Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The northern pike (Esox lucius), known simply as a pike in Britain, Ireland, and the USA, or as jackfish in Canada), is a popular sporting and food fish that inhabits freshwaters around the northern hemisphere, and are found in brackish waters of the Baltic Sea. Northern pike in Europe can grow up to about 25 kg and 150 cm long; females are generally larger than males. They become sexually mature at 3-4 years of age, and live between 10-12 years. Solitary and territorial, these fish ambush predators. As young fish they feed on small invertebrates, and as they grow older their broad diet grows to include amphibians and fish of all sorts (including their own kind), and even small mammals and birds. Pike has been used to stock waterways (often illegally) in many areas, and has impacted native fish populations and fish communities in negative ways. In Alaska, Colorado, Montana and Maine, E. lucius have been documented as threatening stickleback and native salmonids. The northern pike can hybridize with the closely related muskellunge E. masquinongy, and in some areas E. lucius threaten native muskellunge populations.

( Department of Natural Resources; Fuller 2012; Wikipedia 2012)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Pike spawn from the end of March to the beginning of May, usually in quite shallow water and often using the same places year after year. The spawning process can last several weeks and the number of eggs varies with the age and size of the female. A large fish may produce as many as half a million eggs. The eggs are sticky and adhere to plants, the young pike hatching after 10 – 15 days. At this stage they have no proper mouthparts and remain attached to the plants until the yoke sac is consumed. Once the young fish become free-swimming, they feed mainly on small organisms, but once they reach a length of 5 cm, they begin preying on other fish larvae and tadpoles. Once they have survived these early stages, pike grow fast, sometimes reaching a weight of one kilogram in the space of three years. Males mature at the age of two, females at four years. Pike catch their food largely by stealth and lightning-fast acceleration, taking their prey unawares. A large adult pike will eat roach, rudd, dace and perch, trout and salmon, and even other members of their own species. They will also take frogs, newts, crayfish and they have been known to catch ducklings and small mammals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

An adult female pike can grow to more than 1.40 meters long. Males 'only' grow up to 85 centimeters. The pike is a true predator fish. It used to be assumed that it hunts particularly by sight however that is not true. It tracks its prey primarily using its side-line system, a separate nervous system appearing as a line along its flanks. It lies dead still in the water and snaps at prey that happens to pass by. The greatest enemy of young pike (pickerel) is its own larger species. Therefore, pickerels hide among underwater growth until they are large enough not to be eaten by other pike.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The pike is probably the coarse anglers' most sought-after fish. It is predatory both in nature and appearance. The fish has a flat, broad, almost duck-like snout and an elongated, streamlined body with dorsal and anal fins placed well back. The colour of the fish varies with its habitat, those living in weeded waters being predominantly mottled green and yellow. Fish from brackish waters are more yellowish. Pike turn darker with age, old specimens becoming brown or even greyish. Pike are the subject of innumerable fishy stories, with many telling of 'the one that got away'. Establishing the weight of the largest pike on record in the UK is almost as tricky as catching the actual fish might have been. According to the Pike Angler's Club of Great Britain, the record goes to one caught on a rod and line in Llandegfedd Reservoir, Wales, in 1992. That fish weighed 46lb 13oz (21.3 kg). However, there is also a Scottish record dating back to 1945 which refers to a fish caught in Loch Lomond that weighed 47lb 11oz (21.6 kg).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Esox lucius ZBK Linnaeus, 1758

Inland water: 30700-650 (1 spc.), 1974 , Bueyuekcekmece Lagoon , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers (Ref. 5723). Usually solitary and highly territorial. Enters brackish water in the Baltic. Adults feed mainly on fishes, but at times feed heavily on frogs and crayfish (Ref. 27547). Cannibalism is common. In arctic lakes, it is sometimes the only species present in a given water body. In such cases, juveniles feed on invertebrates and terrestrial vertebrates; large individuals are mainly cannibals (Ref. 59043). Cannibalistic as juveniles (Ref. 30578). Feces of pike are avoided by other fish because they contain alarm pheromones. Deposits feces at specific locations, distant from its foraging area (Ref. 59043). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Does not generally undertake long migrations, but a few may move considerable distances (Ref. 27547). Oviparous (Ref. 205). This fish can be heavily infested with parasites, including the broad tapeworm which, if not killed by thorough cooking, can infect human; is used as an intermediate host by a cestode parasite which results to large losses in usable catches of lake whitefish (Coregonus clupeaformis) in some areas; also suffers from a trematode which causes unsightly cysts on the skin (Ref. 9988). Excellent food fish; utilized fresh and frozen; eaten pan-fried, broiled, and baked (Ref. 9988). Valuable game fish (Ref. 5723). In spite of numerous attempts to culture this species, it was never entirely domesticated and does not accept artificial food (Ref. 30578). Locally impacted by habitat alterations (Ref. 59043).
  • Crossman, E.J. 1996 Taxonomy and distribution. p. 1-11. In J.F. Craig (ed.) Pike biology and exploration. Chapman and Hall, London. 298 p. (Ref. 26373)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The range of the pike encompasses many northern latitude countries, including: the USA (north of the prairies), southern Canada, the UK and most of Europe (except Iberia), western Scandinavia, the Baltic States, Russia south to the Caspian Sea and eastwards through southern Siberia to the Baring Straits.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Esox lucius are native to North America and Eurasia. They are found from Labrador west to Alaska, south to Pennsylvannia, Missouri and Nebraska. In Europe they are found throughout northern and western Europe, south throughout Spain and east to Siberia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range is Holarctic and includes the Atlantic, Arctic, Pacific, Great Lakes, and Mississippi River basins from Alaska to Labrador, south to Pennsylvania, Missouri, and Nebraska (Page and Burr 2011). This species has been introduced in many areas southward of the native range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range is Holarctic and includes the Atlantic, Arctic, Pacific, Great Lakes, and Mississippi River basins from Alaska to Labrador, south to Pennsylvania, Missouri, and Nebraska (Page and Burr 2011). This species has been introduced in many areas southward of the native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Esox lucius are native to North America and Eurasia. They are found from Labrador west to Alaska, south to Pennsylvannia, Missouri and Nebraska. In Europe they are found throughout northern and western Europe and south throughout Spain and east to Siberia.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar in fresh water. North America: Atlantic, Arctic, Pacific, Great Lakes and Mississippi River basins from Labrador to Alaska and south to Pennsylvania, Missouri and Nebraska, USA (Ref. 5723). Eurasia: Caspian, Black, Baltic, White, Barents, Arctic, North and Aral Seas and Atlantic basins, southwest to Adour drainage; Mediterranean basin in Rhône drainage and northern Italy. Widely distributed in central Asia and Siberia easward to Anadyr drainage (Bering Sea basin). Historically absent from Iberian Peninsula, Mediterranean France, central Italy, southern and western Greece, eastern Adriatic basin, Iceland, western Norway and northern Scotland. Widely introduced and translocated throughout Europe (Ref. 59043). Several countries report adverse ecological impact after introduction (Ref. 1739).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar in Northern Hemisphere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Northern pike average 46-51 cm (18-20 inches) in length. They can be identified by their single dorsal fin and light-colored spots along their dark body. They are also recognized by scales that cover their entire cheek and the upper half of their gill covers. Their close relative, the muskellunge (Esox masquinongy), have scales covering only the upper half of their cheek and gill covers. The sides of E. lucius vary from dark shades of green to olive green to brown, with 7 to 9 rows of yellowish, bean-shaped spots. The underside is white to cream-colored.

Range mass: 0.5 to 1.4 kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Northern pike average 46 to 51 cm (18-20 inches) in length. They can be identified by their single dorsal fin and light-colored spots along their dark body. They are also recognized by scales that cover their entire cheek and the upper half of their gill covers. The sides of Esox lucius vary from dark shades of green to olive green to brown, with 7 to 9 rows of yellowish, bean-shaped spots. The underside is white to cream-colored.

Range mass: 0.5 to 1.4 kg.

Range length: 46 to 51 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal soft rays (total): 17 - 25; Analsoft rays: 10 - 22; Vertebrae: 57 - 65
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 133 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

137 cm FL (male/unsexed; (Ref. 40637)); 150 cm TL (female); max. published weight: 28.4 kg (Ref. 40637); max. published weight: 35 kg; max. reported age: 30 years (Ref. 556)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosed from all other freshwater fishes in Europe by the combination of the following characters: long snout; large mouth; dorsal fin origin slightly in front of anal origin; and lateral line with 105-148 scales (Ref. 59043). Distinguished by its long, flat, 'duck-bill' snout; its large mouth with many large, sharp teeth; and the rearward position of its dorsal and anal fins (Ref. 27547). Gill rakers present only as patches of sharp teeth on gill arches; lateral line notched posteriorly (Ref. 27547). Dorsal located far to the rear; anal located under and arising a little behind dorsal; pectorals low on body, base under opercle; pelvic fins low on body; paired fins rounded, paddle-shaped (Ref. 27547). Caudal fin with 19 rays (Ref. 2196).
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Esox lucius are found in almost every type of freshwater, from cold deep lakes, to warm shallow ponds, to muddy rivers. Having a broad range of tolerances for water temperature, clarity and oxygen content allows E. lucius to be "one of the most adaptable freshwater species" (Steinberg, 1992, pg. 20).

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This fish usually occurs in clear small lakes, shallow vegetated areas of larger lakes, marshes, creeks, and small to large rivers. It moves to deeper cooler water in summer. Spawning occurs in shallow flooded marshes associated with lakes, inlet streams to those lakes (or flooded terrestrial vegetation at reservoir edge), or rivers; spawning habitat is basically a flooded area with emergent vegetation (optimally over short grasses or sedges). Young remain in spawning habitat for several weeks after hatching.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This fish usually occurs in clear small lakes, shallow vegetated areas of larger lakes, marshes, creeks, and small to large rivers. It moves to deeper cooler water in summer. Spawning occurs in shallow flooded marshes associated with lakes, inlet streams to those lakes (or flooded terrestrial vegetation at reservoir edge), or rivers; spawning habitat is basically a flooded area with emergent vegetation (optimally over short grasses or sedges). Young remain in spawning habitat for several weeks after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Esox lucius are found in almost every type of freshwater, from cold deep lakes, to warm shallow ponds, to muddy rivers. Because they have a broad range of tolerances for water temperature, clarity and oxygen content they are an especially adaptable species of freshwater fish.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous; freshwater; brackish; depth range 0 - 30 m (Ref. 1998), usually 1 - 5 m (Ref. 1998)
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2801 specimens in 1 taxon.
Water temperature and chemistry ranges based on 237 samples.

Environmental ranges
  Depth range (m): 0 - 64
  Temperature range (°C): 3.141 - 7.898
  Nitrate (umol/L): 1.212 - 5.208
  Salinity (PPS): 5.681 - 8.865
  Oxygen (ml/l): 3.529 - 8.684
  Phosphate (umol/l): 0.114 - 1.557
  Silicate (umol/l): 12.053 - 35.741

Graphical representation

Depth range (m): 0 - 64

Temperature range (°C): 3.141 - 7.898

Nitrate (umol/L): 1.212 - 5.208

Salinity (PPS): 5.681 - 8.865

Oxygen (ml/l): 3.529 - 8.684

Phosphate (umol/l): 0.114 - 1.557

Silicate (umol/l): 12.053 - 35.741
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: demersal. Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers. Usually solitary. Highly territorial predator. Enters brackish water in the Baltic. After the yolk is absorbed, young feed on large zooplankton and immature aquatic insects for about 7-10 days; fish then becomes the major part of the diet (Ref. 1998). Adults occasionally feed on frogs, crayfish and other vertebrates (Ref. 1998). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Adults are preyed upon bears, dogs, eagles, and osprey during the spawning run (Ref. 1998). Valuable game fish. This fish can be heavily infested with parasites, including the broad tapeworm which, if not killed by thorough cooking, can infect human; is used as an intermediate host by a cestode parasite which results to large losses in usable catches of lake whitefish (@Coregonus clupeaformis@) in some areas; also suffers from a trematode which causes unsightly cysts on the skin (Ref. 9988). Excellent food fish; utilized fresh and frozen; eaten pan-fried, broiled, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pike can be found in many water bodies provided there is plenty of oxygen and a neutral or alkaline pH. They occur in lakes with plenty of vegetation, rivers and creeks. They occasionally venture into brackish water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate between spawning and nonspawning habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Esox lucius are a carnivorous fish. Equipped with sharp teeth and very complex skull and jaw structures they are predators of smaller fish, frogs, crayfish, small mammals and birds.

Animal Foods: birds; mammals; amphibians; fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in clear vegetated lakes, quiet pools and backwaters of creeks and small to large rivers (Ref. 5723, 10294). Usually solitary and highly territorial. Enters brackish water in the Baltic. Adult feeds mainly on fishes, but at times feeds heavily on frogs and crayfish (Ref. 27547). Cannibalistic as juveniles (Ref. 30578). Eggs and young are preyed upon by fishes, aquatic insect larvae, birds, and aquatic mammals (Ref. 1998). Does not generally undertake long migrations, but a few may move considerable distances (Ref. 27547).
  • Schwalme, K. 1992 A quantitative comparison between diet and body fatty acid composition in wild northern pike (Esox lucius L.). Fish Physiol. Biochem. 10(2):91-98.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Young initially eat large zooplankton and immature aquatic insects. After 7-10 days fishes begin to enter diet and eventually dominate. Adults feed opportunistically on vertebrates small enough to be engulfed. (Scott and Crossman 1973). Sight feeder.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Esox lucius are carnivorous fish. Because they are equipped with sharp teeth and very complex skull and jaw structures, they are able to feed on smaller Actinopterygii, Anura, Cambaridae, small Mammalia and Aves.

Animal Foods: birds; mammals; amphibians; fish; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Northern pike are important as top predators in the aquatic systems where they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern pike are top predators in the systems they inhabit. However, the eggs, fry, and young of northern pike may be eaten by other predatory fish, aquatic birds, otters, or by the larvae of aquatic insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Esox lucius

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises skin of Esox lucius

Animal / parasite / endoparasite
Cryptobia gurneyorum endoparasitises blood of Esox lucius

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Esox lucius

Animal / parasite / ectoparasite / blood sucker
Piscicola geometra sucks the blood of Esox lucius

Animal / parasite / ectoparasite
fluke of Tetraonchus monenteron ectoparasitises gill of Esox lucius

Animal / parasite / endoparasite
Trypanosoma remaki endoparasitises blood of Esox lucius
Other: sole host/prey

Animal / parasite / endoparasite
metacaria of Tylodelphys clavata endoparasitises eye (humour) of Esox lucius

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Esox lucius preys on:
Osmerus eperlanus mordax
Cyprinus carpio
Pimephales notatus
Stizostedion vitreum
Larus californicus

Based on studies in:
Quebec (Lake or pond, Pelagic)

This list may not be complete but is based on published studies.
  • A. Baril, Effect of the water mite Piona constricta on planktonic community structure, M.Sc. Thesis, University of Ottawa, Canada (1983).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Pike Fry Rhabdovirus. Viral diseases
  • Fijan, N. 1999 Spring viraemia of carp and other viral diseases and agents of warm-water fish. p.177-244. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48847)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adults solitary except at spawning. Evidence from New England indicates that landlocked populations of Atlantic salmon may be negatively influenced as abundance of northern pike and/or ESOX hybrids increases.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Feeds diurnally. Active and feeds in winter under ice.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawners move inshore or upstream to the marsh areas to spawn (Ref. 27547). Generally, spawning occurs during the day. The sexes pair and a larger female is usually attended by one or two smaller males. They swim through and over the vegetation in water usually less than 17.8 cm, releasing eggs and sperm simultaneously at irregular intervals (Ref. 1998). Eggs are deposited in flooded areas and on submerged vegetation over a period of 2-5 days (Ref. 59043). Only 5 to 60 eggs ae released at a time (Ref. 27547). This act is repeated every few minutes for up to several hours, after which the fish rest for some time before resuming. During the resting period, both male and female may take new mates, or they may continue together for several days until all eggs are extruded. Spawned-out adults may stay on the spawning grounds for as long as 14 weeks, but most leave within 6 (Ref. 27547).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: captivity:
6.8 years.

Average lifespan

Status: wild:
24.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Northern pike can live up to 12 years.

Typical lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: captivity:
10.0 years.

Average lifespan

Status: captivity:
6.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Northern pike are considered random spawners not nest builders. Spawning occurs in the shallows when the water temperature reaches 4-7 degress Celsius (40-45 degrees Fahrenheit). Spawning lasts for 5 to 10 days after which the female leaves. Males remain in the spawning area for several weeks, but do not protect the eggs. At this stage the eggs are vulnerable to predators. The eggs that do survive hatch in about 2 weeks. With their insatiable eating habits young E. lucius grow rapidly in both length and weight. Males become sexually mature at 2-3 years-old and females at 3-4 years-old.

Breeding season: Spawning occurs in the spring.

Average gestation period: 2 weeks.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
889 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1116 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in spring as soon as ice begins to break up. Produces a single clutch per year. Eggs hatch in 12-14 days at typically prevailing temperatures. Males sexually mature at 1-2 years in south, at age 5 in north; females mature at 2-3 years in south, at age 6 in north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern pike are considered random spawners not nest builders.

Mating System: polygynandrous (promiscuous)

Spawning occurs in the shallows when the water temperature reaches 4 to 7 degress Celsius (40-45 degrees Fahrenheit). Spawning lasts for 5 to 10 days after which the female leaves. Males remain in the spawning area for several weeks, but do not protect the eggs. At this stage the eggs are vulnerable to predators. The eggs that survive hatch in about 2 weeks. With their insatiable eating habits young Esox lucius grow rapidly in both length and weight. Males become sexually mature at 2 to 3 years-old and females at 3 to 4 years-old.

Breeding season: Spawning occurs in the spring.

Average time to hatching: 2 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Spawning lasts for 5 to 10 days after which the female leaves. Males remain in the spawning area for several weeks, but do not protect the eggs.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Esox lucius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCTACTAACCACAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACAGCCTTAAGCCTTTTAATCCGGGCCGAACTAAGCCAGCCAGGGGCTCTCTTAGGTGAC---GACCAGATTTATAATGTTATCGTTACAGCCCATGCCTTTGTTATAATCTTTTTTATAGTTATACCCGTTATAATTGGGGGTTTTGGAAACTGATTAATTCCCCTAATGATTGGTGCCCCCGACATGGCCTTCCCCCGCATAAATAATATAAGCTTCTGACTTCTCCCCCCCTCCTTTTTACTTCTCTTAGCCTCCTCAGGTGTTGAAGCTGGTGCTGGTACTGGCTGAACAGTTTATCCGCCTTTGGCCGGAAACTTAGCACACGCAGGTGCTTCTGTAGACTTAACTATTTTCTCTCTCCACCTGGCCGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACCACAATTATTAACATAAAACCCCCCGCCATCTCACAATATCAGACACCATTATTTGTTTGAGCAGTCCTGATTACAGCTGTACTTCTACTTCTATCTCTCCCAGTCCTAGCCGCTGGAATTACCATATTGCTCACAGACCGAAATTTAAACACCACATTCTTTGACCCCGCTGGTGGTGGAGACCCTATTCTATACCAACACCTCTTCTGATTCTTCGGACACCCGGAAGTCTACATTCTTATTCTACCAGGATTTGGTATAATCTCTCACATTGTAGCTTATTATTCTGGTAAAAAAGAACCATTCGGCTACATAGGCATAGTATGAGCAATAATGGCCATTGGTCTCCTTGGCTTTATTGTCTGAGCCCACCATATGTTTACTGTGGGAATAGATGTAGACACTCGCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Esox lucius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 78
Specimens with Barcodes: 119
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Esox lucius is not currently threatened by extinction. The Departments of Natural Resources in states where they occur keep a close watch on population levels and can augment populations by stocking streams with Esox lucius raised in hatcheries.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s
Freyhof, J. & Kottelat, M.

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.

History
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Esox lucius is not currently threatened by extinction. The Departments of Natural Resources in states where they occur keep a close watch on population levels and can increase populations by stocking streams with Esox lucius raised in hatcheries.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although pike need water high in oxygen and of low acidity, there does not appear to be any threats to population numbers in the UK. However, it is thought that over-fishing may be taking place in some other European countries (1999 figures).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Pike are a much-prized game fish and, in the UK, can be pursued by anglers throughout the season (16 June – 14 March), provided they hold a rod licence. There are no specific conservation measures currently in place for pike apart from general laws governing pollution of rivers and water bodies. Pike have been introduced into several countries' rivers to provide sport, and in some cases the fish have cause adverse ecological problems. Deliberately introducing pike to ponds in order to remove unwanted fish is a frequent practice in some areas and has to be monitored carefully.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no negative effects of northern pike on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Esox lucius is a prized game fish throughout its range and is a commercial food fish in eastern Europe.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Highly prized game fish. Extensively cultured in Europe. (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative effects of northern pike on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Esox lucius are prized game fish throughout their range and are a commercial food fish in eastern Europe.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
  • FAO 1997 Aquaculture production statistics 1986-1995. FAO Fish. Circ. 815, Rev. 9. 195 p.
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Where introduced, this fish can be a threat to native fish species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern pike

This article is about the fish. For the Canadian band, see The Northern Pikes.

The northern pike (Esox lucius), known simply as a pike in Britain, Ireland, most of Canada, and most parts of the USA, (also called jackfish or simply "northern" in the Upper Midwest of the USA and in Manitoba, Canada), is a species of carnivorous fish of the genus Esox (the pikes). They are typical of brackish and fresh waters of the Northern Hemisphere (i.e. holarctic in distribution). Pike grow to a relatively large size: the average length is about 70–120 cm (28–47 in). Even so, lengths of up to 150 cm (59 in) and weights of 25 kg (55 lb) are very rare. The heaviest specimen known so far was caught in 1983 at an abandoned stone quarry in Germany, where the species is called Hecht. This specimen was 147 cm (58 in) long and weighed 31 kg (68 lb). The longest pike ever recorded and confirmed was 152 cm (60 in) long and weighed 28 kg (62 lb). A pike of 60.5 in (154 cm) was caught and released in May 2004 in Apisko Lake, Manitoba. Historic reports of giant pike, caught in nets in Ireland in the late 19th century, of 41–42 kg (90–93 lb) with a length of 173–175 cm (67–68 in), were researched by Fred Buller and published in The Domesday Book of Mammoth Pike. Neither Britain nor Ireland has managed to produce much in the way of giant pike in the last 50 years, so substantial doubt exists surrounding those earlier claims. Currently, the IGFA recognizes a 25-kg pike caught by Lothar Louis in Lake of Grefeern, Germany, on 16 October 1986, as the all-tackle world-record northern pike.

Etymology[edit]

Northern pike in the Aquarium Dubuisson (fr)
Esox lucius skull

The northern pike gets its name from its resemblance to the pole-weapon known as the pike (from the Middle English for pointed). The genus name, Esox, comes from the Greek and Celtic for "big fish" and "salmon" (see Esox: Name). Various other unofficial trivial names are: American pike, common pike, great northern pike, Great Lakes pike, grass pike, snot rocket, slough shark, snake, slimer, slough snake, northern, gator (due a head similar in shape to that of an alligator), jack, jackfish, Sharptooth McGraw, Mr. Toothy, and other such names as long head and pointy nose. Numerous other names can be found in Field Museum Zool. Leaflet Number 9.

Description[edit]

Northern pike in public aquarium in Kotka, Finland
Northern pike in the Straussee at Strausberg

Northern pike are most often olive green, shading from yellow to white along the belly. The flank is marked with short, light bar-like spots and a few to many dark spots on the fins. Sometimes, the fins are reddish. Younger pike have yellow stripes along a green body; later, the stripes divide into light spots and the body turns from green to olive green. The lower half of the gill cover lacks scales and it has large sensory pores on its head and on the underside of its lower jaw which are part of the lateral line system. Unlike the similar-looking and closely related muskellunge, the northern pike has light markings on a dark body background and fewer than six sensory pores on the underside of each side of the lower jaw.

Drawing of northern pike

A hybrid between northern pike and muskellunge is known as a tiger muskellunge (Esox masquinongy × lucius or Esox lucius × masquinongy,[1] depending on the sex of each of the contributing species). In the hybrids, the males are invariably sterile, while females are often fertile, and may back-cross with the parent species.[2] Another form of northern pike, the silver pike, is not a subspecies but rather a mutation that occurs in scattered populations. Silver pike, sometimes called silver muskellunge, lack the rows of spots and appear silver, white, or silvery-blue in color.[3] When ill, silver pike have been known to display a somewhat purplish hue; long illness is also the most common cause of male sterility.

In Italy, the newly identified species Esox cisalpinus ("southern pike") was long thought to be a color variation of the northern pike, but was in 2011 announced to be a species of its own.[4]

Length and weight[edit]

Northern pike in North America seldom reach the size of their European counterparts; one of the largest specimens known was a 21-kg specimen from New York. It was caught in Great Sacandaga Lake on 15 September 1940 by Peter Dubuc. Reports of far larger pike have been made, but these are either misidentifications of the pike's larger relative, the muskellunge, or simply have not been properly documented and belong in the realm of legend.

Northern pike weight length graph.jpg

As northern pike grow longer, they increase in weight, and the relationship between length and weight is not linear. The relationship between total length (L, in inches) and total weight (W, in pounds) for nearly all species of fish can be expressed by an equation of the form:

W = cL^b\!\,

Invariably, b is close to 3.0 for all species, and c is a constant that varies among species. For northern pike, b = 3.096 and c = 0.000180. (c=7.089 enables one to put in length in meters and weight in kg)[5] The relationship described in this section suggests a 20-in northern pike will weigh about 2 lb (0.91 kg), while a 26-in northern pike will weigh about 4 lb (1.8 kg).

Behavior[edit]

Aggressiveness[edit]

The northern pike is a relatively aggressive species, especially with regards to feeding. For example, when food sources are sparse, cannibalism develops, starting around five weeks in a small percentage of populations.[6] This cannibalism occurs when the ratio of predator to prey is two to one.[6] One can expect this because when food is scarce, Northern pike fight for survival, such as turning on smaller pike to feed; this is seen in other species such as tiger salamanders. Usually, pike tend to feed on smaller fish, such as the banded killifish. However, when pike exceed 700 mm long, they feed on larger fish.[7] As one can probably assume, these pike are the ones most likely to develop cannibalistic traits.

Because of cannibalism when food is short, pike suffer a fairly high young mortality rate.[8] Cannibalism is more prevalent in cool summers as the upcoming pike have slow growth rates in that season and might not be able to reach a size to deter the larger pike. Cannibalism is likely to arise in low growth and low food conditions.[8] Pike do not discriminate siblings well, so cannibalism between siblings is likely.

Aggressiveness also arises from a need of space.[9] Young pike tend to have their food robbed by larger pike.[9] Pike are aggressive if not given enough space because they are territorial.[10] They use a form of foraging known as sit-and-wait. Unlike species such as perch, pike undergo bursts of energy instead of actively chasing down prey. As such, a fair amount of inactive time occurs until they find prey. Hunting efficiency decreases with competition;[10] the larger the pike, the larger the area controlled by that particular pike. An inverse relation to vegetation density and pike size exists, which is due to the possibility of cannibalism from the largest pike.[11] This makes sense, as the smaller pike need more vegetation to avoid being eaten. Large pike do not have this worry and can afford the luxury of a large line of sight. They prefer a tree structure habitat.[11]

Physical behavioral traits[edit]

Pike are capable of "fast start" movements, which are sudden high-energy bursts of unsteady swimming.[12] Many other fish exhibit this movement, as well. Most fish use this mechanism to avoid life-threatening situations. For the pike, however, it is a tool used to capture prey from their sedentary positions. They flash out in such bursts and capture their prey. These fast starts terminate when the pike has reached terminal velocity.[12] During such motions, pike make S conformations while swimming at high rates. To decelerate, they, simply make a C conformation, exponentially slowing down their speed so that they can "stop".[12] An interesting behavioral trait that pike have is that they have short digestion times and long feeding periods.[7] They can undergo many of these fast bursts to collect as much prey as they can. Pike are least active during the night.[10]

Reproduction/habitat[edit]

Pike have a strong homing behavior;[11] they inhabit certain areas by nature. During the summer, they tend to group closer to vegetation than during the winter.[13] The exact reason is not clear, but likely is a result of foraging or possibly reproductive needs to safeguard young. Pike diel rhythm changes significantly over the year.[14] On sunny days, pike stay closer to the shallow shore. On windy days, they are further from shore.[15] When close the shore, pike have a preference for shallow, vegetated areas.[15] Pike are more stationary in reservoirs than lakes.[16] A possibility is that lakes have more prey to feed upon, or possibly in reservoirs prey will ultimately cross paths with the pike. As such, this could be a form of energy conservation. Pike breed in the spring.[9] They also mature in around two years before they are physically capable of breeding. Pike also have a tendency to lay a large number of eggs.[9] A likely explanation for such actions are to produce as many surviving offspring as possible as many most likely die early in life. In females, the gonads enlarge when it is time to shed her eggs.[9] However, after they are shed, these eggs will not hatch if the water is below 6 °C.[9] Male pike arrive to the breeding grounds before females do. In addition, the males stay after the spawning is finished.[9] Male parental care in fish is not uncommon, so such behavior is to be expected. Parental stock is vital for pike success.[17] In addition, mortality rates do indeed change from high to low with more eggs, a tenfold difference.[17] Such behavior has been developed through evolutionary trials.[citation needed] For breeding, the more stable the water, the greater the fitness of the pike.[18] Mortality results from toxic concentrations of iron or rapid temperature changes,[18] and adult abundance and the strength of the resulting year classes are not related. It is based upon two points of development: one during embryo stage between fertilization and closure of the blastophore and the second is between hatching and the termination of the alevin stage.[18]

Ecology[edit]

Habitat[edit]

Pike take big prey and are not very particular.

Pike are found in sluggish streams and shallow, weedy places in lakes, as well as in cold, clear, rocky waters. They are typical ambush predators; they lie in wait for prey, holding perfectly still for long periods, and then exhibit remarkable acceleration as they strike. In short, they inhabit any water body that contains fish, but suitable places for spawning are essential for their numbers. Because of their cannibalistic nature, young pike need places where they can take shelter between plants so they are not eaten. In both cases, rich submerged vegetation is needed. Pike are seldom found in brackish water, except for the Baltic Sea area. They seem to prefer water with less turbidity, but that is probably related to their dependence on the presence of vegetation and not to their being sight hunters.

Reproduction[edit]

Pike are known to spawn in spring when the water temperature first reaches 9 °C (48 °F).[19] The males arrive first at the spawning grounds, preceding the females by a few weeks. The larger females tend to arrive earlier than the smaller ones. A female may be followed by several smaller males. When a pair starts slowing down, the male puts his tail under the female's body and releases his sperm, that is then mixed with the eggs by tail movement. The spawning consists of a great number of these moves several times a minute and going on for a few hours a day. Every move, between five and 60 eggs are laid. A female can continue the mating for three days in a row. After the mating, the males tend to stay in the area for a few extra weeks.

The color of the sticky eggs is yellow to orange; the diameter is 2.5 to 3 mm. The embryos are 7.5 to 10 mm in length and able to swim after hatching, but stay on the bottom for some time. The embryonic stage is five to 16 days, dependent on water temperature (at 19 °C and 10 °C, respectively). Under natural circumstances, the survival from free-swimming larva to 75-mm pike is around 5%. Pike can reach the reproductive stage in a year, females being 30 cm, males 19 cm. Pike normally live five to 15 years, but can be as old as 30. Life expectancy and growth are dependent on circumstances.

Feeding[edit]

Prague Vltava fish exhibition

The young free-swimming pike feed on small invertebrates starting with daphnia, and quickly moving on to bigger prey, such as the isopods asellus or gammarus. When the body length is 4 to 8 cm. they start feeding on small fish.

A pike has a very typical hunting behavior; it is able to remain stationary in the water by moving the last fin rays of the dorsal fins and the pectoral fins. Before striking, it bends its body and darts out to the prey using the large surface of its cordal fin, dorsal fin, and anal fin to propel itself. The fish has a distinctive habit of catching its prey sideways in the mouth, immobilising it with its sharp, backward-pointing teeth, and then turning the prey headfirst to swallow it. It eats mainly fish, frog, but also small mammals and birds fall prey to pike. Young pike have been found dead from choking on a pike of a similar size, an observation referred to by the renowned English poet Ted Hughes in his famous poem "Pike".[20] Northern pike also feed on frogs, insects, and leeches. They are not very particular and eat spiny fish like perch, and will even take sticklebacks if they are the only available prey.

The northern pike is a largely solitary predator. It migrates during a spawning season, and it follows prey fish like common roaches to their deeper winter quarters. Sometimes, divers observe groups of similar-sized pike that cooperate some to start hunting at the same time, so "wolfpack" theories are given. Large pike can be caught on dead immobile fish so these pike are thought to move about in a rather large territory to find food. Large pike are also known to cruise large water bodies at a few metres deep, probably pursuing schools of prey fish. Smaller pike are more of ambush predators, probably because of their vulnerability to cannibalism. Pike are often found near the exit of culverts, which can be attributed to the presence of schools of prey fish and the opportunity for ambush. Being potamodromous, all esocids tend to display limited migration, although some local movement may be of key significance for population dynamics. In the Baltic, they are known to follow herring schools, so have some seasonal migration.

Importance to humans[edit]

E. lucius caught by an angler in the river Dráva, Hungary

Although generally known as a "sporting" quarry, some anglers release pike they have caught because the flesh is considered bony, especially due to the substantial (epipleural) "Y-bones". Larger fish are more easily filleted, and pike have a long and distinguished history in cuisine and are popular fare in Europe. Historical references to cooking pike go as far back as the Romans. The flesh is white and mild-tasting. Fishing for pike is said to be very exciting with their aggressive hits and aerial acrobatics. Pike are among the largest North American freshwater game fish.

Because of their prolific and predatory nature, laws have been enacted in some places to help stop the spread of northern pike outside of their native range. For instance, Maine and California, anglers are required by law to remove the head from a pike once it has been caught.[21] In Alaska, pike are native north and west of the Alaska Range, but have been illegally introduced to the south-central Alaska by game fishermen. In south-central Alaska, no limit is imposed in most areas. Pike are seen as a threat to native wild stocks of salmon by some fishery managers.

Notably in Britain and Ireland, pike are greatly admired as a sporting fish and they are returned alive to the water to safeguard future sport and maintain the balance of a fishery. The Pike Anglers Club has campaigned to preserve pike since 1977, arguing that the removal of pike from waters can lead to an explosion of smaller fish, and to ensure pike removal stops, which is damaging to both the sport fishery and the environment.[22]

Geographic distribution[edit]

Esox lucius is found in fresh water throughout the Northern Hemisphere, including Russia, Europe, and North America. It has also been introduced to lakes in Morocco, and is even found in brackish water of the Baltic Sea, but they are confined to the low-salinity water at the surface of the sea, and are seldom seen in brackish water elsewhere.[citation needed]

Within North America, northern pike populations are found in Illinois, North Dakota, South Dakota, Minnesota, Michigan, Montana, Maryland, West Virginia, Wisconsin, Indiana, Connecticut, Rhode Island, New Hampshire, Maine, New Jersey, Massachusetts, Vermont, Iowa, Utah, Texas, northern New Mexico and Arizona, Colorado, New York, Idaho, Alberta, Saskatchewan, Manitoba, Ontario and Québec (pike are rare in British Columbia and east coast provinces), Alaska, the Ohio Valley, the upper Mississippi River and its tributaries, the Great Lakes Basin and surrounding states, Missouri, Kansas, Nebraska, Colorado, and Oklahoma. They are also stocked in, or have been introduced to, some western lakes and reservoirs for sport fishing, although some fisheries managers believe this practice often threatens other species of fish such as bass, trout, and salmon, causing government agencies to attempt to exterminate the pike by poisoning lakes.[23]

Sport fishing[edit]

Northern pike caught with a fishing lure in Belgium
Fly fishing
BrookTroutAmericanFishes.JPG
targets
bluefish
brook trout
crappie
hucho taimen
largemouth bass
northern pike
peacock bass
shoal bass
smallmouth bass
more fly fish...
other sport fish...

fishing

I N D E X

Pike angling is becoming an increasingly popular pastime in the UK and Europe. Effective methods for catching this hard-fighting fish include dead baits, lure fishing, and jerk baiting. They are prized as game fish for their determined fighting.

Lake fishing for pike from the shore is especially effective during spring, when the big pike move into the shallows to spawn in weedy areas, and later many remain there to feed on other spawning coarse fish species to regain their condition after spawning. Smaller jack pike often remain in the shallows for their own protection, and for the small fish food available there. For the hot summer and during inactive phases, the larger female pike tend to retire to deeper water and/or places with better cover. This gives the boat angler good fishing during the summer and winter seasons. Trolling (towing a fairy or bait behind a moving boat) is a popular technique.

The use of float tubes has become a very popular way of fishing for pike on small to medium-sized still waters.[24] Fly fishing for pike is another eligible way of catching these fish, and the float tube is now recognized as an especially suitable water craft for pike fly-fishing. Also they have been caught this way by using patterns that imitate small fry or invertebrates.

In recent decades, more pike are released back to the water after catching (catch and release), but they can easily be damaged when handled. Handling those fish with dry hands can easily damage their mucus-covered skin and possibly lead to their deaths from infections.

Since they have very sharp and numerous teeth, care is required in unhooking a pike. Barbless trebles are recommended when angling for this species, as they simplify unhooking. This is undertaken using long forceps, with 30-cm artery clamps the ideal tool. When holding the pike from below on the lower jaw, it will open its mouth. It should be kept out of the water for the minimum amount of time possible, and should be given extra time to recover if being weighed and photographed before release. If practising live release, calling the fish "caught" when it is alongside a boat is recommended. Remove the hook by grabbing it with needle-nosed pliers while the fish is still submerged and giving it a flip in the direction that turns the hook out of the mouth. This avoids damage to the fish and the stress of being out of water.

In Finland, catching a kymppihauki, a pike weighing at least 10 kg (22 lb), is considered the qualification as a master fisherman.[citation needed]

Many countries have banned the use of live fish for bait, but pike can be caught with dead fish, which they locate by smell. For this technique, fat marine fish like herring, sardines and mackerel are often used. Compared to other fish like the eel, the pike does not have a good sense of smell, but it is still more than adequate to find the baitfish. Baitfish can be used as groundbait, but also below a float carried by the wind. This method is often used in wintertime and best done in lakes near schools of preyfish or at the deeper parts of shallow water bodies, where pike and preyfish tend to gather in great numbers.

Pike make use of the lateral line system to follow the vortices produced by the perceived prey, and the whirling movement of the spinner is probably good way to imitate or exaggerate these. Jerkbaits are also effective and can produce spectacular bites with pike attacking these erratic-moving lures at full speed. For trolling, big plugs or softbaits can be used. Spoons with mirror finishes are very effective when the sun is at a sharp angle to the water in the mornings or evenings because they generate the vibrations previously discussed and cause a glint of reflective sunlight that mimics the flash of white-bellied prey. Most fishermen tend to use small lures, but often that is not advisable because pike have a preference for large prey. When fishing in shallow water for smaller pike, lighter and smaller lures are frequently used. The humble 'woolly bugger' fly is a favourite lure among keen fly fisherman of the southern hemisphere.


References[edit]

  1. ^ http://www.gen.umn.edu/research/fish/fishes/tiger_muskie.html
  2. ^ "tiger muskellunge (Esox lucius x E. masquinongy) - FactSheet". Nas.er.usgs.gov. Retrieved 2011-03-02. 
  3. ^ Craig, John F. ed. Pike: Biology and Exploitation. Chapman & Hall, London. 1996 pp. 1
  4. ^ "Molecular and Phenotypic Evidence of a New Species of Genus Esox (Esocidae, Esociformes, Actinopterygii): The Southern Pike, Esox flaviae". PLOS ONE. Retrieved 2012-11-20. 
  5. ^ R. O. Anderson and R. M. Neumann, Length, Weight, and Associated Structural Indices, in Fisheries Techniques, second edition, B. E. Murphy and D. W. Willis, eds., American Fisheries Society, 1996.
  6. ^ a b Giles, N., Wright, R. M. and Nord, M. E. (1986), Cannibalism in pike fry, Esox lucius L.: some experiments with fry densities. Journal of Fish Biology, 29: 107–113. doi: 10.1111/j.1095-8649.1986.tb04930.x http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8649.1986.tb04930.x/abstract
  7. ^ a b Mann, R. H. K. (1976), Observations on the age, growth, reproduction and food of the pike Esox lucius (L.) in two rivers in southern England. Journal of Fish Biology, 8: 179–197. doi: 10.1111/j.1095-8649.1976.tb03930.x, http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8649.1976.tb03930.x/abstract?deniedAccessCustomisedMessage=&userIsAuthenticated=false
  8. ^ a b R. H. K. Mann. Journal of Animal Ecology , Vol. 51, No. 1 (Feb., 1982), pp. 81-95 Published by:British Ecological Society http://www.jstor.org/stable/4312
  9. ^ a b c d e f g A Study of Reproduction, Early Life, Weight-Length Relationship and Growth of Pike, Esox lucius L., in Windermere. Winifred E. Frost and Charlotte Kipling. Journal of Animal Ecology , Vol. 36, No. 3 (Oct., 1967), pp. 651-693. Published by: British Ecological Society. http://www.jstor.org/stable/2820
  10. ^ a b c Peter Eklov. Group foraging versus solitary foraging efficiency in piscivorous predators: the perch, Perca fluviatilis, and pike, Esox lucius, patterns. Scient Direct. August 1992. Pages 313-326. Volume 44, Part 2. http://www.sciencedirect.com/science/article/pii/000334729290037A
  11. ^ a b c P. Eklov. Effects of Habitat complexity and prey abundance on the spatial and temporal distributions of perch and pike. 9 April 2011. Canadian Journal of Fisheries and Aquatic Sciences. http://www.nrcresearchpress.com/doi/abs/10.1139/f97-059?journalCode=cjfas#.UmnbgxBTVBz
  12. ^ a b c David G. Harper and Robert W. Blake, Fast-Start Performance of Rainbow Trout Salmo gairdneri and Northern Pike Esox lucius. 9 January 1990. The Journal of Experimental Biology. http://jeb.biologists.org/content/150/1/321.short
  13. ^ Jepsen, N., Beck, S., Skov, C. and Koed, A. (2001), Behavior of pike (Esox lucius L.) >50 cm in a turbid reservoir and in a clearwater lake. Ecology of Freshwater Fish, 10: 26–34. doi: 10.1034/j.1600-0633.2001.100104.x, http://onlinelibrary.wiley.com/doi/10.1034/j.1600-0633.2001.100104.x/full
  14. ^ Jepsen, N., Beck, S., Skov, C. and Koed, A. (2001), Behavior of pike (Esox lucius L.) >50 cm in a turbid reservoir and in a clearwater lake. Ecology of Freshwater Fish, 10: 26–34. doi: 10.1034/j.1600-0633.2001.100104.x, http://onlinelibrary.wiley.com/doi/10.1034/j.1600-0633.2001.100104.x/full
  15. ^ a b Chapman, C. A. and Mackay, W. C. (1984), Versatility in habitat use by a top aquatic predator, Esox lucius L. Journal of Fish Biology, 25: 109–115. doi: 10.1111/j.1095-8649.1984.tb04855.x, http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8649.1984.tb04855.x/abstract?deniedAccessCustomisedMessage=&userIsAuthenticated=false
  16. ^ Jepsen, N., Beck, S., Skov, C. and Koed, A. (2001), Behavior of pike (Esox lucius L.) >50 cm in a turbid reservoir and in a clearwater lake. Ecology of Freshwater Fish, 10: 26–34. doi: 10.1034/j.1600-0633.2001.100104.x, http://onlinelibrary.wiley.com/doi/10.1034/j.1600-0633.2001.100104.x/full
  17. ^ a b Craig, J. F. and Kipling, C. (1983), Reproduction effort versus the environment; case histories of Windermere perch, Perca fluviatilis L., and pike, Esox lucius L. Journal of Fish Biology, 22: 713–727. doi: 10.1111/j.1095-8649.1983.tb04231.x, http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8649.1983.tb04231.x/abstract
  18. ^ a b c Donald R. Franklin, Lloyd L. Smith Jr., Early Life History of the Northern Pike, Esox lucius L., with Special References to the Factors Influencing the Numerical Strength of Year Classes
  19. ^ "pikezander.co.uk". 
  20. ^ "Pike" by Ted Hughes. Poem text and audio: Hughes talks about his poem then reads it aloud. PoetryArchive.org. Retrieved 2010-08-13.
  21. ^ [1], p. 21
  22. ^ "What the PAC is All About". Pacgb.co.uk. Retrieved 2011-03-02. 
  23. ^ Young, Samantha (2007-09-26). "Calif. Aims to Rid Lake of Northern Pike". Associated Press. Retrieved 2007-09-27. 
  24. ^ [2][dead link]
  • "Esox lucius". Integrated Taxonomic Information System. Retrieved 8 December 2004. 
  • Froese, Rainer and Pauly, Daniel, eds. (2004). "Esox lucius" in FishBase. October 2004 version.
  • Broughton, Bruno. "A Review of the Scientific Basis for Pike Culls". N.p., 2000.
  • Craig, John F. ed. Pike: Biology and Exploitation. Chapman & Hall, London. 1996 pp. 1.
  • Eddy S, Surber T. Northern Game Fishes Univ. of Michigan Press, 1943.
  • La Monte Fancesca. North American Game Fishes Doubleday & Company, Inc. 1950 pp. 126.
  • Weed Alfred C. Pike, Pickerel, and Muskellunge. Field Museum of Natural History, Chicago, Dept. of Zoology, Leaflet No. 9, 52 pp., 8 plates.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: May hybridize with other esocids (e.g., where pike introduced).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!