Overview

Brief Summary

Biology

The sand tiger shark is one of the best-studied of the shark species. They are the only sharks known to gulp air at the surface and store it in their stomach to provide buoyancy (2). These sharks generally mate between October and November and courtship can take a long time, with the male aggressively nipping his potential mate (3). Females are ovoviviparous, giving birth to two large pups every two years. Pups hatch out of their eggs within the oviduct of the mother's reproductive system, one in each oviduct, and then feed on eggs that the female continues to produce (6). Over nine months to a year, the pups grow within their mother feeding on hundreds to thousands of eggs (6) and, by the time they are born, measure up to a metre long (3). During the day they are found near caves and ledges (5), hovering just above the surface either singly or in small groups (3). These fairly docile sharks are sluggish and, despite a ferocious reputation, feed mainly on fish (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This stocky shark has a conical nose and a slightly flattened head (3). It is a dark brown or beige colour above, with blotches of darker colour, and paler underneath (4). The teeth of this species are especially distinctive, having a fang-like appearance and being visible even when the mouth is shut (5). There are two dorsal fins, which are a similar size to the anal fin; the upper lobe of the tail is larger than the lower one (3). Sharks have a sixth sense that enables them to detect electric currents, and the receptive pores are located on the under surface of the sand tiger's snout (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

A common littoral shark found inshore from the surf zone and in shallow bays to at least 191 m on the outer continental shelves (Ref. 13568). Often on or near the bottom but also occurs in midwater or at the surface (Ref. 247). Only shark known to gulp and store air in its stomach to maintain neutral buoyancy while swimming (Ref. 13568). Found singly or in small to large schools (Ref. 247). Feeds on bony fishes, small sharks, rays, squids, crabs, and lobsters (Ref. 5578). Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother as well as other siblings in the womb (uterine cannibalism) (Ref. 50449). Usually gives birth to 2 pups after a 9-12 months gestation period (Ref.58048). A migratory species in parts of its range, particularly in its northern and southern extremities where pronounced poleward migration occur in the summer and equatorial movements in autumn and winter (Ref. 247). Usually inoffensive and not aggressive when not provoked (Ref. 247) but has known to bite swimmers and be aggressive towards divers with speared fish (Ref. 6586). Utilized for fresh, frozen, smoked and dried for human consumption (Ref. 247); also for fishmeal, liver oil, fins, and hides for leather (Ref. 13568). Flesh highly appreciated in Japan (Ref. 36731).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea and Red Sea), but except eastern and central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Mediterranean Sea and Red Sea), but except eastern and central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Angola, Argentina, Atlantic, Australia, Bahamas, Bermuda, Brazil, Cameroon, Canada, Canary Islands, Cape Verde, Central Pacific Ocean, Djibouti, East Atlantic, Eastern Pacific, Eritrea, European waters (ERMS scope), FAO fishing area 47, FAO fishing area 51, FAO fishing area 57, FAO fishing area 61, FAO fishing area 71, FAO fishing area 81, Ghana, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Indo-West Pacific, Kenya, Madagascar, Mauritania, Mediterranean Sea, Morocco, Mozambique, Namibia, Nigeria, North West Atlantic, Red Sea, São Tomé and Principe, Senegal, Sicily, Somalia, South Africa, South Africa (country), Tanzania, Uruguay, USA, West Atlantic, West Pacific, Western Saharan Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumtropical: Except perhaps the eastern Pacific (Ref. 13568). Indo-West Pacific: Red Sea and off South Africa to Japan, Korea and Australia (Ref. 13568). Present in Arafura Sea (Ref. 9819). Western Atlantic: Gulf of Maine to Argentina. Old record from Bermuda, south Brazil (Ref. 26938). Eastern Atlantic: Mediterranean to Cameroon. Northwest Atlantic: Canada (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Carcharias taurus has a broad but disjunct distribution in littoral and sub-littoral waters, primarily in subtropical to warm temperate regions around the main continental landmasses, except in the eastern and central Pacific (Compagno 1984, 2001; Gilmore et al. 1983). It is not known from deepwater, unlike Odontaspis ferox.

Southwest Atlantic subpopulation: in the Southwest Atlantic C. taurus ranges from Rio de Janeiro, Brazil (21°S) to San Matías Gulf, Argentina (41°30’S) (Menni 1986, Soto 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Because Carcharias taurus is extremely rare in the Northern Territory and South Australia, there is likely to be almost no genetic exchange between sharks on the east and west coasts and, for the purposes of this assessment, the Australian subpopulation is considered to consist of two subpopulations: the New South Wales (east coast) subpopulation, and the Western Australia (west coast) subpopulation. Information for the New South Wales subpopulation follows:

The grey nurse shark is a migratory species that is known to move north and south between particular sites along the east coast of Australia. When not migrating, these sharks aggregate in or near deep sandy-bottomed gutters or in rocky caves around inshore rocky reefs and islands at depths between 15 and 40 metres (Otway and Parker 2000). Depending on the time of year, both mature and juvenile grey nurse sharks may be found at aggregation sites in southern Queensland and New South Wales. The results of diver surveys concluded that grey nurse sharks were no longer found at many of the sites that they were known to previously use.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Because Carcharias taurus is extremely rare in the Northern Territory and South Australia, there is likely to be almost no genetic exchange between sharks on the east and west coasts and, for the purposes of this assessment, the Australian subpopulation is considered to consist of two subpopulations: the New South Wales (east coast) subpopulation, and the Western Australia (west coast) subpopulation. Information for the Western Australia subpopulation follows:

Despite a relatively large and active recreational diving industry in Western Australia (WA), no aggregation sites have been confirmed on the west coast, however, one site has been reported to exist off Perth. WA Department of Fisheries research data suggest that grey nurse sharks are more dispersed throughout temperate continental shelf waters than they are in eastern Australian waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Historically, the Grey Nurse Shark is regarded as having a broad inshore distribution, primarily in subtropical to warm temperate waters around the main continental landmasses, except in the eastern Pacific off North and South America (Compagno 1984a). In the Western Atlantic, this shark occurs from the Gulf of Maine to Florida (USA), in the northern Gulf of Mexico, around the Bahamas and at Bermuda, and also from southern Brazil to northern Argentina. In the eastern Atlantic it is found from the Mediterranean to the Canary Islands, at the Cape Verde Islands, along the coasts of Senegal and Ghana, and from southern Nigeria to Cameroon. In the western Indian Ocean it ranges from South Africa to southern Mozambique, but does not occur around Madagascar. This species has also been reported from the Red Sea and may occur as far east as India (where it appears to have been referred to as C. tricuspidatus; see Compagno 1984a). In the western Pacific, it has been reported from Japan and Australia, but not New Zealand (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Grey nurse sharks, also called sand tiger sharks, can be found in the Atlantic, Indian, and Pacific Oceans in temperate and tropical waters. They are found in warm seas, except for the eastern Pacific. They occur from the Gulf of Maine to Argentina in the western Atlantic, the coast of Europe to north Africa in the eastern Atlantic, in the Mediterranean sea, from Australia to Japan in the west Pacific, and off the coasts of South Africa.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Budker, P. 1971. The Life of Sharks. New York: Columbia University Press.
  • Gilbert, P., R. Matheson, D. Rall. 1967. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press in cooperation with the American Institute of Biological Sciences.
  • Carrier, J., J. Musick, M. Helithaus. 2004. Biology of Sharks and Their Relatives. Boca Raton, London, New York, Washington, D.C.: CRC Press.
  • Cooper, P. 2006. "Sandtiger shark" (On-line). Ichthyology at the Florida Museum of Natural History: Biological Profiles. Accessed April 18, 2006 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/Sandtiger/Sandtiger.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine to Argentina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Nearly cosmopolitan in subtropical and temperate waters, generally at depths less than 60 m. Range includes the western North Atlantic (Nova Scotia to the northern Bahamas and Florida and Gulf of Mexico west to Texas; also Brazil to Argentina), the Atlantic coast of Europe to North Africa and the Mediterranean Sea, western Indian Ocean, and western Pacific Ocean; absent from the eastern Pacific Ocean (Castro 1983, Gilmore et al. 1983, Michael 1993, Hoese and Moore 1998). Perhaps the most common shark in coastal waters from Cape Cod, Massachusetts to Chesapeake Bay; free-swimming juveniles in the western Atlantic are restricted to temperate and warm-temperate waters, extending as far south as northern Florida Juveniles 109.3-157.7 cm total length have been recorded in neritic waters along the northern Florida coast and in the northern and northeastern Gulf of Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coastal waters on both sides of the Atlantic; Maine to Florida and Brazil; Mediterranean, tropical West Africa, Canaries, and Cape Verdes; South Africa.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

A widespread range encompasses all subtropical and tropical oceans (6), with the possible exception of the eastern Pacific (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The dorsal side of grey nurse sharks is grey, the underside is a dirty white color. These are stout-bodied sharks with metallic brown or reddish colored spots on the sides. When a grey nurse shark pup is born it is typically between 115 and 150 cm. As they mature, grey nurse sharks can reach 5.5 meters, but an average size is 3.6 meters. Females are generally larger than males. Average weight is from 95 to 110 kg. A distinguishing characteristic of grey nurse sharks is that the anal fin and both dorsal fins are the same size. The tail is heterocercal, with a long, upper lobe and a shorter, lower lobe. These different lobes allow for great movement. The mouth bears razor like teeth and is long and slender, with pointed snout. Their elongated teeth are visible even when the mouth is closed, giving these sharks a menacing appearance. This has led many to believe that these are dangerous sharks, a reputation they don't deserve.

Range mass: 50 to 300 kg.

Average mass: 95-110 kg.

Range length: 6 (high) m.

Average length: 3.6 m.

Range basal metabolic rate: <190 to 311 cm^3 oxygen/hour.

Average basal metabolic rate: 239 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

  • Hamlett, W. 1999. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press.
  • Office of Naval Research. Sensory Biology of Sharks, Skates, and Rays. N00014-76-C-0943. Arlington, Va: U.S. Government. 1979.
  • 2005. "Abyss Scuba Diving" (On-line). Accessed October 05, 2005 at http://teachit.acreekps.vic.edu.au/animals/greynurseshark.htm.
  • Bennett, M., C. Bansemer. 2004. "Investigation of grey nurse sharks in Queensland to fulfill action under the recovery plan for grey nurse sharks in Australia regarding impact of divers, and establishment of a photographic database" (On-line pdf). Investigation of grey nurse sharks in Queensland to fulfill action under the recovery plan for grey nurse sharks in Australia regarding impact of divers, and establishment of a photographic database. Accessed November 14, 2005 at http://gov.au/coasts/publications/pubs/grey-nurse-shark-project.pdf.
  • Department of the Environment and Heritage, Australia, 1999. "Nurse Sharks" (On-line). Department of the Environment and Heritage, Australia. Accessed October 06, 2006 at http://www.deh.gov.au/coasts/species/sharks/greynurse/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

320 cm TL (male/unsexed; (Ref. 5213)); max. published weight: 158.8 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 320 cm TL; max weight: 154 kg
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A shark with a short, pointed snout, small eyes, protruding spike-like teeth and small, equal-sized dorsal and anal fins; 1st dorsal fin closer to pelvic than to pectoral fins (Ref. 5578). Caudal fin with a pronounced subterminal notch and a short ventral lobe (Ref. 13575). Pale brown or grey, paler below, with dark spots that appear faded in adults; fins plain (Ref. 6586).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Lives mostly on or near the bottom, from the surf zone, in shallow bays, and around coral and rocky reefs down to at least 191 m depth on the outer shelves (Ref. 247). Migratory species which feeds on small fish, sharks, rays, squids, and on crabs and lobsters occasionally (Ref. 5213). Maybe solitary or forms small to large schools. Reproduction features ovophagy or uterine cannibalism. Only one of 16-23 egg cases survives. Inoffensive and unaggresive when not provoked (Ref. 247).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records of the great white shark Carcharodon carcharias (Linnaeus) (Lamniformes: Lamnidae) in the Persian/Arabian Gulf (hereafter referred to as “The Gulf”) are limited to a single report from Kuwait, in the northwest Gulf, which has subsequently been noted in key references (e.g. Compagno, 2001). Khalaf (1987) recorded C. carcharias based on an observation of a mounted specimen in Kuwait Science and Natural History Museum on a visit there in March 1987. The specimen is reported as being a female C. carcharias of 3m in length, caught off Kuwait ’s coast and supplied to the museum on the 14th of April 1984. A black and white photograph of the anterior portion (from just posterior of the pelvic fins) was included in Khalaf’s account (Fig. 1 here), but no measurements or morphological data were presented.

 

The present authors examined the photograph and identified the specimen as Carcharias taurus Rafinesque (Lamniformes: Odontaspididae) based on the first dorsal fin origin being well behind the inner margins of the pectoral fins (cf. over the pectoral inner margins in C. carcharias ), the first dorsal fin insertion being about over the pelvic fin origin (cf. being well ahead of pelvic fin origin), a short flattened snout (cf. moderately long conical snout), moderately long gill openings not extending onto the dorsal surface (cf. long gill openings), and characteristic protruding teeth. The photograph presented did not allow for examination of the caudal region or for effective examination of colouration.

 

Carcharodon carcharias has been recorded from a wide range of habitats and with an extensive distribution ranging from the equatorial tropics to the sub-Arctic, and from the intertidal down to the continental slope (Compagno, 2001). Cliff et al. (2000), Compagno (2001), and Zuffa et al. (2002) report white sharks from the tropical Western Indian Ocean off Mozambique and Madagascar north to Tanzania and Kenya and including the Seychelles, Réunion and Mauritius. There is therefore no theoretical reason why this species should not occur in the Persian Gulf or the wider northwestern Indian Ocean, although the nearest confirmed record is from Sri Lanka and possibly the Red Sea (Compagno, 2001). In addition, there are unconfirmed, anecdotal records of white sharks from the Gulf of Aden coast of Yemen, Djibouti and northern Somalia (Conan Doyle, 1963).

 

Gubanov & Schleib (1980) reported C. taurus as sometimes being encountered in Kuwait waters, although Krupp et al., (2000) noted that there was no material provided to support this. Krupp et al., (2000) reported the first record of C. taurus from The Gulf supported by reference material based on a 2.98m specimen caught off Abu Halifa, Kuwait , in 1997. The C. taurus reported here predates this by thirteen years.

License not applicable

Alec B. M. Moore

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 191m.
Recorded at 191 meters.

Habitat: demersal. Ranges from the surf zone, in shallow bays, and around coral and rocky reefs down to at least 191 m depth on the outer shelves (Ref. 247). Often on or near the bottom but also occurs in midwater or at the surface (Ref. 247). A migratory species in parts of its range, particularly in its northern and southern extremities where pronounced poleward migration occur in the summer and equatorial movements in autumn and winter (Ref. 247). Feeds on small fish, sharks, rays, squids, and on crabs and lobsters occasionally (Ref. 5213). Solitary or forms small to large schools. Reproduction features ovophagy or uterine cannibalism. 2 pups per litter, born at 100 cm (Ref. 6586). Matures at about 220 cm (Ref. 6871). Usually inoffensive and unaggresive when not provoked (Ref. 247) but has known to bite swimmers (Ref. 6586).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 1 - 191 m (Ref. 247), usually 15 - 25 m (Ref. 43278)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Carcharias taurus generally occurs in warm-temperate and subtropical waters, ranging from the surf zone and shallow bays to approximately 200 m depth on the outer continental shelf. The species is most usually found on or near the bottom in reef areas but may occasionally occur in midwater or at the surface (Compagno 1984). Embryonic oviphagy and intra-uterine cannibalism occurs in this species and only two large pups are produced per litter every second year (Gilmore et al. 1983, Goldman 2002, Goldman et al. in press). As a result, annual rates of population increase are very low, greatly reducing its ability to sustain fishing pressure. Size at birth is about 95 to 105 cm TL (Gilmore et al. 1983).

Maximum size attained is 300 to 320 cm TL (females) and 220 to 270 cm TL (males) (Compagno 2001). Age and size at maturity varies regionally. Age at maturity is reported at 7.7 years (females) and 4.5 years (males) in the Southwest Atlantic by Lucifora (2003). Lucifora (2003) reports size at maturity in the Southwest Atlantic as 218 to 235 cm TL (females) and 193 cm TL (males). Longevity is estimated at 18.3 years in females and 12.8 years in males in the Southwest Atlantic (Lucifora 2003).

Average reproductive age is 17.1 yrs from demographic analysis (Goldman 2002). Natural mortality is MHoenig = 0.205, MJensen = 0.211 and MPauly = 0.198 from analyses from the Southwest Atlantic (Lucifora 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Carcharias taurus generally occurs in warm-temperate and sub-tropical waters, ranging from the surf zone and shallow bays to approximately 200 m depth on the outer continental shelf. The species is most usually found on or near the bottom in reef areas but may occasionally occur in midwater or at the surface (Compagno 1984). In NSW and southern Queensland, C. taurus is most frequently sighted in or near sandy-bottomed gutters or in rocky caves, often around inshore rocky reefs and islands at depths of between 15 and 25 m (Pollard et al. 1996, Otway and Parker 1999).

Embryonic oviphagy and intra-uterine cannibalism occurs in this species and only two large pups are produced per litter every second year. As a result, annual rates of population increase are very low, greatly reducing its ability to sustain fishing pressure. Maximum size attained is 220 to 270 cm total length (TL) (males) and 300 to 320 cm TL (females). Age at maturity is 6 to 7 years (males) and 9 to 10 years (females). Female k = 0.11, Male k = 0.16 (Goldman 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Carcharias taurus generally occurs in warm-temperate and sub-tropical waters, ranging from the surf zone and shallow bays to approximately 200 m depth on the outer continental shelf. The species is most usually found on or near the bottom in reef areas but may occasionally occur in midwater or at the surface (Compagno 1984). In NSW and southern Queensland, C. taurus is most frequently sighted in or near sandy-bottomed gutters or in rocky caves, often around inshore rocky reefs and islands at depths of between 15 and 25 m (Pollard et al. 1996; Otway and Parker 1999).

Embryonic oviphagy and intra-uterine cannibalism occurs in this species and only two large pups are produced per litter every second year. As a result, annual rates of population increase are very low, greatly reducing its ability to sustain fishing pressure. Maximum size attained is 220 to 270 cm total length (TL) (males) and 300 to 320 cm TL (females). Age at maturity is 6 to 7 years (males) and 9 to 10 years (females). Female k = 0.11, Male k = 0.16 (Goldman 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The maximum size of this species has been given variously as ~3.2 m by Compagno (1984a), ~2.75 m and ~142 kg by Hutchins and Swainston (1986) and ~3.2 m and ~300 kg by Hutchins and Thompson (1983). Catch records from beach meshing in NSW, however, suggest that these sharks may grow to 4.3 m, though this maximum length is doubtful and may be due to a misidentification (Reid and Krough 1992).

Branstetter and Musick (1994) described the age and growth of C. taurus in the western North Atlantic based on banding patterns on vertebral centra and stated the maximum age to be 30?35 years. The largest (oldest) male examined (248 cm TL) from the south-eastern USA was 7.5 years old, and the largest (oldest) female examined (272 cm TL) was 10.5 years old. The hypothesis of double annual ring formation is currently being re-examined. If only one ring is deposited each year, the ages cited above would be approximately doubled (J. Musick pers. comm.). The oldest individuals recorded in aquaria were 13 years in Australia (Roughley 1955) and 16 years in South Africa (Govender et al. 1991).

The Grey Nurse Shark occurs either alone or in small to medium-sized aggregations of 20?80 individuals (Silvester 1977, Aitken 1991, Cliff unpubl.). These sharks are often observed hovering motionless just above the seabed in or near deep sandy-bottomed gutters or rocky caves, usually in the vicinity of inshore rocky reefs and islands. They are generally coastal, usually being found from the surf zone down to depths of around 25 m. However, they may also occasionally be found in shallow bays, around coral reefs and, very rarely, to depths of around 200 m on the continental shelf. They usually live near the bottom, but may also move throughout the water column (Compagno 1984a).

Males and females both mature at approximately 2 m in length off the south-eastern USA (Gilmore et al. 1983). They are ovoviviparous and usually only two pups are born per litter once every two years. This is because the remaining eggs and developing embryos are eaten by the largest and/or most advanced embryo in each horn of the uterus (a phenomenon known as adelphophagy or uterine cannibalism). The gestation period may last from 9?12 months and size at birth is relatively large, at about 1 m (Gilmore et al. 1983, Gilmore 1993).

Grey Nurse Shark populations off South Africa and the east coast of the USA are known to undertake complex size and sex segregated migrations. These have been documented by Bass et al. (1975c), Gilmore (1993) and Musick et al. (1993). In other parts of its range and particularly in south-eastern Australia, this species appears to undertake similar migrations.

The species feeds on a wide range of teleost fishes, as well as smaller sharks (Carcharhinidae and Triakidae), rays (Myliobatidae), squids, crabs and lobsters (Compagno 1984, Gelsleichter et al. 1999). Scott et al. (1974) reported that Grey Nurse Sharks in south-eastern Australia fed on shoals of Australian salmon (Arripidae) and other pelagic fish species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grey nurse sharks are found in temperate and tropical waters. They are typically found in shallow waters, such as shallow bays, surf zones, and near coral or rocky reefs. They have been sighted in waters as deep as 191 meters, but will most likely be seen in the surf zone to a depth of 60 meters. They are usually found near the bottom of the water column.

Range depth: 2 to 191 m.

Average depth: 60 meters m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Other Habitat Features: estuarine

  • Leneaweaver III, H., R. Backus. 1970. Natural History of Sharks. United States of America (philidelphia and New York): J.B. Lippincott Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

An inshore and offshore, littoral shark. This shark occurs in the surf zone off sandy and rocky beaches, in shallow bays, on offshore banks and reefs, in underwater caves, in troughs on sandy areas, and around coral and rocky reefs from the intertidal less than 1mdeep down to at least 191 m, with most at depths of 15 to 25 m. This species is often found near or on the bottom but also occurs in midwater or at the surface.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138597 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 0-191 m, often on or near the bottom.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 64 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 6 - 1220
  Temperature range (°C): 4.436 - 26.008
  Nitrate (umol/L): 0.202 - 28.267
  Salinity (PPS): 33.239 - 36.529
  Oxygen (ml/l): 2.896 - 6.300
  Phosphate (umol/l): 0.106 - 1.657
  Silicate (umol/l): 0.942 - 25.103

Graphical representation

Depth range (m): 6 - 1220

Temperature range (°C): 4.436 - 26.008

Nitrate (umol/L): 0.202 - 28.267

Salinity (PPS): 33.239 - 36.529

Oxygen (ml/l): 2.896 - 6.300

Phosphate (umol/l): 0.106 - 1.657

Silicate (umol/l): 0.942 - 25.103
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Ranges from turbid coastal waters along shore to deeper waters of upper continental and insular slopes; usually found close to the bottom near shore, often in very shallow water (< 4 m) (Castro 1983). Common in neritic waters off northeastern Florida at 5-12 m depth. Nursery grounds are littoral, temperate waters, but do not include embayments or low salinity areas; young are exposed to predation by adult sharks of these areas (Gilmore et al. 1983). Common in temperate and tropical seas on or near coral and rocky reefs (Michael 1993). Often found amid large schools of smaller baitfish (which it occasionally eats).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; marine; depth range 0-191 m. Commonly found inshore to the outer continental shelf. Generally on or near the bottom, also occurs in midwater or at the surface. Maintains neutral buoyancy while swimming by gulping air and storing it in its stomach. Found singly or in schools.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits shallow coastal waters from the surf zone to a depth of 60 metres (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between nearshore waters (summer) deeper waters (winter) (Castro 1983). Female groups make coordinated seasonal coastal movements possibly for breeding, gestation, and eventually parturition (Gilmore et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Grey nurse sharks have a range of prey, including bony fish, rays, lobsters, crabs, squid, and other small sharks. Grey nurse sharks sometimes hunt cooperatively, chasing fish into small groups and then attacking them. Grey nurse sharks, like other sharks, have been known to attack at random during feeding frenzies, where a large number of prey is found together. In feeding frenzies sharks rely heavily on their electroreceptors, attacking everything in close vicinity.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Considered a voracious eater, feeding on many species (alewives, bluefish, flatfishes, mackerel, menhaden, invertebrates); its teeth are adapted for grasping smaller prey. Known to gather in groups of 3-4 to herd and prey on a school of fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on bony fishes, small sharks, rays, squid, crabs , and lobster.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Grey nurse sharks help to regulate prey populations. Different species of lampreys (Petromyzontidae) prey on these sharks in a parasitic relationship, whereby the lamprey attaches to the shark, and extracts blood and other nutrients through a wound. These sharks also have mutualistic relationships with pilotfish (Naucrates ductor), which clean their gills and, in exchange, get to eat the scraps of food left behind in the gills.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The only know predators of adult grey nurse sharks are humans. Human hunting has caused population declines, both as a result of shark fishing and persecution because their fierce appearance has caused them to be mistaken for other, more dangerous, species of sharks. They are also accidentally caught in commercial fishing nets. Young sharks are eaten by other sharks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Exact number of occurrences is unknown; likely to be many based upon wide distribution in the Atlantic Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Global abundance is unknown. Often common in warm temperate regions; common from Cape Cod to Delaware Bay during the warmer months. Although first reported from Texas in the 1960s, this species does not appear to be uncommon in the northwestern Gulf of Mexico (Hoese and Moore 1998). It is more common along the eastern coast of Florida than the eastern Gulf of Mexico (Gilmore et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

The causes of mortality are poorly known because they have low commercial value and are often difficult to obtain for study (Hoenig and Walsh 1983). Vertical lesions, specifically regions of swelling along the vertebral column, have been recorded from captured specimens (Hoenig and Walsh 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication among grey nurse sharks is not well understood. Sharks in general are sensitive to electrical and chemical cues.

Grey nurse sharks, and other species of sharks, have pores on their ventral surface. These pores are instrumental in detecting electrical fields, which help them to detect and locate prey and may help in navigating using the earth's magnetic field.

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed, then cannibalize siblings (adelphophagy) (Ref. 50449). Distinct pairing with embrace (Ref. 205). Eggs leave the ovaries, and while in transit in the oviducts are fertilized and enclosed in groups of 16 to 23 in egg cases. However, at some time between fertilization and birth only two (Ref. 5578, 6586) embryos of its group prevails, possibly by devouring its rivals, and proceeds to eat fertilized eggs and smaller potential siblings in utero until birth. According to Springer (1948) (Ref. 39565), it is evident that this species sends forth into the world not only large, well-developed, and even experienced young but may send them forth with a full stomach. The yolk sac is resorbed at a small size, less than 17 cm, and the umbilical scar may be lost. Gestation period may be from 8 to 9 months long. Size at birth 100 cm (Ref. 6586).Pratt (2001) (Ref. 49562) relates Gordon's (1993) (Ref. 51113) detailed account of the mating behavior of the sand tiger sharks as follows: "mating activities began when the two male C. taurus, having become reluctant to feed, increased their swimming speed, accompanied by clasper flexion and eventual interest in their female tank mates...aggressive displays such as snapping and stalking became frequent, mostly toward species of smaller Carcharhinus in the tank. The males did not become interested in the female until she slowed, moved to the sand area and started cupping her pelvic fins. The two males then became competitive toward each other, circling and tailing, until the alpha male forced the beta male out of the sand area. The female bit the male prior to copulation. She exhibited shielding behavior for several days and then resumed cupping and flaring. The female gradually changed her swimming position and began displaying the submissive behavior. The alpha male swam in increasingly larger circles and began splaying its claspers, then approached the female and exhibited tailing and nosing. Copulation occurred as the male bit into the right flank and trailing edge of the pectoral fin of the female. The male swam side by side with the female, copulating with the right clasper for one to two minutes. After copulation, the male showed little interest in the female." In captivity, males show aggression toward other species after copulation (Ref. 51113, 49562). Females avoid patrolling males by 'shielding' with pelvics close to the substrate (Ref. 51113, 49562). However, female acceptance of future male partner is indicated by a show of 'submissive' body, 'cupping' and 'flaring' of pelvic fins (Ref. 51113, 49562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

It takes a grey nurse shark pup between 6-9 months to develop in the uterus of a female. Young nurse sharks develop a jaw and teeth very early their development and some eat their siblings while still developing within their mother, a phenomenon known as intra-uterine cannibalism. It is uncertain how long it takes grey nurse sharks to reach maturity, but maturity is estimated at between 5 and 13 years. Sharks continue to grow throughout their lives.

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of ocean dwelling grey nurse sharks, however those held in captivity live to an average age of thirteen to sixteen years. It is believed that those in the wild live longer still.

Range lifespan

Status: wild:
35 (high) years.

Range lifespan

Status: captivity:
16 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males outnumber females by a 2:1 ratio and multiple males will copulate with a single female. A dominance hierarchy has only been observed in captivity, with the oldest males copulating first.

Mating System: polygynandrous (promiscuous)

Mating occurs in November and October. The gestation period will take anywhere from six to nine months. Females give birth in early spring near coastal, rocky reefs. Caves inhabited by these sharks are also used as breeding grounds and, if disrupted, their breeding may be interrupted. Female sharks bear young once every two years, with a maximum of two shark pups at birth, one from each uterus. Grey nurse sharks are ovoviviparous which means that eggs develop inside of the female in each uterus. Young hatch from the eggs and are retained in the uteri until they are fully developed. Females have hundreds of eggs inside the uterus. When an egg is fertilized the shark pup begins to grow and, at 55 mm, develops a jaw and teeth. This shark then eats the other developing embryos during its 6 to 9 month gestation (intra-uterine cannibalism).

Males mature at a length of 1.95 meters, or 4-5 years in age, and females mature at 2.2 meters, or 6 years in age.

Breeding interval: Grey nurse sharks bear young once every two years.

Breeding season: Shark pups are usually born in early spring (March and April).

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 6 to 9 months.

Range age at sexual or reproductive maturity (female): 5 to 13 years.

Average age at sexual or reproductive maturity (female): 7-8 years.

Range age at sexual or reproductive maturity (male): 5 to 13 years.

Average age at sexual or reproductive maturity (male): 7-8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

A pup will be born approximately 115-150 cm in length. This shark is able to fend for itself and live without parental care. Intra-uterine cannibalism ensures plenty of energy to the developing pup, resulting in a well-fed and well-developed offspring.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Hamlett, W. 1999. Sharks, Skates, and Rays. Baltimore, Maryland: John Hopkins Press.
  • Carrier, J., J. Musick, M. Helithaus. 2004. Biology of Sharks and Their Relatives. Boca Raton, London, New York, Washington, D.C.: CRC Press.
  • Office of Naval Research. Sensory Biology of Sharks, Skates, and Rays. N00014-76-C-0943. Arlington, Va: U.S. Government. 1979.
  • Cooper, P. 2006. "Sandtiger shark" (On-line). Ichthyology at the Florida Museum of Natural History: Biological Profiles. Accessed April 18, 2006 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/Sandtiger/Sandtiger.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Winter-spring is the breeding period off the Florida east coast (Gilmore et al. 1983). Individuals may aggregate in specific areas for mating (Michael 1993). Development is ovoviviparous. The gestation time is very long (10.5 months) (Pratt and Casey 1987). Individuals are about 65-110 cm total length at birth (Gilmore et al. 1983; Michael 1993). Age and growth data are lacking except for captive specimens (Branstetter 1990). The birthing season in Florida waters occurs during November through February. Adult females produce only two extremely large (> 100 cm) young per mating season (embryos are oviphagous and cannibalistic) (Castro 1983, Gilmore et al. 1983). Females reach maturity at 237 cm total length (Pratt and Casey 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ovoviviparous. One embryo develops in each oviduct.
  • Bigelow, H. B., and Schroeder.W.C.,1953; Last, P.R. and Stewens, J.D., 1994; Compagno, L.J.V. and Niem, V. H., 1998; Compagno, L.J.V., Ebert, D. A. and Smale, M. J., 1989; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharias taurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 73 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGGGCAGGAATAGTAGGAACAGCCCTAAGCCTTCTAATTCGAGCTGAACTAGGACAACCCGGATCACTCCTAGGAGATGATCAGATCTATAATGTTATTGTAACCGCCCATGCATTTGTAATAATTTTCTTCATGGTTATACCTGTAATAATTGGTGGATTCGGAAACTGACTAGTGCCCTTAATAATTGGTGCACCAGACATAGCCTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTTCCCCCCTCTTTTCTTTTACTCCTAGCTTCAGCTGGAGTCGAAGCTGGAGCCGGCACCGGTTGAACGGTGTATCCTCCTTTAGCCGGTAACTTAGCCCATGCCGGAGCATCCGTTGACTTAGCTATCTTTTCTCTTCATTTAGCAGGCATTTCATCAATCTTAGCCTCAATCAACTTCATTACAACCATTATTAACATAAAACCCCCAGCTATCTCTCAGTACCAAACACCATTATTTGTATGATCAATTTTAGTAACAACTATCCTCCTCCTTCTATCCCTTCCAGTACTTGCAGCTGGTATCACTATACTTCTTACGGACCGAAACTTAAACACAACATTCTTTGACCCGGCTGGGGGAGGAGACCCAATCCTCTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharias taurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 78
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2abcd

Version
3.1

Year Assessed
2007

Assessor/s
Chiaramonte, G., Domingo, A. & Soto, J.

Reviewer/s
Musick, J., Dudley, S., Soldo, A., Francis, M., Valenti, S.V. & Kyne, P.M. (Shark Red List Authority)

Contributor/s

Justification
A large migratory coastal shark with one of the lowest reproductive rates known among chondrichthyans, giving birth to only one or two large young every two years. As a result, annual rates of population increase and ability to sustain fishing pressure are extremely low. Although the species is widespread in subtropical and temperate waters of the Atlantic, Indian and western Pacific Oceans, as well as the Mediterranean Sea, regional populations are isolated and are not thought to mix. In the Southwest Atlantic, the species ranges from Rio de Janeiro, Brazil (21°S) to San Matías Gulf, Argentina (41°30’S). Although it is not directly fished in this region, it does have commercial value as a bycatch in benthic trawling and gillnet fisheries and is harvested throughout this range by commercial, artisanal and recreational (mainly in Argentina) fishing. In Uruguay, this species has been taken for over 50 years by the artisanal fleet and it formed an important component of gillnet catches off southern Brazil in the 1980s. Catches have declined dramatically off Uruguay from 784 kg per fishing day in 1985 to 32 kg per fishing day in 2001 and off southern Brazil from a CPUE of 11.7 to 0.3 sharks per 1,000 meters of net during the 1980s and 1990s, respectively. Recent surveys (2005) also appear to indicate that catches in the gillnet fisheries off southern Brazil have declined considerably relative to levels in the 1980s. Aggregations off Brazil were also targeted by spear-fishers for sport in the 1970s and 1980s. This species is assessed as Critically Endangered due to a combination of a severe depletion along the Brazilian coast since the 1970s and declining trends in the Uruguayan coastal fisheries. Coastal fishing pressure is intense and continuing within its range along the South Atlantic coast of South America. The species is listed as threatened with over-exploitation on Annex II of the Brazilian federal law of Threatened and Overexploited Aquatic Species. However there are no known species-specific management measures in place for it within the region and protection measures are urgently required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2abcd+3cd+4abcd

Version
3.1

Year Assessed
2003

Assessor/s
Pollard, D., Gordon, I., Williams, S., Flaherty, A. & McAuley, R.

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Workshop, March 2003, participants (Shark Red List Authority)

Justification
Numbers of Carcharias taurus in inshore waters of New South Wales (NSW) and southern Queensland (QLD) declined dramatically throughout the 1960s and 1970s due to the combined effects of targeted spearfishing, incidental capture by commercial and recreational fishing and beach protective shark meshing. Numbers in NSW are very low, probably numbering less than 500 and possibly as low as 300. The Critically Endangered assessment is assigned due to observed declines in the numbers of sharks at aggregation sites, a reduction in the number of known aggregation sites and dramatic declines in catch rates in beach protective meshing programs. Although protected in NSW since 1984, they are still subject to incidental capture and there appears to be little or no recruitment at sites where populations have become locally extinct.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Pollard, D., Gordon, I., Williams, S., Flaherty, A. & McAuley, R.

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Workshop, March 2003, participants (Shark Red List Authority)

Justification
Grey nurse sharks have never been targeted in Western Australia (WA). The only significant source of mortality has been from incidental capture by a demersal gillnet fishery. Based on data from this fishery, the west coast population of C. taurus is assessed as Near Threatened because mean annual catches of 77 sharks, in conjunction with a stable CPUE, indicate that the subpopulation is larger and more stable than the eastern subpopulation, and aggregation sites are not known within the range of this fishery. However, these data are only available for 1989–1997, when the species was protected under the Endangered Species Protection Act and commercial catch reporting ceased. Due to the loss of this established index of abundance, the limited reproductive capacity of C. taurus and the precarious status of the eastern subpopulation, it is recognized that the western subpopulation still has the potential to become Vulnerable in the future. Even low levels of bycatch may lead to population declines in a species with such a low intrinsic rate of increase. There is a need to develop the means to monitor the abundance of these sharks in WA and conduct further research into their ecology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ab+3d

Version
3.1

Year Assessed
2009

Assessor/s
Pollard, D. & Smith, A.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the the information published in the 2005 shark status survey (Fowler et al. 2005).

The Grey Nurse Shark (Carcharias taurus) is a large, coastal shark with a disjunct distribution, occurring in most subtropical and warm temperate oceans, except for the Eastern Pacific. It has a strongly K-selected life history and produces only two large pups per litter. As a result, annual rates of population increase are very low, greatly reducing its ability to sustain fishing pressure. Populations in several locations have been severely depleted by commercial fishing, spearfishing and protective beach meshing, requiring the introduction of specific management measures.

History
  • 2000
    Vulnerable
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grey nurse sharks were the first shark species to be protected by law. Grey nurse sharks are cited as being critically endangered in the Commonwealth Legislation (Australia). They are also considered endangered in New South Wales. The Queensland Government is hoping to provide a listing in the Nature Conservation Act of 1992 which will give these sharks additional protection. The National Marine Fisheries service in the United States prohibits hunting of these sharks. The IUCN lists grey nurse sharks as a vulnerable species on the red list (last evaluated in 2000). CITES does not have a listing for them, and is the most recently updated (2005). The fact that these sharks live in shallow, accessible waters, have a fierce appearance, and have a low reproductive rate, has contributed to declines in populations. Population declines worldwide are estimated at 20% in the last 10 years.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Wide, nearly cosmopolitan distribution in subtropical and warm temperate oceans; number of extant occurrences and global abundance are not well documented; no known protected occurrences and no specific fisheries protection afforded; considered extremely susceptible to overfishing due to based on life history characteristics, particularly very low reproductive output.

Other Considerations: Slow growth (Pratt and Casey 1987, Branstetter 1990), delayed reproduction, and very low reproductive output (Compagno 1990) make this species vulnerable to overexploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Morphometric and meristic analysis indicate that the Southwest Atlantic subpopulation is a probable “closed group” with common characteristics, but not a distinct species (Sadowsky 1970, Compagno 2001). Although there is no information on the population size of C. taurus in the Southwest Atlantic, past and present fishing pressures have led to significant declines in catches (see Threats section below).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The east coast subpopulation has been estimated to possibly consist of as few as 500 individuals (Otway and Parker 2000) and there are concerns that this subpopulation has fallen to such critically low numbers that individual animals may be failing to find mates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Whilst a population estimate is not available for the west coast subpopulation, mean annual catches of 77 sharks in the WA demersal gillnet fisheries, in conjunction with a stable CPUE trend indicate that the population is larger and more stable than the eastern subpopulation.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Insufficient information exists to determine population trends; assumed to be stable but may be declining because of fishing pressure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2ab+3d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Because this species typically inhabits shallow inshore areas it is rarely, if ever caught by large-scale industrial fisheries operating on the high seas. However, its nearshore distribution makes it susceptible to small-scale multi-species and artisanal fisheries as well as recreational fisherman, spearfishers and shark control programs. As a bycatch in other fisheries it is often reported as unidentified shark or not reported at all and as such the extent of the impact that these fisheries have had on C. taurus is unknown for most of its geographic range. Consequently this species could be at a high risk of unrecognized depletion in many countries.

The sand tiger is not subjected to directed fishing in South America, but nevertheless does have commercial value (including the jaws) as a non target catch in benthic trawling and gillnet fisheries and is harvested throughout its regional range by commercial, artisanal and recreational (mainly in Argentina) fishing (Chiaramonte 1998, Nion 1999, Lucifora et al. 2002). Coastal species are the most important commercial elasmobranchs in the Southwest Atlantic and coastal fishing pressure is intense in this region (Bonfil et. al. 2005). The exposure of its coastal habitat to fisheries and its vulnerable life-history characteristics provide little capacity for recovery.

Captures of C. taurus from Central-North Rio Grande do Sul, southern Brazil have declined dramatically throughout the 1980s and 1990s from a CPUE of 11.7 to 0.3 sharks per 1000 meters of net (Soto 2001) (a decline of approximately 97%). In Rio Grande do Sul C. taurus were fished with gillnets during the 1980s, at which time the species was considered abundant and could be captured in aggregations (Vooren et al. 2005). However there are no records of the species from monitoring of the shore based fishery during the summer of 2003, and the species occurred in only 3 of 43 fishing trips (11 individuals captured in total) by the Passo de Torres gillnet fishery monitored during November-March 2005 (Vooren et al. 2005). Vooren et al. (2005) note that this species is now considered rare in this area and that the scarcity of recent records of neonates is of great concern. Adult C. taurus can still be found inshore along the coast between Tramandaí and Saint Simão (30 to 31°S) (Vooren et al. 2005). Although no information exists on the population size of C. taurus, fishing pressure is intense and continuing within its coastal habitat off southern Brazil. Large aggregations of C. taurus were also systematically wiped out in Santa Catarina state, Brazil, by spear fishermen in the 1970s and 1980s.

In Uruguay, this species has been taken for over 50 years by the artisanal fleet. Captures increased in the late 1970s, mainly in summer, reaching a peak in the mid 1980s. Thereafter there was a continued decline, with catches decreasing from 784 kg per fishing day in 1985 to 32 kg per fishing day in 2001 (A. Domingo pers. obs). Only occasional captures are recorded from 2000 to the present. There are also occasional captures in the trawl net and longline fisheries.

Lucifora (2003) estimated that 889 sharks (CI 95%=625 to 1,140) were captured by anglers during three consecutive summers (1999-2001) in Anegada Bay, Argentina. Out of 175 sharks observed, 153 suffered serious injuries of the internal organs caused by hooks. Crespo and Corcuera (1990) report extensive damage to shark catches in gillnets by marine mammals (sea lions bite out the belly of entangled sharks and eat the liver).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Currently the main threatening processes in Australian waters would appear to be commercial and recreational fishing (including shark control programs in NSW and QLD), in which this species is taken as a bycatch. It has also been suggested that excessive dive tourism activities (i.e., 'shark diving') may also have the potential to adversely impact upon populations of the grey nurse shark. Refer to the Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia (Environment Australia 2002) for a fuller description of threats facing grey nurse sharks in Australian waters.

Grey nurse sharks are no longer found in significant numbers at several sites on the East Coast of NSW where they used to be dominant during the 1950s and 1960s. These sites include Brush Island, Jervis Bay and Long Reef, where in the past (1950/60s) aggregations of 40 plus could be observed. However, a recent NSW Fisheries study found that they no longer aggregate at such locations. Numbers of grey nurse sharks in NSW were found to be unexpectedly low, probably numbering less than 500 and possibly as low as 300. There is concern that the east coast subpopulation is suffering from depensation having fallen to such critically low numbers that individual animals may now be failing to find mates.

During the early 1950s up to 36 grey nurse sharks per year were captured by shark control nets in NSW. However, by the 1980s this number had decreased to three or less per year, and over the last decade (up to 2000) only three grey nurse sharks were caught. The declining catch rate has continued despite increased meshing effort over this period as more beaches were included in the beach protection program. A similar trend was observed in data from the Queensland beach protection program, where grey nurse shark captures decreased from an average of nine sharks per year between 1962 and 1972, to slightly over two sharks per year (Reid and Krogh 1992).

Although grey nurse sharks have been protected in NSW since 1984, they are still subject to incidental capture by commercial and recreational fishers, and in the ongoing protective beach meshing programs. In particular, vessels targeting wobbegong sharks (Orectolobus spp.) in the NSW Trap and Line Fishery have a significant bycatch of this species (Fletcher and McVea 2000). In the 1998-2001 NSW diver survey, between 5% and 7% of observed grey nurse sharks had wobbegong setline and other line fishing hooks embedded in their jaws (Otway and Parker 2000). There also appears to be little or no recruitment at sites where populations have become locally extinct (D. Pollard and I. Gordon, pers. comms 2003).

Illegal finning, eco-tourism and trade for aquarium displays may pose additional threats to the recovery of grey nurse sharks in NSW and southern Queensland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Currently the main threatening processes in Australian waters would appear to be commercial and recreational fishing (including shark control programs in NSW and QLD), in which this species is taken as a bycatch. It has also been suggested that excessive dive tourism activities (i.e., 'shark diving') may also have the potential to adversely impact upon populations of the grey nurse shark. Refer to the Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia (Environment Australia, 2002) for a fuller description of threats facing grey nurse sharks in Australian waters.

Unlike NSW and Queensland, grey nurse sharks have never been subjected to targeted fishing in WA. The only significant source of C. taurus mortality on the west coast has been from incidental capture by the demersal gillnet fishery that operates between Steep Point and the South Australia border. Relatively high quality grey nurse shark catch and catch rate data are available from this fishery. These data have been independently verified by estimating the fishery’s total catch from the CPUE recorded by scientific observers (McAuley and Simpfendorfer, draft report). However, these data are only available for the period July 1989 to December 1997, when the species was protected under the Endangered Species Protection Act and commercial reporting ceased. These data cover the eight year period immediately after the historical peak in demersal gillnet fishing effort and the period during which direct management adjustment reduced effort to 42% of its maximum level.

Catches of between 70-105 sharks per year (McAuley, unpublished data) indicate that grey nurse sharks were relatively abundant on the lower west coast of WA between 1989 and 1997 and CPUE of grey nurse sharks in the demersal gillnet fishery increased between 1989-1993 and then remained level until 1997, indicating that the population was stable.

WA Department of Fisheries (WA DOF) research records do not suggest that aggregation sites occur within the functional area of the WA demersal gillnet fishery. If such sites do occur within the fishery’s geographic boundaries, they are likely to be in areas of heavy reef, where gillnet vessels do not operate due to the risk of net entanglement. Additionally, there are several records of grey nurse shark occurrence in two significant regions outside of the fishery’s operational range, between Steep Point (26º 30’ S) and NW Cape (22º S), which has been closed to shark fishing since 1993 and, in deeper coastal waters (>100 m), where demersal gillnet vessels cannot operate due to their generally small size and the amount of expected damage to gear and catch caused by currents and predation. Both areas are likely to contain large amounts of suitable unfished habitat and are thought to offer significant refugia to this species in WA. However, there is also some concern regarding anecdotal reports that grey nurse sharks were more abundant in the 1960s and 1970s and that there may have been inshore aggregation sites that are no longer in existence.

Due to the limited reproductive capacity of C. taurus, the precarious status of the eastern subpopulation and the loss of an established index of abundance (commercial catch records), it is recognised that the western subpopulation still has the potential to become Vulnerable in the future. Therefore, developing a means to monitor the abundance of grey nurse sharks in Western Australia and further research into their ecology are necessary. Archival tagging of grey nurse sharks to provide data on distribution and migratory behaviour in Western Australia is expected to be undertaken in the next 12 months.

This species may well be reassessed over the coming year, as well as undergoing routine reassessments in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Grey Nurse Sharks have been fished throughout their range in the past, but are of variable economic importance regionally (Compagno 1984a). The species is highly regarded as a food fish in Japan, but not in the western Atlantic. It is caught primarily with line fishing gear, but is also taken in bottom-set gillnets and trawls. The meat is utilised fresh, frozen, smoked, and dried and salted, for human consumption. This species has also been used for fishmeal, its liver for oil, and its fins for making soup via the oriental sharkfin trade (Compagno 1984a).

This species has been taken along the Atlantic coast of the United States in a commercial shark fishery directed towards a wide array of large coastal species, but supported primarily by catches of Carcharhinus plumbeus and C. limbatus. Musick et al. (1993) showed that several species of sharks, including the sand tiger, had declined by as much as 75% during the decade from 1980?1990 because of overfishing. Recently, this fishery has come under management and C. taurus has been accorded full protection (see below).

In the 1850s, this species was fished by hook-and-line in and around Botany Bay, New South Wales (NSW), Australia, during October and November, to provide a source of oil ?of excellent quality for burning in lamps? (Grant 1982). In the late 1920s this species was also fished, together with other shark species, at Port Stephens, NSW (Roughley 1955). It was the second most commonly captured shark after the whaler sharks (Carcharhinidae) in this area. According to Roughley (1955), Grey Nurse Sharks produced the best quality shark leather but their fins were not as desirable as those from some of the other sharks commonly caught in this fishery. Commercial fishing for C. taurus reputedly continued on and off in NSW using various methods up until the Second World War.

Pepperell (1992) summarised catch records of gamefishermen in south-eastern Australia and found that C. taurus constituted 11% (161 sharks) of the total recorded shark catch (1,461) during the 1960s and 7% (244 sharks) in the 1970s (total catch 3,466 sharks). The weights of C. taurus specimens caught by game fishermen ranged from less than 10 to around 190 kg (Pepperell 1992). Capture of this species was banned voluntarily by game fishermen throughout Australia in 1979 (Pepperell 1992).

Meshing of beaches was instituted in NSW in the late 1930s to protect bathers from shark attack (Reid and Krough 1992). Since then, shark meshing has also been adopted in Queensland, Australia (Paterson 1986) and in Natal, South Africa (Cliff and Dudley 1992). Carcharias taurus comprised 3.8% (n = 369) of the total NSW (i.e. Newcastle-Sydney-Wollongong area) beach meshing catch of sharks from 1950?1990 (Reid and Krough 1992). The number of C. taurus taken in these mesh nets in NSW over this 40-year period is thus slightly less than that taken by game fishermen during the 1960s and 1970s. Overall, there have been large declines over time in the meshing catch and catch per unit effort for the species. During the early 1950s, 24?36 C. taurus were meshed per year, but since the late 1970s only 0?3 were caught each year (Pollard et al. 1996). Prior to this 40-year period, Coppleson (1958) reported 58 Grey Nurse Sharks being caught in these beach meshing nets between October and December 1937.

Cliff and Dudley (1992) reported an average annual catch of 246 spotted ragged tooth sharks in the Natal (South Africa) beach meshing programme for the period 1978?1990, with 38% of the catch being found alive in the nets. Whenever possible these live sharks were released, many with tags. Between 1966?1972 there was a significant decline in the catch rate of this species, followed by a significant increase between 1972?1990 (Dudley and Cliff 1993a). Maximum and minimum catches were 20 (1966) and two (1981) sharks per km of net per year (Dudley and Cliff 1993a).

Interactions between skindivers and C. taurus in Australia are nowadays rare. There are reports of Grey Nurse Sharks stealing speared fish from skindivers, but this is not common. During the 1950s and 1960s, however, skin and SCUBA divers armed with barbless or barbed spears, hypodermic spears containing strychnine nitrate, and especially explosive powerheads, killed many C. taurus off the NSW coast (Cropp 1964). Divers also took them alive, often with lassos, to sell to aquariums (Cropp 1964). Carcharias taurus are still taken, under permit, for aquariums (Smith 1992), but with the assigning of their protected status (see later) and an increased awareness of the need for their conservation, there are now no reports of divers killing these sharks deliberately.

Because of its large size and fearsome appearance, and because it occurs in relatively shallow water where it often hovers almost motionless near the sea floor, C. taurus can be readily approached and is now a very popular attraction with SCUBA divers. Dive guides tend to highlight locations where these sharks regularly occur (e.g., Byron 1985), and divers can observe C. taurus at the same locations on many occasions, suggesting a high degree of site-attachment by these sharks. On the other hand, concern has been expressed (most recently in South Africa) that disturbance by divers may be detrimental to natural behaviour patterns and could even result in the exclusion of some sharks from critical habitat and/or important refuge areas (Andrew Cobb in litt.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Principal threat is fishing, although habitat degradation in coastal waters and nursery areas may affect juveniles. Generally fished wherever it exists; regularly caught in substantial amounts (Compagno 1990). Caught with hook-and-line, gill nets, and trawls for meat, fishmeal, liver oil, fins, and hide. Often caught by sport anglers and was formerly targeted by fishermen in Australia and South Africa. Much of catch is relatively minor bycatch for more fecund teleosts. Mostly caught as bycatch in Japanese tuna longline vessels (Taniuchi 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species of shark is particularly vulnerable to overfishing due to its low reproduction rate (2). Despite a widespread distribution, populations are now isolated and, where there is data available, the species is thought to be in decline. In the past, the sand tiger shark has been hunted throughout its range, and the flesh is particularly prized in Japan (3). The oil and fins are also in demand; in the 18th and 19th Centuries the shark was persecuted in large numbers for its liver oil that was used in lighting (7). Individuals tend to group in coastal areas at certain times of the year, making them especially vulnerable to fishing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further studies of the biology and reproduction of this species in the Southwest Atlantic are needed. This species has been listed as a species threatened with over-exploitation on Annex II of the Brazilian federal law of Threatened and Overexploited Aquatic Species since 2004 (Vooren and Klippel 2005). Also the prohibition of trawl fishing within three nautical miles from the coast of southern Brazil is now being enforced satisfactorily. However, the species is still caught as bycatch in the legally permitted coastal gillnet fisheries and offshore trawl and gillnet fisheries. It is recommended that the species is protected throughout its inshore range along the Southwest Atlantic coast of South America, particularly in areas of critical habitat and areas where the adult population still exists. A management plan is being considered for development for this species in the Bahía San Blas Reserve (Anegada Bay, Argentina).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Protection Status in Australia
- Protected Species in Commonwealth waters under the EPBC Act, 1999: East Coast Subpopulation - Critically Endangered (2002).
- Listed as a Vulnerable Species in NSW waters under the Fisheries Management Act, 1994 (since 1999)·
- Listed as a Vulnerable Species in Victorian waters under the Fisheries Act 1995·
- Protected Species in NSW waters under the Fisheries Management Act, 1994 (since November 1984)·
- Protected Species in Tasmanian waters under the Fisheries Regulations, 1996 (since 1998)·
- Protected Species in Queensland waters under the Fisheries Act, 1994 (Fisheries Regulation 1995) (since 1997).

Recovery Plans
- A National Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia was adopted for implementation by the Minister for Environment and Heritage June 2002.
- A draft Recovery Plan for Grey Nurse Shark has been developed for New South Wales.

Proposed Conservation Measures
Conservation measures can been found in the National Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia (Environment Australia 2002). The overall conservation objective is to increase Grey Nurse Shark numbers in Australian waters to a level that will see the species removed from the IUCN Red List.

Other conservation measures
Management measures have been developed for the critical habitat site identified at Pimpernel Rock in northern NSW. Details on management arrangements can be referred to in the Solitary Islands Marine Reserve (Commonwealth Waters) Management Plan Environment Australia, 2001 and the zoning plan for the Solitary Islands Marine Park - Marine Parks Authority, NSW, adopted 1 August 2002 (see Marine Parks Authority, New South Wales).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Protection Status in Australia
- Protected Species in Commonwealth waters under the EPBC Act, 1999: West Coast Population - Vulnerable (since 1997).
- Protected Species in Western Australian waters under the Wildlife Conservation Act, 1950 (since December 1999).

Recovery Plans:
- A National Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia was adopted for implementation by the Minister for Environment and Heritage June 2002.

Proposed Conservation Measures
Conservation measures can been found in the National Recovery Plan for the Grey Nurse Shark (Carcharias taurus) in Australia (Environment Australia 2002). The overall conservation objective is to increase Grey Nurse Shark numbers in Australian waters to a level that will see the species removed from the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Carcharias taurus was protected in NSW in 1984 because of serious declines in the population due to commercial and recreational fishing, spearfishing and beach meshing. In early 1997, the Queensland State Government also declared C. taurus a totally protected species in that State?s waters, and the Australian Commonwealth Government followed suit with protection of C. taurus as a Vulnerable species in all Commonwealth waters and throughout Australia?s Exclusive Economic Zone (EEZ) (i.e., out to two hundred nautical miles offshore). Also in 1997, C. taurus received full protection on the Atlantic and Gulf coasts of the USA, under the Atlantic Fishery Management Plan. The main current threat to this species in south-eastern Australia is probably the accidental (bycatch) capture of juveniles by recreational line fishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: More research on population dynamics and reproductive biology is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: No known protected occurrences. In 1989, the National Marine Fisheries Service judged large coastal sharks (including the tiger shark) to have been overfished by 2,348 metric tons and in 1990 by 1,431 metric tons. As a result, the National Marine Fisheries Service set annual poundage quotas, called total allowable catches for each of the heavily fished groups. In 1993 the total allowable catch for large coastal sharks was set at 2,436 metric tons plus a 464 metric tons recreational quota. The total allowable catch for large coastal sharks was set to be adjusted annually upward at 80% of the annual surplus production. This strategy was predicted to allow for a population increase leading to a return of the natural Maximum Sustainable Yield by the year 2000 (Burgess 1998). Sport anglers were restricted to two sharks per boat per trip for combined large coastal and pelagic sharks. Sale of recreationally caught sharks was prohibited (Burgess 1998). Finning of sharks by commercial and recreational fishermen was prohibited. In addition, a system of data collection and reporting was partially implemented (Burgess 1998). Still this plan has underestimated the recovery of the stocks (Burgess 1998). The total annual take of large coastal sharks was reduced to a total of 2,570 metric tons in 1994 and additional restrictions may be forthcoming (Burgess 1998).

Needs: Occurrences should be protected to ensure long-term survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Despite protection in some countries such as Australia (2) and the United States (3), this species appears to be in decline (2). Management plans urgently need to be implemented in order to safeguard the future of these elegant coastal dwellers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Grey nurse sharks are known for their fierce appearance and have gained an undeserved reputation as a man-eater in Australia. These sharks are not generally aggressive, but have been known to bite. Their bites can inflict serious damage because of their size and their dangerous teeth. They are sometimes tangled in fishing nets.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Shark teeth are lost frequently and are prized gifts in many regions of the world. Shark is a delicacy that is eaten in many areas.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

  • 2005. "Conservation on International Trade in Endangeren Species of wild flora and fauna" (On-line). Accessed November 19, 2005 at http://www.cites.org/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Not considered to be of economic importance and generally not considered dangerous to humans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sand tiger shark

The sand tiger shark (Carcharias taurus), grey nurse shark, spotted ragged tooth shark, or blue-nurse sand tiger is a species of shark that inhabits coastal waters worldwide. It lives close to the shorelines and sandy beaches of North America, hence the name sand tiger shark. It also dwells in the waters of Japan, Australia, and South Africa. Despite its fearsome appearance and strong swimming ability, it is a relatively placid and slow-moving shark. This species has a sharp, pointy head, and a bulky body. The sand tiger's length can reach 3.0 to 3.4 meters (9.8 to 11.2 ft). They are grey with reddish-brown spots on their backs. The sand tiger prefers to hunt close to shore, and shivers (groups) have been observed to hunt large schools of fish. Their diet consists of bony fish, crustaceans, squid, and skates. Unlike other sharks, the sand tiger can gulp air from the surface, allowing it to be suspended in the water column with minimal effort. During pregnancy, the most developed embryo will feed upon its siblings, a reproductive strategy known as intrauterine cannibalism. The sand tiger is categorized as vulnerable on the International Union for Conservation of Nature Red List. It is the most widely kept shark in public aquariums owing to its large size and tolerance for captivity.

Contents

Taxonomy[edit]

The sand tiger shark's classification, Carcharias taurus was originally determined by Constantine Rafinesque, from a specimen caught off the coast of Sicily. Its taxonomic classification has been long disputed by shark experts. Twenty-seven years after Rafinesque's original naming, Müller and Henle, German biologists, changed the genus name from C. taurus to Triglochis taurus. The following year, Swiss-American naturalist Jean Louis Rodolphe Agassiz reclassified the shark as Odontaspis cuspidata based upon examples of fossilized teeth. Agassiz's name was used until 1961 when three paleontologists and ichthyologists, W. Tucker, E. I. White, and N. B. Marshall, requested the shark be returned to the genus Carcharias. The experts' request was rejected and Odontaspis was approved by the International Code of Zoological Nomenclature (ICZN). When experts concluded that taurus belongs after Odontaspis, the name was changed to Odontaspis taurus. In 1977, a South African shark expert, Leonard J. V. Compagno, challenged the Odontaspis taurus name and substituted Eugomphodus, a somewhat unknown classification, for Odontaspis. Many taxonomists questioned his change stating there was not a significant difference between Odontaspis and Carcharias. After changing the name to Eugomphodus taurus, Compagno successfully advocated in establishing the sharks current classification as Carcharias taurus. Carcharias taurus means "bull shark". The ICZN approved this name, and today the name is used among shark experts.[2]

Description[edit]

Snout and mouth of sand tiger shark, showing protruding teeth and small eyes

The eyes of the sand tiger shark are small, lacking eyelids, one of the shark's many distinct characteristics.[3] The head is rather pointy, as opposed to round, while the snout is flattened with a conical shape. Its body is stout and bulky and its mouth extends beyond the eyes. The sand tiger shark usually swims with its mouth open displaying three rows of protruding, smooth-edged, sharp-pointed teeth. Adult sharks tend to have reddish-brown spots scattered around their entire body.[3] Juvenile sand tiger sharks have yellow-brown spots on their bodies.[4] The sand tiger shark has a grey back and white underside. The males have grey claspers with white tips located on the underside of their body. The caudal fin is elongated and has a long upper lobe. They have two large, broad-based grey dorsal fins set back beyond the pectoral fins.[5] The pectoral fins are triangular, and the tail is almost one-third as long as the shark's head. The sand tiger's length at sexual maturity averages 1.9 to 1.95 m (6.2 to 6.4 ft) in males and 2.2 m (7.2 ft) in females, the latter being the larger-bodied sex.[6] Large mature specimens can attain a length of 3.0 to 3.4 meters (9.8 to 11.2 ft). A specimen of 50 kg (110 lb) in weight is considered "medium"-sized while a 95 to 110 kg (210 to 240 lb) specimen is considered "average"-sized.[7][8] Sand tiger sharks have been reported to attain a maximum mass of 159 kg (350 lb), however some sources claim the specimen can attain a weight of 300 kg (660 lb).[8][9]

In August 2007, an albino specimen was photographed off South West Rocks, Australia.[10]

Behaviour[edit]

The underbelly of a sand tiger shark, showing its pectoral fins

The sand tiger shark is an active night feeder.[11] It is the only shark known to gulp air and store it in the shark's stomach, allowing the shark to maintain near-neutral buoyancy which helps it to hunt motionlessly and quietly so as not to alert its prey.[11][12] The sand tiger shark has been observed to gather in hunting groups with other sand tiger sharks when preying upon large schools of fish.[13] The sand tiger shark also gathers in numbers when hunting large prey or when mating.[14] As the shark matures, it tends to eat larger prey including other sharks, dolphins, and swordfish. Biologists have observed that the shark will usually swallow its prey whole, which if the prey is too large can lead to health problems for the shark such as esophagus, heart, and liver damage.[15]

Diet[edit]

The diet of the sand tiger shark often consists of fish, young sharks, rays, crustaceans, and bluefin tuna trapped in nets. The sand tiger hunts a variety of fish along the Atlantic coast of North America, including mackerel, menhaden, butterfish, flounder, weakfish, bonito, alewives, and silver hake.[16][17] However, the sand tiger prefers bony fish such as eels, mullets, and sea basses.[12]

Interaction with humans[edit]

The sand tiger is often associated with being vicious or deadly, due to their relatively large size and sharp, protruding teeth that point outward from their jaws, however they are often quite docile, and aren't usually a threat to humans. Sand tigers roam the surf of the Atlantic coast, sometimes in close proximity to humans, but of 29 reported attacks, only two were fatal.[12] There have been only a few instances of unprovoked sand tiger shark attacks on humans.[18] Spearfishing may lead to aggressive behavior.[12] When the sharks become aggressive they tend to steal the fish or bait rather than attacking humans. Owing to its large size and docile temperament, the sand tiger is commonly displayed in aquariums around the world.[11]

These sharks were also recently used in a successful experiment in artificial uterus development.[19]

Habitat and range[edit]

Sand tiger sharks roam the epipelagic and mesopelagic regions of the ocean,[12] sandy coastal waters, estuaries, shallow bays, and rocky or tropical reefs, at depths of up to 19 meters (62 ft). However, sand tiger sharks inhabiting even deeper depths have been recorded. Sand tiger sharks have only been seen in Canadian waters three times: in the Minas Basin of Nova Scotia; near St. Andrews, New Brunswick; and off Point Lepreau, New Brunswick.[20] The sand tiger shark can be found in the Atlantic, Pacific and Indian Oceans, and in the Mediterranean and Adriatic Seas.[12]

Sand tiger next to a German U-boat in the Pine Knoll Shores Aquarium

In the Western Atlantic Ocean, the sand tiger shark is found in coastal waters around from the Gulf of Maine to Florida, in the northern Gulf of Mexico around the Bahamas and Bermuda, and from southern Brazil to northern Argentina. The sand tiger shark is also found in the eastern Atlantic Ocean from the Mediterranean Sea to the Canary Islands, at the Cape Verde Islands, along the coasts of Senegal and Ghana, and from southern Nigeria to Cameroon. In the western Indian Ocean, the shark's habitat ranges from South Africa to southern Mozambique, but it does not live around Madagascar. The sand tiger shark has also been sighted in the Red Sea and may be found as far east as India. In the western Pacific, it has been sighted in the waters around the coasts of Japan and Australia, but not New Zealand.[1] The sand tiger dwells in warmer waters, and migrates according to its hemisphere's seasonal changes (south for the summer; north for the winter). When migrating, the species tends not to travel great distances.[21]

Reproduction[edit]

Males reach sexual maturity at about six to seven years old and approximately 1.8 meters (6 ft) in length. Females reach maturity when approximately 2 meters (7 ft) long at about nine to ten years of age.[3] Mating occurs around the months of March and April in the northern hemisphere.[3] During mating, the male sand tiger grasps the female's fins with his teeth. This can leave deep cuts that normally heal within a week. The male shark uses claspers (modified pelvic fins), to inseminate the female.[22] The sand tiger shark has one of the lowest reproduction rates of all species of sharks, therefore, they are easily affected by population pressures.[11] Female sharks have two uteri. During early embryonic stages the young absorb nutrients from a yolk sac and possibly consume uterine fluids. At approximately 10 centimeters (4 in) in length, developing embryos in the mother's uteri are killed and devoured by two surviving pups, a process called intrauterine cannibalism (oophagy).There is one report of a biologist disecting the bellies of landed females and having their fingers nipped by the cannibalistic young with their fully developed teeth.[23] The surviving embryos (one in each uterus) continue to feed on a steady supply of yolk capsules that contain 7–23 unfertilized ova.[24] After a lengthy labour, the female gives birth to 1 meter (3 ft) long, fully independent offspring. The gestation period is approximately eight to nine months.[3] Hydroids grow on the mother's teeth during pregnancy because she stops feeding.[25]

Conservation status[edit]

Carcharias taurus newport.jpg

This species is listed as vulnerable on the International Union for Conservation of Nature Red List,[1] and as endangered under Queensland's Nature Conservation Act 1992. It is a U.S. National Marine Fisheries Service Species of Concern, which are those species that the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service (NMFS), has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act. According to the National Marine Fisheries Service, any shark caught must be released immediately with minimal harm, and is considered a prohibited species, making it illegal to harvest any part of the sand tiger shark on the United States' Atlantic coast.[3] The population of the sand tiger has been reduced over twenty percent in the past ten years, which means the shark is considered vulnerable by the World Conservation Union. There are several factors contributing to the decline in the population of the sand tigers. Sand tigers can be caught by fishing trawls, although they are more commonly caught with a fishing line. Sand tigers' fins are a popular trade item in Japan.[1] Shark liver oil is a popular product in beauty products such as lipstick.[3] Thus, overfishing is a major contributor to the population decline. In northern Australia, nets are put in place to protect swimmers from sharks. Many sand tigers are caught in the nets, and then either strangled or taken by fishermen.[1] Estuaries along the United States of America's eastern Atlantic coast houses many of the young sand tiger sharks. These estuaries are susceptible to non-point source pollution that is harmful to the pups.[3]

Common names[edit]

Because the sand tiger is worldwide in distribution it has many common names. The grey nurse shark, the name used in Australia and the United Kingdom, is the second-most-used name for the shark. Other names include spotted ragged tooth (South Africa) and blue-nurse sand tiger (India).[26]

References[edit]

  1. ^ a b c d e Pollard, D.; & Smith, A. (2009). "Carcharias taurus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved November 29, 2011. 
  2. ^ "The Tangled Taxonomy of the Sandtiger Shark". ReefQuest Centre for Shark Research. 2007. Retrieved October 18, 2011. 
  3. ^ a b c d e f g h "Sand tiger shark". NOAA National Marine Fisheries Service. 2011. Retrieved November 28, 2011. 
  4. ^ "Sand shark Carcharias taurus Rafinesque 1810". United States Department of the Interior. 2009. Retrieved October 25, 2011. 
  5. ^ "SAND TIGER SHARK". Florida Museum of Natural History. 2011. Retrieved November 21, 2011. 
  6. ^ FLMNH Ichthyology Department: Sandtiger Shark. Flmnh.ufl.edu. Retrieved on 2012-12-19.
  7. ^ The Sand Tiger Shark in GURPS. Panoptesv.com. Retrieved on 2012-12-19.
  8. ^ a b ADW: Carcharias taurus: INFORMATION. Animaldiversity.ummz.umich.edu. Retrieved on 2012-12-19.
  9. ^ "Meet the Animals". The Maritime Aquarium of Long Island. 2011. Retrieved November 29, 2011. 
  10. ^ Samantha Williams (8 August 2007). "Rare albino shark rules deep". thetelegraph.com.au. Retrieved 2008-08. 
  11. ^ a b c d "Sand Tiger Shark". National Geographic Society. 2009. Retrieved October 26, 2011. 
  12. ^ a b c d e f "Florida Museum of Natural History Ichthyology Department: Sand tiger Shark". Florida Museum of Natural History. 2009. Retrieved October 18, 2011. 
  13. ^ "The Sand Tiger Shark". University of Delaware College of Earth, Ocean, and Environment. 2008. Retrieved 2011-12-05. 
  14. ^ "Fact Sheet: Sand Tiger Sharks". Dr. Erich K. Ritter. 2011. Retrieved November 29, 2011. 
  15. ^ Lucifora, L. O.; Garcia, V. B.; Escalante, A. H. (2009). "How can the feeding habits of the sand tiger shark influence the success of conservation programs?". Animal Conservation 12 (4): 291–301. doi:10.1111/j.1469-1795.2009.00247.x. 
  16. ^ "Sand Tiger Shark". The Discovery Channel. 2011. Retrieved November 29, 2011. 
  17. ^ "Recovery plan for the Grey Nurse Shark (Carcharias taurus) in Australia". Australian Government: Department of Sustainability, Environment, Water, Population and Communities. 2002. Retrieved October 18, 2011. 
  18. ^ "Sand Tiger Shark". National Geographic. 2009. Retrieved October 20, 2011. 
  19. ^ Venton, Danielle (2011-09-29). Baby Sharks Birthed in Artificial Uterus. wired.com
  20. ^ "Sand Tiger Shark". WebWise. Retrieved December 24, 2011. 
  21. ^ "Sand Tiger Sharks, Carcharias taurus". MarineBio.org. 2011. Retrieved December 5, 2011. 
  22. ^ "Sand Tiger Sharks: Characteristics". Nautilus Productions. Retrieved December 4, 2011. 
  23. ^ "Sand Tiger Shark". New England Aquarium. Retrieved October 26, 2011. 
  24. ^ Gilmore, Grant; Dodrill, Jon; Linley, Patricia (1983). "Reproduction and Embryonic Development of the Sand Tiger Shark, Odontapsis taurus (Rafinesque)". Fishery Bulletin 81 (2): 201. Retrieved 2011-12-19. 
  25. ^ "Sand Tiger Shark". Elasmo Diving. Retrieved November 29, 2011. 
  26. ^ "Common names of Carcharias taurus". FishBase. 2011. Retrieved December 4, 2011. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Although some recent authors recognize Odontaspis, the senior synonym, and Carcharias as congeneric, Nelson (2004) follows Compagno (1999) in considering Carcharias to be a valid genus.

Also known as gray nurse shark and spotted raggedtooth shark (Compagno 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!