Overview

Comprehensive Description

Description: This type shares the characteristic markings of larval and transitional Sparisoma. Recruits become distinct from S. radians and S. viride as melanophores extend onto the base of the caudal fin and divide the light bar on the tail. The tail melanophores extending into the caudal bar are roughly equal both above and below the midline and the bar is still clearly white. Juveniles are variably marked, but typically develop an alternating pattern of white and dark bars.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs in coral reefs and adjacent habitats, the young especially in seagrass beds. Juveniles or primary-phase adults rapidly assume a mottled pattern with which they blend with the substratum when they come to rest on the bottom. Feeds on benthic algae and seagrasses.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from the Bahamas and South Florida (USA) to Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: southern Florida (USA) and Bahamas to Brazil; throughout the Caribbean Sea (Ref. 3802).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 460 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

46.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: The larvae of all Sparisoma may well be identical, and DNA sequencing is required to identify species. Transitional recruits develop the basic markings probably shared by all members of the genus, but small juveniles of Sparisoma acquire distinct patterns that separate most, if not all, regional species. S. chrysopterum and S. rubripinne may have a similar appearance as juveniles.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Young adults with black saddle-shaped markings at upper end of pectoral fin base; often vague, pale saddle-shaped area on top of caudal peduncle; and dorsal, anal, and pelvic fins red or orange (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Sparisoma chrysopterum
Catalog Number: USNM 81504
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Panama Market, Panama, Panama, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Sparisoma chrysopterum
Catalog Number: USNM 35082
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): D. Jordan
Locality: Havana, Cuba, Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in reef and seagrass habitats from 1-20 m depth. It occurs in coral and rocky reefs, and adjacent habitats, the young especially in seagrass beds. Juveniles or primary-phase adults rapidly assume a mottled pattern and blend with the substratum when they come to rest on the bottom. It feeds on benthic algae and seagrass.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 15 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 504 specimens in 1 taxon.
Water temperature and chemistry ranges based on 347 samples.

Environmental ranges
  Depth range (m): 0.225 - 26
  Temperature range (°C): 26.181 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 36.556
  Oxygen (ml/l): 4.313 - 4.698
  Phosphate (umol/l): 0.006 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.225 - 26

Temperature range (°C): 26.181 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 36.556

Oxygen (ml/l): 4.313 - 4.698

Phosphate (umol/l): 0.006 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coral reefs and adjacent habitats, the young especially in seagrass beds. Juveniles or primary-phase adults rapidly assume a mottled pattern with which they blend with the substratum when they come to rest on the bottom. Feeds on benthic algae and seagrasses. Herbivore (Ref. 33499, 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sparisoma chrysopterum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sparisoma chrysopterum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTTTAAGCCTTCTCATCCGAGCCGAATTAAGCCAACCCGGGGCCCTTCTCGGAGACGACCAGATCTATAATGTAATTGTTACTGCTCACGCGTTCGTAATAATCTTTTTTATGGTCATGCCTATCATGATTGGAGGCTTTGGAAACTGACTCATCCCCCTCATGATTGGAGCGCCCGACATGGCATTCCCACGAATAAATAATATGAGCTTTTGACTTCTTCCGCCTTCCTTCCTTTTACTACTTGCCTCTTCTGGCGTTGAAGCAGGTGCAGGAACAGGGTGAACTGTCTATCCCCCACTAGCAGGCAACCTCGCACACGCAGGAGCATCCGTAGACCTCACAATTTTCTCCCTTCACCTCGCAGGGATTTCCTCAATTCTTGGGGCTATTAACTTCATTACAACTATTATTAACATGAAGCCCCCTGCTATCTCCCAGTATCAAACACCTCTATTTGTCTGAGCTGTTTTAATTACAGCTGTTCTCCTTCTGTTATCCCTGCCCGTTCTCGCTGCAGGAATTACGATACTCCTTACTGACCGTAATCTCAACACCACCTTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Rocha, L.A., Choat, J.H., Clements, K.D., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is widely distributed in the western North Atlantic, and is common throughout its range. There are no major threats known to this species and it occurs in a number of marine protected areas in parts of its distribution. It is listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout its range (L. Rocha pers comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. Even though fisheries on these and other medium to large-sized parrotfish species in the Caribbean has been steadily increasing, there is no apparent global decline in population sizes (Friedlander and Beets 2008). There are however, severe population declines in reefs close to densily populated areas around Haiti and Jamaica (Hawkins and Roberts 2004).

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!