertain how long it takes grey nurse sharks to reach maturity, but maturity is estimated at between 5 and 13 years. Sharks continue to grow throughout their lives.

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of ocean dwelling grey nurse sharks, however those held in captivity live to an average age of thirteen to sixteen years. It is believed that those in the wild live longer still.

Range lifespan

Status: wild:
35 (high) years.

Range lifespan

Status: captivity:
16 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Winter-spring is the breeding period off the Florida east coast (Gilmore et al. 1983). Individuals may aggregate in specific areas for mating (Michael 1993). Development is ovoviviparous. The gestation time is very long (10.5 months) (Pratt and Casey 1987). Individuals are about 65-110 cm total length at birth (Gilmore et al. 1983; Michael 1993). Age and growth data are lacking except for captive specimens (Branstetter 1990). The birthing season in Florida waters occurs during November through February. Adult females produce only two extremely large (> 100 cm) young per mating season (embryos are oviphagous and cannibalistic) (Castro 1983, Gilmore et al. 1983). Females reach maturity at 237 cm total length (Pratt and Casey 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males outnumber females by a 2:1 ratio and multiple males will copulate with a single female. A dominance hierarchy has only been observed in captivity, with the oldest males copulating first.

Mating System: polygynandrous (promiscuous)

Mating occurs in November and October. The gestation period will take anywhere from six to nine months. Females give birth in early spring near coastal, rocky reefs. Caves inhabited by these sharks are also used as breeding grounds and, if disrupted, their breeding may be interrupted. Female sharks bear young once every two years, with a maximum of two shark pups at birth, one from each uterus. Grey nurse sharks are ovoviviparous which means that eggs develop inside of the female in each uterus. Young hatch from the eggs and are retained in the uteri until they are fully developed. Females have hundreds of eggs inside the uterus. When an egg is fertilized the shark pup begins to grow and, at 55 mm, develops a jaw and teeth. This shark then eats the other developing embryos during its 6 to 9 month gestation (intra-uterine cannibalism).

Males mature at a length of 1.95 meters, or 4-5 years in age, and females mature at 2.2 meters, or 6 years in age.

Breeding interval: Grey nurse sharks bear young once every two years.

Breeding season: Shark pups are usually born in early spring (March and April).

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 6 to 9 months.

Range age at sexual or reproductive maturity (female): 5 to 13 years.

Average age at sexual or reproductive maturity (female): 7-8 years.

Range age at sexual or reproductive maturity (male): 5 to 13 years.

Average age at sexual or reproductive maturity (male): 7-8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

A pup will be born approximately 115-150 cm in length. This shark is able to fend for itself and live without parental care. Intra-uterine cannibalism ensures plenty of energy to the developing pup, resulting in a well-fed and well-developed offspring.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Hamlett, W. 1999. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press.
  • Carrier, J., J. Musick, M. Helithaus. 2004. Biology of Sharks and Their Relatives. Boca Raton, London, New York, Washington, D.C.: CRC Press.
  • Office of Naval Research. Sensory Biology of Sharks, Skates, and Rays. N00014-76-C-0943. Arlington, Va: U.S. Government. 1979.
  • Cooper, P. 2006. "Sandtiger shark" (On-line). Ichthyology at the Florida Museum of Natural History: Biological Profiles. Accessed April 18, 2006 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/Sandtiger/Sandtiger.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ovoviviparous. One embryo develops in each oviduct.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharias taurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 73 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGGGCAGGAATAGTAGGAACAGCCCTAAGCCTTCTAATTCGAGCTGAACTAGGACAACCCGGATCACTCCTAGGAGATGATCAGATCTATAATGTTATTGTAACCGCCCATGCATTTGTAATAATTTTCTTCATGGTTATACCTGTAATAATTGGTGGATTCGGAAACTGACTAGTGCCCTTAATAATTGGTGCACCAGACATAGCCTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTTCCCCCCTCTTTTCTTTTACTCCTAGCTTCAGCTGGAGTCGAAGCTGGAGCCGGCACCGGTTGAACGGTGTATCCTCCTTTAGCCGGTAACTTAGCCCATGCCGGAGCATCCGTTGACTTAGCTATCTTTTCTCTTCATTTAGCAGGCATTTCATCAATCTTAGCCTCAATCAACTTCATTACAACCATTATTAACATAAAACCCCCAGCTATCTCTCAGTACCAAACACCATTATTTGTATGATCAATTTTAGTAACAACTATCCTCCTCCTTCTATCCCTTCCAGTACTTGCAGCTGGTATCACTATACTTCTTACGGACCGAAACTTAAACACAACATTCTTTGACCCGGCTGGGGGAGGAGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carcharias taurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 78
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Wide, nearly cosmopolitan distribution in subtropical and warm temperate oceans; number of extant occurrences and global abundance are not well documented; no known protected occurrences and no specific fisheries protection afforded; considered extremely susceptible to overfishing due to based on life history characteristics, particularly very low reproductive output.

Other Considerations: Slow growth (Pratt and Casey 1987, Branstetter 1990), delayed reproduction, and very low reproductive output (Compagno 1990) make this species vulnerable to overexploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ab+3d

Version
3.1

Year Assessed
2009

Assessor/s
Pollard, D. & Smith, A.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the the information published in the 2005 shark status survey (Fowler et al. 2005).

The Grey Nurse Shark (Carcharias taurus) is a large, coastal shark with a disjunct distribution, occurring in most subtropical and warm temperate oceans, except for the Eastern Pacific. It has a strongly K-selected life history and produces only two large pups per litter. As a result, annual rates of population increase are very low, greatly reducing its ability to sustain fishing pressure. Populations in several locations have been severely depleted by commercial fishing, spearfishing and protective beach meshing, requiring the introduction of specific management measures.

History
  • 2000
    Vulnerable
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Grey nurse sharks were the first shark species to be protected by law. Grey nurse sharks are cited as being critically endangered in the Commonwealth Legislation (Australia). They are also considered endangered in New South Wales. The Queensland Government is hoping to provide a listing in the Nature Conservation Act of 1992 which will give these sharks additional protection. The National Marine Fisheries service in the United States prohibits hunting of these sharks. The IUCN lists grey nurse sharks as a vulnerable species on the red list (last evaluated in 2000). CITES does not have a listing for them, and is the most recently updated (2005). The fact that these sharks live in shallow, accessible waters, have a fierce appearance, and have a low reproductive rate, has contributed to declines in populations. Population declines worldwide are estimated at 20% in the last 10 years.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Insufficient information exists to determine population trends; assumed to be stable but may be declining because of fishing pressure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Principal threat is fishing, although habitat degradation in coastal waters and nursery areas may affect juveniles. Generally fished wherever it exists; regularly caught in substantial amounts (Compagno 1990). Caught with hook-and-line, gill nets, and trawls for meat, fishmeal, liver oil, fins, and hide. Often caught by sport anglers and was formerly targeted by fishermen in Australia and South Africa. Much of catch is relatively minor bycatch for more fecund teleosts. Mostly caught as bycatch in Japanese tuna longline vessels (Taniuchi 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Grey Nurse Sharks have been fished throughout their range in the past, but are of variable economic importance regionally (Compagno 1984a). The species is highly regarded as a food fish in Japan, but not in the western Atlantic. It is caught primarily with line fishing gear, but is also taken in bottom-set gillnets and trawls. The meat is utilised fresh, frozen, smoked, and dried and salted, for human consumption. This species has also been used for fishmeal, its liver for oil, and its fins for making soup via the oriental sharkfin trade (Compagno 1984a).

This species has been taken along the Atlantic coast of the United States in a commercial shark fishery directed towards a wide array of large coastal species, but supported primarily by catches of Carcharhinus plumbeus and C. limbatus. Musick et al. (1993) showed that several species of sharks, including the sand tiger, had declined by as much as 75% during the decade from 1980?1990 because of overfishing. Recently, this fishery has come under management and C. taurus has been accorded full protection (see below).

In the 1850s, this species was fished by hook-and-line in and around Botany Bay, New South Wales (NSW), Australia, during October and November, to provide a source of oil ?of excellent quality for burning in lamps? (Grant 1982). In the late 1920s this species was also fished, together with other shark species, at Port Stephens, NSW (Roughley 1955). It was the second most commonly captured shark after the whaler sharks (Carcharhinidae) in this area. According to Roughley (1955), Grey Nurse Sharks produced the best quality shark leather but their fins were not as desirable as those from some of the other sharks commonly caught in this fishery. Commercial fishing for C. taurus reputedly continued on and off in NSW using various methods up until the Second World War.

Pepperell (1992) summarised catch records of gamefishermen in south-eastern Australia and found that C. taurus constituted 11% (161 sharks) of the total recorded shark catch (1,461) during the 1960s and 7% (244 sharks) in the 1970s (total catch 3,466 sharks). The weights of C. taurus specimens caught by game fishermen ranged from less than 10 to around 190 kg (Pepperell 1992). Capture of this species was banned voluntarily by game fishermen throughout Australia in 1979 (Pepperell 1992).

Meshing of beaches was instituted in NSW in the late 1930s to protect bathers from shark attack (Reid and Krough 1992). Since then, shark meshing has also been adopted in Queensland, Australia (Paterson 1986) and in Natal, South Africa (Cliff and Dudley 1992). Carcharias taurus comprised 3.8% (n = 369) of the total NSW (i.e. Newcastle-Sydney-Wollongong area) beach meshing catch of sharks from 1950?1990 (Reid and Krough 1992). The number of C. taurus taken in these mesh nets in NSW over this 40-year period is thus slightly less than that taken by game fishermen during the 1960s and 1970s. Overall, there have been large declines over time in the meshing catch and catch per unit effort for the species. During the early 1950s, 24?36 C. taurus were meshed per year, but since the late 1970s only 0?3 were caught each year (Pollard et al. 1996). Prior to this 40-year period, Coppleson (1958) reported 58 Grey Nurse Sharks being caught in these beach meshing nets between October and December 1937.

Cliff and Dudley (1992) reported an average annual catch of 246 spotted ragged tooth sharks in the Natal (South Africa) beach meshing programme for the period 1978?1990, with 38% of the catch being found alive in the nets. Whenever possible these live sharks were released, many with tags. Between 1966?1972 there was a significant decline in the catch rate of this species, followed by a significant increase between 1972?1990 (Dudley and Cliff 1993a). Maximum and minimum catches were 20 (1966) and two (1981) sharks per km of net per year (Dudley and Cliff 1993a).

Interactions between skindivers and C. taurus in Australia are nowadays rare. There are reports of Grey Nurse Sharks stealing speared fish from skindivers, but this is not common. During the 1950s and 1960s, however, skin and SCUBA divers armed with barbless or barbed spears, hypodermic spears containing strychnine nitrate, and especially explosive powerheads, killed many C. taurus off the NSW coast (Cropp 1964). Divers also took them alive, often with lassos, to sell to aquariums (Cropp 1964). Carcharias taurus are still taken, under permit, for aquariums (Smith 1992), but with the assigning of their protected status (see later) and an increased awareness of the need for their conservation, there are now no reports of divers killing these sharks deliberately.

Because of its large size and fearsome appearance, and because it occurs in relatively shallow water where it often hovers almost motionless near the sea floor, C. taurus can be readily approached and is now a very popular attraction with SCUBA divers. Dive guides tend to highlight locations where these sharks regularly occur (e.g., Byron 1985), and divers can observe C. taurus at the same locations on many occasions, suggesting a high degree of site-attachment by these sharks. On the other hand, concern has been expressed (most recently in South Africa) that disturbance by divers may be detrimental to natural behaviour patterns and could even result in the exclusion of some sharks from critical habitat and/or important refuge areas (Andrew Cobb in litt.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2ab+3d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species of shark is particularly vulnerable to overfishing due to its low reproduction rate (2). Despite a widespread distribution, populations are now isolated and, where there is data available, the species is thought to be in decline. In the past, the sand tiger shark has been hunted throughout its range, and the flesh is particularly prized in Japan (3). The oil and fins are also in demand; in the 18th and 19th Centuries the shark was persecuted in large numbers for its liver oil that was used in lighting (7). Individuals tend to group in coastal areas at certain times of the year, making them especially vulnerable to fishing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: More research on population dynamics and reproductive biology is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: No known protected occurrences. In 1989, the National Marine Fisheries Service judged large coastal sharks (including the tiger shark) to have been overfished by 2,348 metric tons and in 1990 by 1,431 metric tons. As a result, the National Marine Fisheries Service set annual poundage quotas, called total allowable catches for each of the heavily fished groups. In 1993 the total allowable catch for large coastal sharks was set at 2,436 metric tons plus a 464 metric tons recreational quota. The total allowable catch for large coastal sharks was set to be adjusted annually upward at 80% of the annual surplus production. This strategy was predicted to allow for a population increase leading to a return of the natural Maximum Sustainable Yield by the year 2000 (Burgess 1998). Sport anglers were restricted to two sharks per boat per trip for combined large coastal and pelagic sharks. Sale of recreationally caught sharks was prohibited (Burgess 1998). Finning of sharks by commercial and recreational fishermen was prohibited. In addition, a system of data collection and reporting was partially implemented (Burgess 1998). Still this plan has underestimated the recovery of the stocks (Burgess 1998). The total annual take of large coastal sharks was reduced to a total of 2,570 metric tons in 1994 and additional restrictions may be forthcoming (Burgess 1998).

Needs: Occurrences should be protected to ensure long-term survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Carcharias taurus was protected in NSW in 1984 because of serious declines in the population due to commercial and recreational fishing, spearfishing and beach meshing. In early 1997, the Queensland State Government also declared C. taurus a totally protected species in that State?s waters, and the Australian Commonwealth Government followed suit with protection of C. taurus as a Vulnerable species in all Commonwealth waters and throughout Australia?s Exclusive Economic Zone (EEZ) (i.e., out to two hundred nautical miles offshore). Also in 1997, C. taurus received full protection on the Atlantic and Gulf coasts of the USA, under the Atlantic Fishery Management Plan. The main current threat to this species in south-eastern Australia is probably the accidental (bycatch) capture of juveniles by recreational line fishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Despite protection in some countries such as Australia (2) and the United States (3), this species appears to be in decline (2). Management plans urgently need to be implemented in order to safeguard the future of these elegant coastal dwellers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Not considered to be of economic importance and generally not considered dangerous to humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Grey nurse sharks are known for their fierce appearance and have gained an undeserved reputation as a man-eater in Australia. These sharks are not generally aggressive, but have been known to bite. Their bites can inflict serious damage because of their size and their dangerous teeth. They are sometimes tangled in fishing nets.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Shark teeth are lost frequently and are prized gifts in many regions of the world. Shark is a delicacy that is eaten in many areas.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

  • 2005. "Conservation on International Trade in Endangeren Species of wild flora and fauna" (On-line). Accessed November 19, 2005 at http://www.cites.org/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sand tiger shark

Not to be confused with sand shark, tiger shark, or nurse shark.

The sand tiger shark (Carcharias taurus), grey nurse shark, spotted ragged-tooth shark, or blue-nurse sand tiger is a species of shark that inhabits subtropical and temperate waters worldwide. It inhabits the continental shelf, from sandy shorelines (hence the name sand tiger shark) and submerged reefs to a depth of around 191 m (627 ft).[2] They dwell in the waters of Japan, Australia, South Africa, the Mediterranean and the east coasts of North and South America. It is not related to the tiger shark Galeocerdo cuvier; however, it is a cousin of the great white shark Carcharodon carcharias. Despite its fearsome appearance and strong swimming ability, it is a relatively placid and slow-moving shark with no confirmed human fatalities. This species has a sharp, pointy head, and a bulky body. The sand tiger's length can reach 3.0 m (9.8 ft). They are grey with reddish-brown spots on their backs. Shivers (groups) have been observed to hunt large schools of fish. Their diet consists of bony fish, crustaceans, squid, skates and other sharks. Unlike other sharks, the sand tiger can gulp air from the surface, allowing it to be suspended in the water column with minimal effort. During pregnancy, the most developed embryo will feed upon its siblings, a reproductive strategy known as intrauterine cannibalism i.e. "embryophagy" or, more colorfully, adelphophagy — literally "eating one's brother." The sand tiger is categorized as vulnerable on the International Union for Conservation of Nature Red List. It is the most widely kept large shark in public aquariums owing to its tolerance for captivity.

Taxonomy[edit]

The sand tiger shark's description as Carcharias taurus by Constantine Rafinesque came from a specimen caught off the coast of Sicily. Carcharias taurus means "bull shark". This taxonomic classification has been long disputed. Twenty-seven years after Rafinesque's original description the German biologists Müller and Henle changed the genus name from C. taurus to Triglochis taurus. The following year, Swiss-American naturalist Jean Louis Rodolphe Agassiz reclassified the shark as Odontaspis cuspidata based on examples of fossilized teeth. Agassiz's name was used until 1961 when three palaeontologists and ichthyologists, W. Tucker, E. I. White, and N. B. Marshall, requested the shark be returned to the genus Carcharias. This request was rejected and Odontaspis was approved by the International Code of Zoological Nomenclature (ICZN). When experts concluded that taurus belongs after Odontaspis, the name was changed to Odontaspis taurus. In 1977 Compagno and Follet challenged the Odontaspis taurus name and substituted Eugomphodus, a somewhat unknown classification, for Odontaspis. Many taxonomists questioned his change arguing there was no significant difference between Odontaspis and Carcharias. After changing the name to Eugomphodus taurus, Compagno successfully advocated in establishing the shark's current scientific name as Carcharias taurus. The ICZN approved this name, and today it is used among biologists.[2]

Common names[edit]

Because the sand tiger shark is worldwide in distribution, it has many common names. The term "sand tiger shark" actually refers to four different sand tiger shark species in the family Odontaspididae. Furthermore, the name creates confusion with the tiger shark Galeocerdo cuvier which is not related to the sand tiger. The grey nurse shark, the name used in Australia and the United Kingdom, is the second-most-used name for the shark, and in India it is known as blue-nurse sand tiger. However, there are unrelated nurse sharks in the family Ginglymostomatidae. The most unambiguous and descriptive English name is probably the South African one, spotted ragged-tooth shark.[2][3]

Identification[edit]

There are four species of sand tiger sharks[2]

  1. The sand tiger shark Carcharias taurus
  2. The Indian sand tiger shark Carcharias tricuspidatus. Very little is known about this species which, described before 1900, is probably the same as (a synonym of) the sand tiger C. taurus[2]
  3. The small-toothed sand tiger shark Odontaspis ferox. This species has a worldwide distribution, is seldom seen but normally inhabits deeper water than does C. taurus.
  4. The large-eyed sand tiger shark Odontaspis noronhai, a deep water shark of the Americas, of which little is known.
Diagram indicating the differences between C. taurus and O. ferox

The most likely problem in identifying the sand tiger shark, is in the presence of either of the two species of Odontaspis. Firstly, the sand tiger is usually spotted, especially on the hind half of the body. However, there are several other differences that are probably more reliable

  1. The bottom part of the caudal fin (tail fin) of the sand tiger is smaller;
  2. The second (i.e. hind) dorsal fin of the sand tiger is almost as large as the first (i.e. front) dorsal fin.
  3. The first (i.e. front) dorsal fin of the sand tiger is relatively non-symmetric;
  4. The first (i.e. front) dorsal fin of the sand tiger is closer to the pelvic fin than to the pectoral fin (i.e. the first dorsal fin is positioned further backwards in the case of the sand tiger);
Snout and mouth of sand tiger shark, showing protruding teeth and small eyes

Description[edit]

The head is pointy, as opposed to round, while the snout is flattened with a conical shape. Its body is stout and bulky and its mouth extends beyond the eyes. The eyes of the sand tiger shark are small, lacking eyelids.[2] A sand tiger usually swims with its mouth open displaying three rows of protruding, smooth-edged, sharp-pointed teeth.[4] The males have grey claspers with white tips located on the underside of their body. The caudal fin is elongated with a long upper lobe (i.e. strongly heterocercal). They have two large, broad-based grey dorsal fins set back beyond the pectoral fins.[2] The sand tiger shark has a grey-brown back and pale underside. Adults tend to have reddish-brown spots scattered, mostly on the hind part of the body.[4] In August 2007, an albino specimen was photographed off South West Rocks, Australia.[5] The teeth of these sharks have no transverse serrations (as have many other sharks) but they have a large, smooth main cusp with a tiny cusplet on each side of the main cusp.[2] The upper front teeth are separated from the teeth on the side of the mouth by small intermediate teeth.

Habitat and range[edit]

Geographical range[edit]

Sand tiger sharks roam the epipelagic and mesopelagic regions of the ocean,[6] sandy coastal waters, estuaries, shallow bays, and rocky or tropical reefs, at depths of up to 190 metres (623 ft).

A migrating sand tiger shark on the Aliwal Shoal on the east coast of South Africa

The sand tiger shark can be found in the Atlantic, Pacific and Indian Oceans, and in the Mediterranean and Adriatic Seas. In the Western Atlantic Ocean, it is found in coastal waters around from the Gulf of Maine to Florida, in the northern Gulf of Mexico around the Bahamas and Bermuda, and from southern Brazil to northern Argentina. It is also found in the eastern Atlantic Ocean from the Mediterranean Sea to the Canary Islands, at the Cape Verde Islands, along the coasts of Senegal and Ghana, and from southern Nigeria to Cameroon. In the western Indian Ocean, the shark ranges from South Africa to southern Mozambique, but excluding Madagascar. The sand tiger shark has also been sighted in the Red Sea and may be found as far east as India. In the western Pacific, it has been sighted in the waters around the coasts of Japan and Australia, but not around New Zealand.[1]

Annual movements of sand tiger sharks off South Africa and Australia

Annual migration[edit]

Sand tigers in South Africa and Australia undertake an annual migration that may cover more than 1,000 km (620 mi).[6] They pup during the summer in relatively cold water (temperature ca. 16 °C). After parturition, they swim northwards toward sites where there are suitable rocks or caves, often at a water depth ca. 20 m (66 ft), where they mate during and just after the winter.[7] Mating normally takes place at night. After mating they swim further north to even warmer water where gestation takes place. In the Autumn they return southwards to give birth in cooler water. This round trip may encompass as much as 3,000 km (1,900 mi). The young sharks do not take part in this migration, but they are absent from the normal birth grounds during winter: it is thought that they move deeper into the ocean.[6] At Cape Cod (USA) juveniles move away from coastal areas when water temperatures decreases below 16 °C (61 °F) and day length decreases to less than 12 h.[8] Juveniles, however, return to their usual summer haunts and as they become mature they start larger migratory movements.

Behaviour[edit]

The underbelly of a sand tiger shark, showing its pectoral fins

Hunting[edit]

The sand tiger shark is a nocturnal feeder. During the day, they take shelter near rocks, overhangs, caves and reefs often at relatively shallow depths (<20 m). This is the typical environment where divers encounter sand tigers. However, at night they leave the shelter and hunt over the ocean bottom, often ranging far from their shelter.[9] Sand tigers hunt by stealth. It is the only shark known to gulp air and store it in the shark's stomach, allowing the shark to maintain near-neutral buoyancy which helps it to hunt motionlessly and quietly.[2] Aquarium observations indicate that when it comes close enough to a prey item, it grabs with a quick sideways snap of the prey. The sand tiger shark has been observed to gather in hunting groups when preying upon large schools of fish.[2]

Diet[edit]

A bottom-living smooth-hound shark, one of the important prey items of sand tiger sharks

The majority of prey items of sand tigers are demersal (i.e. from the sea bottom), suggesting that they hunt extensively on the sea bottom as far out as the continental shelf. Bony fish (Teleosts) form about 60% of sand tigers food, the remaining prey comprising sharks and skates. In Argentina, the prey includes mostly demersal fishes, e.g. the striped weakfish (Cynoscion guatucupa). The most important elasmobranch prey is the bottom-living smooth-hound shark (Mustelus sp.). Benthic (i.e. free-swimming) rays and skates are also taken.[10] Stomach content analysis indicates that smaller sand tigers mainly focus on the sea bottom and as they grow larger they start to take more benthic prey. This perspective of the diet of sand tigers is consistent with similar observations in the north west Atlantic[11] and in South Africa where large sand tigers capture a wider range of shark and skate species as prey, from the surf zone to the continental shelf, indicating the opportunistic nature of sand tiger feeding.[9] Off South Africa, sand tigers less than 2 m (6 ft 7 in) in length prey on fish about a quarter of their own length; however, large sand tigers capture prey up to about half of their own length.[9] The prey items are usually swallowed as three or four chunks.[10]

Courtship and mating[edit]

Mating occurs around the months of March and April in the northern hemisphere and during August–October in the southern hemisphere. The courtship and mating of sand tigers has been best documented from observations in large aquaria. In Oceanworld, Sydney, the females tended to hover just above the sandy bottom ("shielding") when they were receptive.[12] This prevented males from approaching from underneath towards their cloaca. Often there is more than one male close by with the dominant one remaining close to the female, intimidating others with an aggressive display in which the dominant shark closely follows the tail of the subordinate, forcing the subordinate to accelerate and swim away. The dominant male snaps at smaller fish of other species. The male approaches the female and the two sharks protect the sandy bottom over which they interact. Strong interest of the male is indicated by superficial bites in the anal and pectoral fin areas of the female. The female responds with superficial biting of the male. This behaviour continues for several days during which the male patrols the area around the female. The male regularly approaches the female in "nosing" behaviour to "smell" the cloaca of the female. If she is ready, she swims off with the male, while both partners contort their bodies so that the right clasper of the male enters the cloaca of the female. The male bites the base of her right pectoral fin, leaving scars that are easily visible afterwards. After one or two minutes, mating is complete and the two separate. Females often mate with more than one male.[13] Females mate only every second or third year.[14] After mating, the females remain behind, while the males move off to seek other areas to feed,[14] resulting in many observations of sand tiger populations comprising almost exclusively females.

Reproduction and growth[edit]

Growth curve for sand tiger sharks in the north Atlantic

Reproduction[edit]

The reproductive pattern is similar to that of many of the Lamnidae, the shark family to which sand tigers belong. Female sand tigers have two uterine horns that, during early embryonic development, may have as many as 50 embryos that obtain nutrients from their yolk sacs and possibly consume uterine fluids. When one of the embryos reaches some 10 cm (4 in) in length, it eats all the smaller embryos so that only one large embryo remains in each uterine horn, a process called intrauterine cannibalism i.e. "embryophagy" or, more colorfully, adelphophagy — literally "eating one's brother."[2][13] While multiple male sand tigers commonly fertilize a single female, adelphophagy sometimes excludes all but one of them from gaining offspring. These surviving embryos continue to feed on a steady supply of unfertilised eggs.[15] After a lengthy labour, the female gives birth to 1 m (3 ft) long, fully independent offspring. The gestation period is approximately eight to twelve months. These sharks give birth only every second or third year,[14] resulting in an overall mean reproductive rate of less than one pup per year, one of the lowest reproductive rates for sharks.

Growth[edit]

In the north Atlantic sand tiger sharks are born about 1 m in length. During the first year they grow about 27 cm to reach 1.3 m. After that the growth rate decreases by about 2.5 cm each year until it stabilises at about 7 cm/y.[16] Males reach sexual maturity at an age of five to seven years and approximately 1.9 m (6 ft) in length. Females reach maturity when approximately 2.2 m (7 ft) long at about seven to ten years of age.[16] They are normally not expected to reach lengths much over 3 m. In the informal media such as YouTube there have been several reports of sand tigers around five meters in length, but none of these have been verified scientifically.

Interaction with humans[edit]

Shark attacks on humans[edit]

The sand tiger is often associated with being vicious or deadly, due to their relatively large size and sharp, protruding teeth that point outward from their jaws, however they are quite docile, and are not a threat to humans: their mouths are not large enough to cause a human fatality. Sand tigers roam the surf, sometimes in close proximity to humans, and there have been only a few instances of unprovoked sand tiger shark attacks on humans, these usually being associated with spear fishing, line fishing or shark feeding.[17] As of 2013 the database of Shark Attack Survivors does not list any fatalities due to sand tiger sharks.[18] When the sharks become aggressive they tend to steal the fish or bait rather than attack humans. Owing to its large size and docile temperament, the sand tiger is commonly displayed in aquariums around the world.[17]

Nets around swimming beaches and their effects on sand tiger sharks[edit]

In Australia and South Africa one of the common practices in beach holiday areas is to erect shark nets around the beaches frequently used by swimmers. These nets are erected some 400 m (1,300 ft) from the shore and act as gill nets that trap incoming sharks:[19] this was the norm until about 2005. In South Africa, the mortality of sand tiger sharks caused a significant decrease in the length of these animals and it was concluded that the shark nets pose a significant threat to this species that has a very low reproductive rate[20] Before 2000, these nets snagged about 200 sand tiger sharks per year in South Africa, of which only about 40% survived and were released alive.[21] The efficiency of shark nets for the prevention of unprovoked shark attacks on bathers has been questioned, and since 2000 there has been a reduced use of these nets and alternative approaches are being developed.

Sand shark in the Newport Aquarium

Competition for food between humans and sand tiger sharks[edit]

In Argentina, the prey items of sand tigers largely coincided with important commercial fisheries targets.[10] Humans affect sand tiger food availability and the sharks, in turn, compete with humans for food that, in turn, has already been heavily exploited by the fisheries industry. The same applies to the bottom-living sea catfish (Galeichthys feliceps), a fisheries resource off the South African coast.[9]

Effects of scuba divers on sand tiger sharks[edit]

Sand tiger sharks are often the targets of scuba divers who wish to observe or photograph these animals. A study near Sydney in Australia found that the behaviour of the sharks are affected by the proximity of scuba divers.[22] Diver activity affects the aggregation, swimming and respiratory behaviour of sharks, but only at short time scales. The group size of scuba divers was less important in affecting sand tiger behaviour than the distance within which they approached the sharks. Divers approaching to within 3 m of sharks affected their behaviour but after the divers had retreated, the sharks resumed normal behaviour. Scuba divers are normally compliant when it comes to observing the Australian regulations for shark diving.[23]

Sand tiger sharks in captivity[edit]

Its large and menacing appearance, combined with its relative placidity, has made the sand tiger shark among the most popular shark species to be displayed in public aquaria.[24] However, as with all large sharks, keeping them in captivity is not without its difficulties. Sand tiger sharks have been found to be highly susceptible to developing spinal deformities, with as many as one in every three captive sharks being affected, giving them a hunched appearance.[25] These deformities have been hypothesized to be correlated to both the size and shape of their tank.[26] As sharks need to be in constant motion in order to absorb oxygen through their gills, their tanks need to be of sufficient size to allow free motion. If the tank is too small, the sharks have to spend more time actively swimming than they would in the wild, where they have space to glide. Also, sharks in small, circular tanks often spend most of their time circling along the edges in only one direction, causing asymmetrical stress on their bodies.

Threats and conservation status[edit]

Threats to sand tiger sharks[edit]

There are several factors contributing to the decline in the population of the sand tigers. Sand tigers reproduce at an unusually low rate, due to the fact that they do not have more than two pups at a time and because they breed only every second or third year. This shark is a highly prized food item in the western northern Pacific, off Ghana and off India and Pakistan where they are caught by fishing trawlers, although they are more commonly caught with a fishing line.[2] Sand tigers' fins are a popular trade item in Japan.[1] Off North America, it is fished for its hide and fins. Shark liver oil is a popular product in beauty products such as lipstick.[4] It is sought by anglers in fishing competitions in South Africa and some other countries. In Australia it has been heavily reduced in numbers by spear fishers using poison and where it is now protected.[2] It is also prized as an aquarium exhibit in the United States, Europe, Australia and South Africa because of its docile and hardy nature.[2] Thus, overfishing is a major contributor to the population decline. All indications show that the world population in sand tigers has been reduced significantly in size since 1980.[2] Many sand tigers are caught in shark nets, and then either strangled or taken by fishermen.[1] Estuaries along the United States of America's eastern Atlantic coast houses many of the young sand tiger sharks. These estuaries are susceptible to non-point source pollution that is harmful to the pups.[4]

Conservation status of sand tiger sharks[edit]

This species is therefore listed as vulnerable on the International Union for Conservation of Nature Red List,[1] and as endangered under Queensland's Nature Conservation Act 1992. It is a U.S. National Marine Fisheries Service Species of Concern, which are those species that the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service (NMFS), has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act. According to the National Marine Fisheries Service, any shark caught must be released immediately with minimal harm, and is considered a prohibited species, making it illegal to harvest any part of the sand tiger shark on the United States' Atlantic coast.[4]

References[edit]

  1. ^ a b c d e Pollard, D.; & Smith, A. (2009). "Carcharias taurus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved November 29, 2011. 
  2. ^ a b c d e f g h i j k l m n o Compagno, L. J. V. (1984). FA0 Species Catalogue, Vol. 4. Sharks of the World. An annotated and illustrated catalogue of shark species known to date. Part 1, "Hexanchiformes to Lamniformes", FAO Fisheries Synopsis, No. 125, ISBN 92-5-101384-5.
  3. ^ "Common names of Carcharias taurus". FishBase. 2011. Retrieved December 4, 2011. 
  4. ^ a b c d e "Sand tiger shark". NOAA National Marine Fisheries Service. 2011. Retrieved November 28, 2011. 
  5. ^ Williams, Samantha (8 August 2007). "Rare albino shark rules deep". thetelegraph.com.au. Retrieved August 2008. 
  6. ^ a b c Dicken, M. L.; Booth, A. J.; Smale, M. J.; Cliff, G. (2007). "Spatial and seasonal distribution patterns of juvenile and adult raggedtooth sharks (Carcharias taurus) tagged off the east coast of South Africa". Marine and Freshwater Research 58: 127. doi:10.1071/MF06018.  edit
  7. ^ Bansemer, C. S.; Bennett, M. B. (2011). "Sex- and maturity-based differences in movement and migration patterns of grey nurse shark, Carcharias taurus, along the eastern coast of Australia". Marine and Freshwater Research 62 (6): 596. doi:10.1071/MF10152.  edit
  8. ^ Kneebone, J.; Chisholm, J.; Skomal, G. B. (2012). "Seasonal residency, habitat use, and site fidelity of juvenile sand tiger sharks Carcharias taurus in a Massachusetts estuary". Marine Ecology Progress Series 471: 165. doi:10.3354/meps09989.  edit
  9. ^ a b c d Smale, M. J. (2005). "The diet of the ragged-tooth shark Carcharias taurus Rafinesque 1810 in the Eastern Cape, South Africa". African Journal of Marine Science 27: 331–335. doi:10.2989/18142320509504091.  edit
  10. ^ a b c Lucifora, L. O.; García, V. B.; Escalante, A. H. (2009). "How can the feeding habits of the sand tiger shark influence the success of conservation programs?". Animal Conservation 12 (4): 291. doi:10.1111/j.1469-1795.2009.00247.x.  edit
  11. ^ Gelsleichter, J.; Musick, J. A.; Nichols, S. (1999). "Food habits of the smooth dogfish, Mustelus canis, dusky shark, Carcharhinus obscurus, Atlantic sharpnose shark, Rhizoprionodon terraenovae, and the sand tiger, Carcharias taurus, from the northwest Atlantic Ocean". Environmental Biology of Fishes 54 (2): 205. doi:10.1023/A:1007527111292.  edit
  12. ^ Gordon, I. (1993). "Pre-copulatory behaviour of captive sandtiger sharks,Carcharias taurus". Environmental Biology of Fishes 38: 159–164. doi:10.1007/BF00842912.  edit
  13. ^ a b Chapman, D. D.; Wintner, S. P.; Abercrombie, D. L.; Ashe, J.; Bernard, A. M.; Shivji, M. S.; Feldheim, K. A. (2013). "The behavioural and genetic mating system of the sand tiger shark, Carcharias taurus, an intrauterine cannibal". Biology Letters 9 (3): 20130003. doi:10.1098/rsbl.2013.0003. PMC 3645029. PMID 23637391.  edit
  14. ^ a b c Bansemer, C. S.; Bennett, M. B. (2009). "Reproductive periodicity, localised movements and behavioural segregation of pregnant Carcharias taurus at Wolf Rock, southeast Queensland, Australia". Marine Ecology Progress Series 374: 215. doi:10.3354/meps07741.  edit
  15. ^ Gilmore, R.G.; Dodrill, J.W. and Linley, P. (1983). "Reproduction and embryonic development of the sand tiger shark, Odontaspis taurus (Rafinesque)". Fishery Bulletin 81 (2): 201–225. 
  16. ^ a b Branstetter, Steven; Musick, John A. (1994). "Age and Growth Estimates for the Sand Tiger in the Northwestern Atlantic Ocean". Transactions of the American Fisheries Society 123 (2): 242. doi:10.1577/1548-8659(1994)123<0242:AAGEFT>2.3.CO;2. 
  17. ^ a b "Sand Tiger Shark". National Geographic Society. 2009. Retrieved October 26, 2011. 
  18. ^ Shark Attack Survivors. sharkattacksurvivors.com
  19. ^ Dudley, S. F. J. (1997). "A comparison of the shark control programs of New South Wales and Queensland (Australia) and KwaZulu-Natal (South Africa)". Ocean & Coastal Management 34: 1–9. doi:10.1016/S0964-5691(96)00061-0.  edit
  20. ^ Dudley, S. F. J.; Simpfendorfer, C. A. (2006). "Population status of 14 shark species caught in the protective gillnets off KwaZulu–Natal beaches, South Africa, 1978–2003". Marine and Freshwater Research 57 (2): 225. doi:10.1071/MF05156.  edit
  21. ^ Brazier, W.; Nel, R.; Cliff, G.; Dudley, S. (2012). "Impact of protective shark nets on sea turtles in KwaZulu-Natal, South Africa, 1981–2008". African Journal of Marine Science 34 (2): 249. doi:10.2989/1814232X.2012.709967.  edit
  22. ^ Barker, S. M.; Peddemors, V. M.; Williamson, J. E. (2011). "A video and photographic study of aggregation, swimming and respiratory behaviour changes in the Grey Nurse Shark (Carcharias taurus) in response to the presence of SCUBA divers". Marine and Freshwater Behaviour and Physiology 44 (2): 75. doi:10.1080/10236244.2011.569991.  edit
  23. ^ Smith, K.; Scarr, M.; Scarpaci, C. (2010). "Grey Nurse Shark (Carcharias taurus) Diving Tourism: Tourist Compliance and Shark Behaviour at Fish Rock, Australia". Environmental Management 46 (5): 699–710. doi:10.1007/s00267-010-9561-8. PMID 20872140.  edit
  24. ^ http://animals.nationalgeographic.com/animals/fish/sand-tiger-shark/
  25. ^ http://alleghenycampus.com/2012/10/26/mystery-captivity/
  26. ^ http://www.comparativepsychology.org/ijcp-vol26-1/06.Tate_etal_FINAL.pdf

Bibliography[edit]

  • Parker, Steve; Parker, Jane (2002). "Design for Living". The Encyclopedia of Sharks. Firefly Books. p. 100. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Although some recent authors recognize Odontaspis, the senior synonym, and Carcharias as congeneric, Nelson (2004) follows Compagno (1999) in considering Carcharias to be a valid genus.

Also known as gray nurse shark and spotted raggedtooth shark (Compagno 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!