Overview

Brief Summary

The northern pike (Esox lucius), known simply as a pike in Britain, Ireland, and the USA, or as jackfish in Canada), is a popular sporting and food fish that inhabits freshwaters around the northern hemisphere, and are found in brackish waters of the Baltic Sea. Northern pike in Europe can grow up to about 25 kg and 150 cm long; females are generally larger than males. They become sexually mature at 3-4 years of age, and live between 10-12 years. Solitary and territorial, these fish ambush predators. As young fish they feed on small invertebrates, and as they grow older their broad diet grows to include amphibians and fish of all sorts (including their own kind), and even small mammals and birds. Pike has been used to stock waterways (often illegally) in many areas, and has impacted native fish populations and fish communities in negative ways. In Alaska, Colorado, Montana and Maine, E. lucius have been documented as threatening stickleback and native salmonids. The northern pike can hybridize with the closely related muskellunge E. masquinongy, and in some areas E. lucius threaten native muskellunge populations.

( Department of Natural Resources; Fuller 2012; Wikipedia 2012)


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Pike spawn from the end of March to the beginning of May, usually in quite shallow water and often using the same places year after year. The spawning process can last several weeks and the number of eggs varies with the age and size of the female. A large fish may produce as many as half a million eggs. The eggs are sticky and adhere to plants, the young pike hatching after 10 – 15 days. At this stage they have no proper mouthparts and remain attached to the plants until the yoke sac is consumed. Once the young fish become free-swimming, they feed mainly on small organisms, but once they reach a length of 5 cm, they begin preying on other fish larvae and tadpoles. Once they have survived these early stages, pike grow fast, sometimes reaching a weight of one kilogram in the space of three years. Males mature at the age of two, females at four years. Pike catch their food largely by stealth and lightning-fast acceleration, taking their prey unawares. A large adult pike will eat roach, rudd, dace and perch, trout and salmon, and even other members of their own species. They will also take frogs, newts, crayfish and they have been known to catch ducklings and small mammals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Biology

Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers (Ref. 5723). Usually solitary and highly territorial. Enters brackish water in the Baltic. Adults feed mainly on fishes, but at times feed heavily on frogs and crayfish (Ref. 27547). Cannibalism is common. In arctic lakes, it is sometimes the only species present in a given water body. In such cases, juveniles feed on invertebrates and terrestrial vertebrates; large individuals are mainly cannibals (Ref. 59043). Cannibalistic as juveniles (Ref. 30578). Feces of pike are avoided by other fish because they contain alarm pheromones. Deposits feces at specific locations, distant from its foraging area (Ref. 59043). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Does not generally undertake long migrations, but a few may move considerable distances (Ref. 27547). Oviparous (Ref. 205). This fish can be heavily infested with parasites, including the broad tapeworm which, if not killed by thorough cooking, can infect human; is used as an intermediate host by a cestode parasite which results to large losses in usable catches of lake whitefish (Coregonus clupeaformis) in some areas; also suffers from a trematode which causes unsightly cysts on the skin (Ref. 9988). Excellent food fish; utilized fresh and frozen; eaten pan-fried, broiled, and baked (Ref. 9988). Valuable game fish (Ref. 5723). In spite of numerous attempts to culture this species, it was never entirely domesticated and does not accept artificial food (Ref. 30578). Locally impacted by habitat alterations (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The pike is probably the coarse anglers' most sought-after fish. It is predatory both in nature and appearance. The fish has a flat, broad, almost duck-like snout and an elongated, streamlined body with dorsal and anal fins placed well back. The colour of the fish varies with its habitat, those living in weeded waters being predominantly mottled green and yellow. Fish from brackish waters are more yellowish. Pike turn darker with age, old specimens becoming brown or even greyish. Pike are the subject of innumerable fishy stories, with many telling of 'the one that got away'. Establishing the weight of the largest pike on record in the UK is almost as tricky as catching the actual fish might have been. According to the Pike Angler's Club of Great Britain, the record goes to one caught on a rod and line in Llandegfedd Reservoir, Wales, in 1992. That fish weighed 46lb 13oz (21.3 kg). However, there is also a Scottish record dating back to 1945 which refers to a fish caught in Loch Lomond that weighed 47lb 11oz (21.6 kg).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The range of the pike encompasses many northern latitude countries, including: the USA (north of the prairies), southern Canada, the UK and most of Europe (except Iberia), western Scandinavia, the Baltic States, Russia south to the Caspian Sea and eastwards through southern Siberia to the Baring Straits.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Caspian, Black, Baltic, White, Barents, Arctic, North and Aral Seas and Atlantic basins, southwest to Adour drainage; Mediterranean basin, in Rhône drainage and northern Italy. Widely distributed in North America and Siberia eastward to Anadyr drainage (Bering Sea basin). Historically absent from Iberian Peninsula, Mediterranean France, central Italy, southern and western Greece, eastern Adriatic basin, Iceland, western Norway and northern Scotland. Now widely introduced and translocated throughout Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Esox lucius are native to North America and Eurasia. They are found from Labrador west to Alaska, south to Pennsylvannia, Missouri and Nebraska. In Europe they are found throughout northern and western Europe, south throughout Spain and east to Siberia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Black Sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, Hudson Bay, Hudson Strait, IJsselmeer, North East Pacific, North Pacific, North West Territories, Polish Exclusive Economic Zone, Portugese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, Ungava Bay, United Kingdom Exclusive Economic Zone, Westerschelde, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Holarctic. Atlantic, Arctic, Pacific, Great Lakes, and Mississippi River basins from Alaska to Labrador, south to Pennsylvania, Missouri, and Nebraska (Page and Burr 1991). Introduced in many areas southward of native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumpolar in fresh water. North America: Atlantic, Arctic, Pacific, Great Lakes and Mississippi River basins from Labrador to Alaska and south to Pennsylvania, Missouri and Nebraska, USA (Ref. 5723). Eurasia: Caspian, Black, Baltic, White, Barents, Arctic, North and Aral Seas and Atlantic basins, southwest to Adour drainage; Mediterranean basin in Rhône drainage and northern Italy. Widely distributed in central Asia and Siberia easward to Anadyr drainage (Bering Sea basin). Historically absent from Iberian Peninsula, Mediterranean France, central Italy, southern and western Greece, eastern Adriatic basin, Iceland, western Norway and northern Scotland. Widely introduced and translocated throughout Europe (Ref. 59043). Several countries report adverse ecological impact after introduction (Ref. 1739).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Northern pike average 46-51 cm (18-20 inches) in length. They can be identified by their single dorsal fin and light-colored spots along their dark body. They are also recognized by scales that cover their entire cheek and the upper half of their gill covers. Their close relative, the muskellunge (Esox masquinongy), have scales covering only the upper half of their cheek and gill covers. The sides of E. lucius vary from dark shades of green to olive green to brown, with 7 to 9 rows of yellowish, bean-shaped spots. The underside is white to cream-colored.

Range mass: 0.5 to 1.4 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 6 - 8; Dorsal soft rays (total): 17 - 25; Anal spines: 4 - 7; Analsoft rays: 10 - 22; Vertebrae: 57 - 65
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 133 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

137 cm FL (male/unsexed; (Ref. 40637)); 150 cm TL (female); max. published weight: 28.4 kg (Ref. 40637); max. published weight: 35 kg; max. reported age: 30 years (Ref. 556)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from all other freshwater fishes in Europe by the combination of the following characters: long snout; large mouth; dorsal fin origin slightly in front of anal origin; and lateral line with 105-148 scales (Ref. 59043). Distinguished by its long, flat, 'duck-bill' snout; its large mouth with many large, sharp teeth; and the rearward position of its dorsal and anal fins (Ref. 27547). Gill rakers present only as patches of sharp teeth on gill arches; lateral line notched posteriorly (Ref. 27547). Dorsal located far to the rear; anal located under and arising a little behind dorsal; pectorals low on body, base under opercle; pelvic fins low on body; paired fins rounded, paddle-shaped (Ref. 27547). Caudal fin with 19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
In a wide variety of habitats with aquatic or periodically flooded vegetation. Often semi-anadromous in part of northern Baltic basin with lower salinity.

Biology:
Males reproduce for the first time at 170-350 mm SL, females at 250-400 mm SL, at 1-6 years. Reproduction closely related to the presence of submerged vegetation. Spawns in late winter or early spring, between February in the south and June in the north, when temperature rises above 5°C. Several males court a single female. Eggs are deposited in flooded areas and on submerged vegetation over a period of 2-5 days. Juvenile survival is negatively related to biomass of older individuals and positively related to the area of the patches covered by submerged vegetation. Feeds on various small vertebrates, predominantly fish, and large invertebrates as decapod crustaceans. Cannibalism is common. In arctic lakes, it is sometimes the only fish species in a given water body; in such cases, juveniles feed on invertebrates and terrestrial vertebrates; large individuals are predominantly cannibals.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Esox lucius are found in almost every type of freshwater, from cold deep lakes, to warm shallow ponds, to muddy rivers. Having a broad range of tolerances for water temperature, clarity and oxygen content allows E. lucius to be "one of the most adaptable freshwater species" (Steinberg, 1992, pg. 20).

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2801 specimens in 1 taxon.
Water temperature and chemistry ranges based on 237 samples.

Environmental ranges
  Depth range (m): 0 - 64
  Temperature range (°C): 3.141 - 7.898
  Nitrate (umol/L): 1.212 - 5.208
  Salinity (PPS): 5.681 - 8.865
  Oxygen (ml/l): 3.529 - 8.684
  Phosphate (umol/l): 0.114 - 1.557
  Silicate (umol/l): 12.053 - 35.741

Graphical representation

Depth range (m): 0 - 64

Temperature range (°C): 3.141 - 7.898

Nitrate (umol/L): 1.212 - 5.208

Salinity (PPS): 5.681 - 8.865

Oxygen (ml/l): 3.529 - 8.684

Phosphate (umol/l): 0.114 - 1.557

Silicate (umol/l): 12.053 - 35.741
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Usually in clear small lakes, shallow vegetated areas of larger lakes, marshes, creeks, and small to large rivers. Moves to deeper cooler water in summer. Generally does not do well with low or widely fluctuating water levels (Sublette et al. 1990). Spawns in shallow flooded marshes associated with lakes or with inlet streams to those lakes (or flooded terrestrial vegetation at reservoir edge); spawning habitat basically a flooded area with emergent vegetation (optimally over short grasses or sedges). Young remain in spawning habitat for several weeks after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: demersal. Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers. Usually solitary. Highly territorial predator. Enters brackish water in the Baltic. After the yolk is absorbed, young feed on large zooplankton and immature aquatic insects for about 7-10 days; fish then becomes the major part of the diet (Ref. 1998). Adults occasionally feed on frogs, crayfish and other vertebrates (Ref. 1998). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Adults are preyed upon bears, dogs, eagles, and osprey during the spawning run (Ref. 1998). Valuable game fish. This fish can be heavily infested with parasites, including the broad tapeworm which, if not killed by thorough cooking, can infect human; is used as an intermediate host by a cestode parasite which results to large losses in usable catches of lake whitefish (@Coregonus clupeaformis@) in some areas; also suffers from a trematode which causes unsightly cysts on the skin (Ref. 9988). Excellent food fish; utilized fresh and frozen; eaten pan-fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pike can be found in many water bodies provided there is plenty of oxygen and a neutral or alkaline pH. They occur in lakes with plenty of vegetation, rivers and creeks. They occasionally venture into brackish water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous; freshwater; brackish; depth range 0 - 30 m (Ref. 1998), usually 1 - 5 m (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate between spawning and nonspawning habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Esox lucius are a carnivorous fish. Equipped with sharp teeth and very complex skull and jaw structures they are predators of smaller fish, frogs, crayfish, small mammals and birds.

Animal Foods: birds; mammals; amphibians; fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers (Ref. 5723, 10294). Usually solitary and highly territorial. Enters brackish water in the Baltic. Adult feeds mainly on fishes, but at times feeds heavily on frogs and crayfish (Ref. 27547). Cannibalistic as juveniles (Ref. 30578). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Does not generally undertake long migrations, but a few may move considerable distances (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Young initially eat large zooplankton and immature aquatic insects. After 7-10 days fishes begin to enter diet and eventually dominate. Adults feed opportunistically on vertebrates small enough to be engulfed. (Scott and Crossman 1973). Sight feeder.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Esox lucius preys on:
Osmerus eperlanus mordax
Cyprinus carpio
Pimephales notatus
Stizostedion vitreum
Larus californicus

Based on studies in:
Quebec (Lake or pond, Pelagic)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Esox lucius

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises skin of Esox lucius

Animal / parasite / endoparasite
Cryptobia gurneyorum endoparasitises blood of Esox lucius

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Esox lucius

Animal / parasite / ectoparasite / blood sucker
Piscicola geometra sucks the blood of Esox lucius

Animal / parasite / ectoparasite
fluke of Tetraonchus monenteron ectoparasitises gill of Esox lucius

Animal / parasite / endoparasite
Trypanosoma remaki endoparasitises blood of Esox lucius
Other: sole host/prey

Animal / parasite / endoparasite
metacaria of Tylodelphys clavata endoparasitises eye (humour) of Esox lucius

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Pike Fry Rhabdovirus. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Adults solitary except at spawning. Evidence from New England indicates that landlocked populations of Atlantic salmon may be negatively influenced as abundance of northern pike and/or Esox hybrids increases.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeds diurnally. Active and feeds in winter under ice.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Spawners move inshore or upstream to the marsh areas to spawn (Ref. 27547). Generally, spawning occurs during the day. The sexes pair and a larger female is usually attended by one or two smaller males. They swim through and over the vegetation in water usually less than 17.8 cm, releasing eggs and sperm simultaneously at irregular intervals (Ref. 1998). Eggs are deposited in flooded areas and on submerged vegetation over a period of 2-5 days (Ref. 59043). Only 5 to 60 eggs ae released at a time (Ref. 27547). This act is repeated every few minutes for up to several hours, after which the fish rest for some time before resuming. During the resting period, both male and female may take new mates, or they may continue together for several days until all eggs are extruded. Spawned-out adults may stay on the spawning grounds for as long as 14 weeks, but most leave within 6 (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: captivity:
6.8 years.

Average lifespan

Status: wild:
24.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Northern pike are considered random spawners not nest builders. Spawning occurs in the shallows when the water temperature reaches 4-7 degress Celsius (40-45 degrees Fahrenheit). Spawning lasts for 5 to 10 days after which the female leaves. Males remain in the spawning area for several weeks, but do not protect the eggs. At this stage the eggs are vulnerable to predators. The eggs that do survive hatch in about 2 weeks. With their insatiable eating habits young E. lucius grow rapidly in both length and weight. Males become sexually mature at 2-3 years-old and females at 3-4 years-old.

Breeding season: Spawning occurs in the spring.

Average time to hatching: 2 weeks.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
889 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1116 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns in spring as soon as ice begins to break up. Produces a single clutch per year. Eggs hatch in 12-14 days at typically prevailing temperatures. Males sexually mature at 1-2 years in south, at age 5 in north; females mature at 2-3 years in south, at age 6 in north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Esox lucius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 48 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1633-06|NC_004593|Esox lucius| ACACGCTGATTTTTCTCTACTAACCACAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACAGCCTTA---AGCCTTTTAATCCGGGCCGAACTAAGCCAGCCAGGGGCTCTCTTAGGTGAC---GACCAGATTTATAATGTTATCGTTACAGCCCATGCCTTTGTTATAATCTTTTTTATAGTTATACCCGTTATAATTGGGGGTTTTGGAAACTGATTAATTCCCCTAATG---ATTGGTGCCCCCGACATGGCCTTCCCCCGCATAAATAATATAAGCTTCTGACTTCTCCCCCCCTCCTTTTTACTTCTCTTAGCCTCCTCAGGTGTTGAAGCTGGTGCTGGTACTGGCTGAACAGTTTATCCGCCTTTGGCCGGAAACTTAGCACACGCAGGTGCTTCTGTAGACTTA---ACTATTTTCTCTCTCCACCTGGCCGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACCACAATTATTAACATAAAACCCCCCGCCATCTCACAATATCAGACACCATTATTTGTTTGAGCAGTCCTGATTACAGCTGTACTTCTACTTCTATCTCTCCCAGTCCTAGCCGCT---GGAATTACCATATTGCTCACAGACCGAAATTTAAACACCACATTCTTTGACCCCGCTGGTGGTGGAGACCCTATTCTATACCAACACCTCTTCTGATTCTTCGGACACCCGGAAGTCTACATTCTTATTCTACCAGGATTTGGTATAATCTCTCACATTGTAGCTTATTATTCTGGTAAAAAA---GAACCATTCGGCTACATAGGCATAGTATGAGCAATAATGGCCATTGGTCTCCTTGGCTTTATTGTCTGAGCCCACCATATGTTTACTGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Esox lucius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 48
Species: 85
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Justification
A widespread species with no known major widespread threats, however some local populations are impacted by habitat alterations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Esox lucius is not currently threatened by extinction. The Departments of Natural Resources in states where they occur keep a close watch on population levels and can augment populations by stocking streams with Esox lucius raised in hatcheries.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although pike need water high in oxygen and of low acidity, there does not appear to be any threats to population numbers in the UK. However, it is thought that over-fishing may be taking place in some other European countries (1999 figures).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Pike are a much-prized game fish and, in the UK, can be pursued by anglers throughout the season (16 June – 14 March), provided they hold a rod licence. There are no specific conservation measures currently in place for pike apart from general laws governing pollution of rivers and water bodies. Pike have been introduced into several countries' rivers to provide sport, and in some cases the fish have cause adverse ecological problems. Deliberately introducing pike to ponds in order to remove unwanted fish is a frequent practice in some areas and has to be monitored carefully.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of northern pike on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Esox lucius is a prized game fish throughout its range and is a commercial food fish in eastern Europe.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Highly prized game fish. Extensively cultured in Europe. (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern pike

The northern pike (Esox lucius, known simply as a pike in Britain, Ireland, and the USA, or as jackfish in Canada), is a species of carnivorous fish of the genus Esox (the pikes). They are typical of brackish and freshwaters of the northern hemisphere (i.e. holarctic in distribution).

Contents

Geographic distribution

Esox lucius is found in freshwater throughout the northern hemisphere, including Russia, Europe and North America. It has also been introduced to lakes in Morocco and is even found in brackish water of the Baltic Sea. However pike are confined to the low salinity water at the surface of the Baltic sea, and are seldom ever seen in brackish water elsewhere.[citation needed]

Within North America, there are northern pike populations in Illinois, North Dakota, South Dakota, Minnesota, Michigan, Montana, Maryland, West Virginia, Wisconsin, Indiana, Connecticut, Rhode Island, New Hampshire, Massachusetts, Vermont, Iowa, Utah, Northern New Mexico and Arizona, Colorado, New York, Idaho, northern Alberta, Saskatchewan, Manitoba, Ontario and Québec (pike are rare in British Columbia and east coast provinces), Alaska, the Ohio Valley, the upper Mississippi River and its tributaries, the Great Lakes Basin and surrounding states, Missouri, Kansas, Nebraska, Colorado and parts of Oklahoma. They are also stocked in, or have been introduced to, some western lakes and reservoirs for angling purposes, although some fisheries managers believe this practice often threatens other species of fish such as bass, trout and salmon, causing government agencies to attempt to exterminate the pike by poisoning lakes.[1]

Northern pike in public aquarium in Kotka, Finland

Description

Northern pike in the Straussee at Strausberg

Northern pike are most often olive green, shading from yellow to white along the belly. The flank is marked with short, light bar-like spots and there are a few too many dark spots on the fins. Sometimes the fins are reddish. Younger pike have yellow stripes along a green body, later the stripes divide into light spots and the body turns from green to olive green. The lower half of the gill cover lacks scales and they have large sensory pores on their head and on the underside of the lower jaw which are part of the lateral line system. Unlike the similar-looking and closely related muskellunge, the northern pike has light markings on a dark body background and fewer than six sensory pores on the underside of each side of the lower jaw.

Drawing of Esox lucius

A hybrid between northern pike and muskellunge is known as a Tiger Muskellunge (Esox masquinongy × lucius or Esox lucius × masquinongy,[2] depending on the sex of each of the contributing species). In the hybrids, the males are invariably sterile, while females are often fertile, and may back-cross with the parent species.[3] Another form of northern pike, the silver pike, is not a subspecies but rather a mutation that occurs in scattered populations. Silver pike, sometimes called silver muskellunge, lack the rows of spots and appear silver, white, or silvery-blue in color.[4] When ill Silver pike have been known to display a somewhat purplish hue, long illness is also the most common cause of male sterility. They have been known to attack swimmers in fresh water.

Length and weight

Pike grow to a relatively large size; lengths of 150 centimetres (59 in) and weights of 25 kilograms (55 lb) are not unheard of. The heaviest specimen known so far was caught in an abandoned stone quarry, in Germany, in 1983. She (the majority of all pikes over 8 kg or 18 lb are females) was 147 cm (58 in) long and weighed 31 kg (68 lb). The longest pike ever recorded was 152 cm (60 in) long and weighed 28 kg (62 lb). Historic reports of giant pike, caught in nets in Ireland in the late 19th century, of 41–42 kg (90–93 lb), were researched by Fred Buller and published in "The Domesday Book of Mammoth Pike". Neither Britain nor Ireland has managed to produce much in the way of giant pike in the last 50 years and as a result there is substantial doubt surrounding those earlier claims. Currently, the IGFA recognizes a 25 kg (55 lb) pike caught by Lothar Louis in Lake of Grefeern, Germany, on the sixteenth of October in the year 1986 as the all-tackle world record northern pike. Northern pike in North America seldom reach the size of their European counterparts; one of the largest specimens known was a 21 kg (46 lb) specimen from New York state. It was caught in Great Sacandaga Lake on 15 September 1940 by Peter Dubuc. There are reports of far larger pike, but these are either misidentifications of the pike's larger relative the muskellunge, or simply have not been properly documented and belong in the realm of legend.

Northern pike weight length graph.jpg

As northern pike grow longer, they increase in weight. The relationship between length and weight is not linear. The relationship between total length (L, in inches) and total weight (W, in pounds) for nearly all species of fish can be expressed by an equation of the form:

W = cL^b\!\,

Invariably, b is close to 3.0 for all species, and c is a constant that varies among species. For northern pike, b = 3.096 and c = 0.000180.[5]

The relationship described in this section suggests that a 20-inch (510 mm) northern pike will weigh about 2 lb (0.91 kg), while a 26-inch (660 mm) northern pike will weigh about 4 lb (1.8 kg).

Ecology

Habitat

Pike take big prey and are not very particular.

Pike are found in sluggish streams and shallow, weedy places in lakes, as well as in cold, clear, rocky waters. Pike are typical ambush predators; they lie in wait for prey, holding perfectly still for long periods and then exhibit remarkable acceleration as they strike. In short, they will inhabit any water body that contains fish, but suitable places for spawning are essential for their numbers. Because of their cannibalistic nature, young pike need places where they can take shelter between plants so they are not eaten. In both cases it comes down to a rich submersible vegetation nearby. Pikes are seldom found in brackish water, except for the Baltic Sea area. Pike are known to prefer water with less turbidity but that is probably related to their dependence on the presence of submersible vegetation and not to their being a sight hunter.

Reproduction

Prague Vltava fish exhibition

Pike are known to spawn in spring when the water temperature first reaches 9 °C (48 °F).[6] The males are first at the spawning grounds preceding the females for a few weeks. The larger females tend to be earlier than the smaller ones. Mostly a female is followed by several smaller males. When a pair starts slowing down the male will put his tail under the female's body and release it's sperm that is mixed with the eggs due to the tail movement. The spawning consists of a great number of these moves several times a minute and going on for a few hours a day. Every move between 5 and 60 eggs are laid. A female can continue the mating for three days in a row. After the mating the males tend to stay in the area for a few extra weeks.

The color of the sticky eggs is yellow to orange, the diameter is 2.5 to 3 mm. The embryos are 7.5 to 10 mm in length and able to swim after hatching but stay on the bottom for some time. The embryonic stage is 5 to 16 days, dependent on water temperature (at 19°C and 10°C, respectively). Under natural circumstances the survival from free swimming larva to 75 mm pike is around 5 percent. Pike can reach the reproductive stage in a year, females being 30 cm, males 19 cm. Pike normally live 5 to 15 years, but can be as old as 30. Life expectancy and growth are dependent on circumstances. Some Canadian populations have many old slender pikes, Baltic pike grow to great lengths in a short time while eating nutrient rich herring.

Feeding

The young free swimming pike feed on small invertebrates starting with daphnia, and quicky moving on to bigger prey like isopods like asellus or gammarus. When the body length is 4 to 8 cm they start feeding on small fish.

Prague Vltava fish exhibition

The pike have a very typical hunting behavior, they are able to remain stationary in the water, by just moving the last fin rays of the dorsal fins and the breast fins. Before striking they bend their body and dash out to the prey using the large surface of tail fin, dorsal fin and anal fin to propel themselves. The fish has a distinctive habit of catching its prey sideways in the mouth, immobilising it with its sharp backward pointing teeth, and then turning the prey headfirst to swallow it. It eats mainly fish, but on occasion water voles and ducklings have also been known to fall prey to pike. Young pike have been found dead from choking on a pike of a similar size, an observation referred to by the renowned English poet Ted Hughes in his famous poem 'Pike'.[7] Northern pike also feed on frogs, insects and leeches. They are not very particular and eat spiny fish like perch and will even take sticklebacks if that is the only available prey.

The northern pike is a largely solitary predator. It migrates during a spawning season, and it follows prey fish like roach to their deeper winter quarters. Sometimes divers observe groups of similar sized pike that might have some cooperation and it is known to anglers pike tend to start hunting at the same time, so there are some "wolfpack" theories about that. Large pike can be caught on dead immobile fish so it is thought that these pike move about in a rather large territory to find the food to sustain them. Large pike are also known to cruise large water bodies at a few metres depth, probably pursuing schools of prey fish. Smaller pike are more of an ambush predator, probably because of their vulnerability to cannibalism. Pikes are often found near the exit of culverts, which can be attributed to the presence of schools of prey fish and the opportunity for ambush. Being potamodromous, all esocids tend to display limited migration, although some local movement may be of key significance for population dynamics. In the Baltic they are known to follow herring schools, and therefore have some seasonal migration.

Importance to humans

E. lucius caught by an angler in the river Dráva, Hungary

Although generally known as a "sporting" quarry, some anglers release pike they have caught because the flesh is considered bony, especially due to the substantial (epipleural) "Y-bones". Larger fish are more easily filleted, and pike have a long and distinguished history in cuisine and are popular fare in Europe. Historical references to cooking pike go as far back as the Romans. The flesh is white and mild-tasting. Fishing for pike is said to be very exciting with their aggressive hits and aerial acrobatics. Pike are among the largest North American freshwater game fish.

Because of their prolific and predatory nature, laws have been enacted in some places to help stop the spread of northern pike outside of their native range. For instance, in the states of Maine and California, anglers are required, by law, to remove the head from a pike once it has been caught.[8] In Alaska, pike are native north and west of the Alaska Range, but have been illegally introduced to the south central Alaska by game fishermen. In south central Alaska, there is no limit in most areas. Pike are seen as a threat to native wild stocks of salmon by some fishery managers.

Notably in Britain and Ireland, pike are greatly admired as a sporting fish and they are returned alive to the water in order to safeguard future sport and maintain the balance of a fishery. The Pike Anglers Club has campaigned to preserve pike since 1977, arguing that the removal of pike from waters can lead to an explosion of smaller fish and to ensure pike removal stops, which is damaging to both the sport fishery and the environment.[9]

Sport fishing

Fly fishing
BrookTroutAmericanFishes.JPG
targets
bluefish
brook trout
crappie
hucho taimen
largemouth bass
northern pike
peacock bass
shoal bass
smallmouth bass
more fly fish...
other sport fish...

fishing

I N D E X

Pike angling is becoming an increasingly popular pastime in the UK and Europe. Effective methods for catching this hard fighting fish include dead baits, lure fishing, and jerk baiting. They are prized as game fish for their determined fighting and have been food fish since ancient times.

Lake fishing for pike from the shore is especially effective during springtime, at which stage the big pike move into the shallows to spawn in weedy areas, and later many remain there to feed on other spawning coarse fish species to regain their condition after spawning. Smaller jack pike often remain in the shallows for their own protection, and for the small fish food available there. For the hot summer period and during non-active phases the larger female pike tend to retire to deeper water and/or places of better cover. This gives the boat angler good fishing during the summer and winter seasons. Trolling (towing a fairy or bait behind a moving boat) is a popular technique.

The use of float tubes have become a very popular way of fishing for pike on small to medium size stillwaters.[10] Fly fishing for pike is another recently developing way of catching these fish, and the float tube is now recognized as an especially suitable water craft for pike fly-fishing.

In recent decades, more and more pike are released back to the water after catching (catch and release), but they can easily be damaged when handled. Handling those fish with dry hands can easily damage their mucous covered skin and possibly lead to their death from infections.

Since they have very sharp and numerous teeth, care is required in unhooking a pike. It is recommended that barbless trebles are used when angling for this species as it simplifies dehooking. This is undertaken using long forceps, with 30 cm (12 in) artery clamps the ideal tool. When holding the pike from below on the lower jaw, it will open its mouth. The pike should be kept out of the water for the minimum amount of time possible, and should be given extra time to recover if being weighed and photographed before release. If practicing live release, it is recommended to call the fish "caught" when it is alongside a boat. Remove the hook by grabbing it with a pair of needle-nosed pliers while the fish is still submerged and giving it a flip in the direction that turns the hook out of the mouth. This avoids damage to the fish and the stress of being out of water.

In Finland, catching a kymppihauki, a pike weighing at least 10 kilograms (22 lb), is considered the qualification as a master fisherman.

Many countries have banned the use of live fish for bait, but it is also possible to catch the pike with dead fish which they locate with smell. For this technique, often fat sea fish like herring, sardines and mackerel are used. This is a particularly good method for catching really big and well fed pike in the colder season. Compared to other fish like the eel, the pike does not have a good sense of smell, but it is still more than adequate to find the baitfish. Baitfish can be used as ground bait, but also below a float carried by the wind. This method is often used in wintertime and best done in lakes near schools of preyfish or at the deeper parts of shallow water bodies, where pike and preyfish tend to gather in great numbers.

Pike make use of the lateral line system to register low frequency vibrations and follow the vortices produced by the perceived prey, and the whirling movement of the spinner is a good way to create these. Jerkbaits are also really effective and can produce spectacular bites with pike attacking these erratic moving lures at full speed. For trolling, big plugs or softbaits can be used. Spoons with mirror finishes are very effective when the sun is at a sharp angle to the water in the mornings or evenings because they generate the vibrations previously discussed and cause a glint of reflective sunlight that mimics the flash of white-bellied prey. Most fishermen tend to use small lures but often that is not advisable because pike have a preference for large prey. When fishing in shallow water for smaller pike, lighter and smaller lures are frequently used.

Etymology

Brochet Luc Viatour .jpg

The northern pike gets its name from its resemblance to the pole-weapon known as the pike (from the Middle English for pointed). The genus name, Esox, comes from the Greek and Celtic for "big fish" and "salmon" (see Esox: Name). Various other unofficial trivial names are: American pike, common pike, great northern pike, Great Lakes pike, grass pike, slough shark, snake, slimer, slough snake, northern, gators (due a head similar in shape to that of an alligator), jack, jackfish, Sharptooth McGraw, Mr. Toothy and other such names as Long head and Pointy nose. Numerous other names can be found in Field Museum Zool. Leaflet Number 9.

References

  1. ^ Young, Samantha (2007-09-26). "Calif. Aims to Rid Lake of Northern Pike". Associated Press. http://hosted.ap.org/dynamic/stories/P/PIKE_POISONING. Retrieved 2007-09-27. 
  2. ^ http://www.gen.umn.edu/research/fish/fishes/tiger_muskie.html
  3. ^ "tiger muskellunge (Esox lucius x E. masquinongy) - FactSheet". Nas.er.usgs.gov. http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=677. Retrieved 2011-03-02. 
  4. ^ Craig, John F. ed. Pike: Biology and Exploitation. Chapman & Hall, London. 1996 pp. 1
  5. ^ R. O. Anderson and R. M. Neumann, Length, Weight, and Associated Structural Indices, in Fisheries Techniques, second edition, B. E. Murphy and D. W. Willis, eds., American Fisheries Society, 1996.
  6. ^ "pikezander.co.uk". http://www.pikezander.co.uk/pike.htm. 
  7. ^ Pike by Ted Hughes. Poem text and audio: Hughes talks about his poem then reads it aloud. PoetryArchive.org. Retrieved 2010-08-13.
  8. ^ [1]
  9. ^ "What the PAC is All About". Pacgb.co.uk. http://www.pacgb.co.uk/aboutpac/intro.html. Retrieved 2011-03-02. 
  10. ^ [2][dead link]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: May hybridize with other esocids (e.g., where pike introduced).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!