Overview

Comprehensive Description

Biology

Found on outer continental shelves and upper slopes on or near the bottom at depths of 100 to 1,000 m; also pelagic at depths of 70 to 480 m over water 2,240 m deep off Argentina (Ref. 247). Feeds on bony fish, octopus, squid and deep-water shrimp (Ref. 5578). Ovoviviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Emerald Bank to Argentina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

E. gracilispinis has a widespread but disjunct distribution off North and South America and southern Africa. Widespread in temperate and subtropical western Atlantic Ocean waters and off South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Virginia and Florida (USA), Uruguay and Argentina; reported off Suriname (Ref. 13608) and Brazil (Ref. 57911). Southeast Atlantic: off the eastern Cape and northern Natal in South Africa (Ref. 11228). Some reports of this species from the southeast Atlantic may be misidentifications of the recently described Etmopterus compagnoi (Ref. 36731).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic; southwestern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

35.0 cm TL (male/unsexed; (Ref. 36137)); 33 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A stout lanternshark with a short tail and small conical denticles, not forming conspicuous lines along the body (Ref. 5578). Brown above, becoming black ventrally with inconspicuous, elongated, broad black marks along the caudal fin and at its base (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

on or near the bottom at depths of 100 to 1,000 m
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Benthic or epibenthic on the outer continental shelf and upper to middle slopes at depths of 100 to 1,000 m, but with captures in midwater trawls at depths of 70 to 480 m over waters of 2,240 m off Argentina and off South Africa also indicating an epipelagic and mesopelagic existence (Compagno in prep. a, G.H. Burgess unpub. data).

Like most other lanternsharks, biology and ecology is poorly known, but presumed to be aplacental viviparous (Compagno et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 70 - 1000 m (Ref. 247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 146 - 763
  Temperature range (°C): 3.940 - 18.453
  Nitrate (umol/L): 3.423 - 29.293
  Salinity (PPS): 34.344 - 36.286
  Oxygen (ml/l): 3.602 - 4.900
  Phosphate (umol/l): 0.534 - 2.044
  Silicate (umol/l): 4.334 - 38.057

Graphical representation

Depth range (m): 146 - 763

Temperature range (°C): 3.940 - 18.453

Nitrate (umol/L): 3.423 - 29.293

Salinity (PPS): 34.344 - 36.286

Oxygen (ml/l): 3.602 - 4.900

Phosphate (umol/l): 0.534 - 2.044

Silicate (umol/l): 4.334 - 38.057
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 70 - 1000m.
From 70 to 1000 meters.

Habitat: benthopelagic. Found on the outer continental shelves and upper slopes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on outer continental shelves and upper slopes on or near the bottom at depths of 100 to 1,000 m; also pelagic at depths of 70 to 480 m over water 2,240 m deep off Argentina. Feeds on bony fish, octopus, squid and deep-water shrimp.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on bony fish, octopus, squid and deep-water shrimp
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Distinct pairing with embrace (Ref. 205). Pups born with 13 cm length.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etmopterus gracilispinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACAGCCCTAAGCTTACTTATTCGAGCAGAATTAAGCCAACCTGGGACTCTTCTGGGTGATGACCAGATCTATAATGTAATTGTAACTGCCCATGCATTTGTAATAATTTTTTTTATAGTAATACCAGTAATAATCGGCGGATTTGGAAACTGACTAGTACCTTTAATAATTGGCGCACCAGATATAGCTTTTCCACGAATAAATAACATAAGCTTCTGATTATTACCTCCAGCACTACTTCTACTCTTAGCCTCCGCTGGAGTTGAAGCAGGAGCTGGAACTGGTTGAACAGTTTATCCACCCCTTGCGGGAAATATAGCCCATGCCGGAGCATCCGTAGACTTAGCCATTTTTTCACTTCATTTAGCTGGCATCTCCTCAATTTTGGCCTCTGTAAACTTTATTACAACCATTATTAATATAAAACCACCAGCTATTTCTCAATACCAAACACCACTATTTGTTTGATCAATTCTTGTAACTACTATTCTACTCCTCCTTGCCCTTCCCGTACTTGCAGCTGCAATTACAATATTACTTACTGACCGTAATTTAAACACAACATTCTTTGATCCTTCAGGGGGTGGAGATCCAATCCTATATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etmopterus gracilispinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Burgess, G.H., Amorim, A.F., Mancini, P. & Gonzalez, P.

Reviewer/s
Kyne, P.M. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
Etmopterus gracilispinis is a small lanternshark (to at least 33 cm TL) inhabiting the outer continental shelf and upper to middle slopes at depths of 100 to 1,000 m. Also epipelagic and mesopelagic at depths of 70 to 480 m over waters of 2,240 m off Argentina and off South Africa. It has a widespread but disjunct distribution in the western Atlantic and off southern Africa. In the western Atlantic known from off the USA, Suriname, southern Brazil, Uruguay and Argentina. Like most other lanternsharks, biology and ecology is poorly known. Some mortality from pelagic and deepwater fisheries is likely to occur across the species' range, for example the species is a rare bycatch in Santos longliners off southern Brazil, and in deepwater fisheries off the USA. However, this mortality is of no immediate threat to the viability of the species given the limited catches in these fisheries, and the widespread benthic, epibenthic, epipelagic and mesopelagic occurrence of the species. As such, the species is assessed as Least Concern. As with other deepwater species though, any future expansion of deepwater fisheries within its range should be closely-monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Large disjunctions between northern and southern Atlantic and southern African distributions may suggest distinct subpopulations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Some mortality from pelagic and deepwater fisheries is likely to occur across the species range. For example, the species has been recorded as rare (very few specimens, representing a little more than 0% of the catch of elasmobranchs) in the bycatch longliners operating out of Santos City, São Paulo, southern Brazil (Amorin et al. 1998). Also, only limited bycatch off the USA. As such, this mortality is of no immediate threat to the viability of the species given the limited catches in these fisheries, and the widespread benthic, epibenthic, epipelagic and mesopelagic occurrence of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place. Any future expansion of deepwater fisheries in the area should be closely-monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Broadbanded lanternshark

The broadbanded lanternshark, Etmopterus gracilispinis, is a shark of the family Etmopteridae found in the western and southeast Atlantic, between latitudes 40°N and 45°S, at depths of between 70 and 1,000 m. Its length is up to 35 cm.

Reproduction is presumed to be ovoviviparous.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!