Overview

Comprehensive Description

Ruud (1954) published the first detailed report on several Antarctic fish species in the family Channichthyidae, including the Mackerel Icefish (Champsocephalus gunnari), that have nearly colorless blood as a consequence of a total lack of hemoglobin (many icefish species, including the Mackerel Icefish, also do not produce the related myoglobin proteins in their muscles [Grove et al. 2004] and, like many related Antarctic fishes, carry compounds in their blood that prevents it from freezing [Cheng and Detrich 2007; di Prisco et al. 2007]). This lack of hemoglobin results in an oxygen-carrying capacity in icefishes that is less than 10% of that seen in closely related red-blooded species. However, the problem of obtaining sufficient oxygen is at least somewhat reduced because the solubility of gases is inversely proportional to temperature, making oxygen content in Antarctic waters extremely high. Nearly all icefishes live only in the cold-stable and oxygen-rich environment of the Southern Ocean. The Mackerel Icefish is one of the few icefishes with a low-Antarctic range of distribution, nearly all the others being confined to high Antarctic latitudes (Kock and Everson 2003). It is a prominent member of the coastal fish fauna of the Seasonal Pack-Ice Zone and the islands north of it (Kock and Everson 1997). Mackerel Icefish are generally found above 300 m in depth and have never been found below 700 m (Kock and Everson 2003 and references therein).

A range of anatomical and physiological features of icefishes appear to be adaptations associated with the lack of hemoglobin. Notably, modifications of the cardiovascular system of icefishes help compensate for the absence of oxygen-binding hemoglobin. Denser vascularization supplying tissues with especially high oxygen demand, such as retinal tissue, has been shown in some icefishes, including the Mackerel Icefish. More generally, icefishes possess large capillaries and have blood volumes that are two to four times larger than those of red-blooded fishes. Hearts are larger in icefishes than in red-blooded fishes of similar size, resulting in mass-specific cardiac outputs that are several times greater than those of red-blooded species. As a consequence of these features, icefishes are able to circulate large blood volumes at relatively high flow rates. This is achieved at low arterial blood pressures due to decreased systemic resistance to flow. The combination of high-throughput cardiovascular systems, waters of high oxygen content, and relatively low absolute metabolic rates enables icefish to deliver sufficient oxygen to their tissues. (Kock 2005 and references therein; Wujcik et al. 2007 and references therein; Garofalo et al. 2009)

Mackerel Icefish are active bentho-pelagic fish which migrate up and down the water column in a daily cycle (Kock and Everson 2003 and references therein). In contrast to many Antarctic fishes, when Mackerel Icefish form dense aggregations, they often stay in the water column 20 to 30 m or even farther above the bottom during the day (Kock and Jones 2005). Mackerel Icefish mature at three to four years of age (Kock 2005) and may exceed 60 inches in length and live to 15 years. Sexually mature males have a significantly higher first dorsal fin than do females (Kock and Jones 2005 and references therein). Mackerel Icefish were targeted by commercial fisheries in the 1970s and 1980s and most stocks had been overexploited by the beginning of the 1990s (Kock 2005).

Main et al. (2009) studied the stomach contents of more than 2000 Mackerel Icefish individuals. They found that diet varied significantly between year and age classes. In general, the diet was dominated by Antarctic Krill (Euphausia superba) and by the amphipod Themisto gaudichaudii. Smaller (younger) individuals tended to include in their diets a higher proportion of T. gaudichaudii and smaller euphausiids (such as Thyanoessa sp.) and fewer Antarctic Krill.

Kock and Everson (2003) review what is known about the ecology of this species. Kock et al. (2007) review the history of the Mackerel Icefish fishery.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Champsocephalus gunnari Lonnberg, 1905: Preserved specimen
Attribution Share Alike

This fish, along with the other members of the family Channichthyidae, is best known for being the only vertebrates that lack hemoglobin and skeletal myoglobin (Moylan and Sidell 2000). Champhocephalus gunarri is additionally one of only 6 species of fish to lack cardiac myoglobin (Grove et. al 2004). These and other adaptations have made it possible for the mackerel icefish to inhabit successfully the sub-freezing temperatures of the bodies of water surrounding Antarctica. C. gunarri move through different depths of the water column diurnally, from 0 – 800 m, with the oldest specimens staying farther from the surface (Frolkina and Trunov 2004). Using primarily labriform locomotion, flapping their pectoral fins back and forth (Johnston 1989), they feed almost exclusively on krill.

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Biology

Feed mainly on krill and mysids. Spawn in autumn and winter (Ref. 50743). Synchronous spawner (Ref. 50743). Larval pelagic phase is long (Ref. 71843). Utilized as a food fish (Ref. 4931). The Australian mackerel icefish fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_1255.htm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

Southern Ocean: Islands of the Scotia Sea, including the northern part of Antarctic Peninsula; Kerguelen, Heard and Bouvet islands; in the South Atlantic, near the South Georgia. Also in near the South Orkneys and South Shetland islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

C. gunnari is only found in the Antarctic, most southern region of the world, but is widely distributed south of the Antarctic convergence over shelf areas of sufficiently shallow habitat surrounding sub-Antarctic Islands. Their main area of distribution in the Atlantic Ocean is the Scotia Arc from South Georgia Island in the north to west of the Antarctic Peninsula at approximately 67°S. Their area of distribution in the southern Indian Ocean is around Kerguelen, Heard, and McDonald Islands (Kuhn 2006).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Antarctica: Scotia Sea
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 59 - 62
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Champsocephalus gunnari Lönnberg, 1905
Attribution Non‐commercial

C. gunnari have large heads, with depressed, elongate snouts. Their mouth is large with small teeth, all designed to capture their prey of krill and other plankton forms. They are fusiform in shape, tapered at the head and tail, with rounded pelvic fins (Kock 2005a). in C. gunnari and species of the genus Chionodraco, sexually mature males have a significantly higherfirst dorsal fin than females (Iwami and Kock 1990). Due in part to their lack of hemoglobin, mackerel icefish are predominantly blue and silver hues, with clear, almost white gills.

The oxygen carrying capacity of icefish blood is only 10% of what it would be for a fish with hemoglobin (Wojcik 2007). Blood is transparent and less viscous. C. gunnari has several adaptations to compensate for lacking hemoglobin. Its heart is significantly larger than its close relatives who have retained hemoglobin. This enables mackerel icefish to circulate blood volumes of blood 2-4 times greater than fish with hemoglobin (Wojcik 2007). The cold water temperature and thus relatively high concentration of oxygen and relatively low metabolic rates of C. gunnari also help compensating for lack of hemoglobin.

Because mackerel icefish have increased vascularitzation (higher number and density of veins and arteries) of their fins and scaleless skin it has been suggested that they utilize cutaneous respiration (Feller and Gerday 1997), obtaining oxygen through their skin, though this hasn’t been demonstrated through observation or experimentation.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 660 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

66.0 cm TL (male/unsexed; (Ref. 5200)); max. published weight: 2,000 g (Ref. 4883)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size for a C.gannari is 65 cm, though fish this large are rarely reported (review). Most adult fish range 25-35 cm, with the following size guidelines established that juveniles ranged from 1-15 cm, immature fish from 15-25 cm, mature fish from 25-39 cm, and large mature fish were those greater that 40 cm (Frolkina 2001).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Icefish Mackerel are around 25 -35 cm on average. They're predominantly striped different shades of silver. It appears exceedingly similar to Champhsocephalus exos, its sister species, with a slightly less dorsal-ventrally compressed snout, thicker stripes, and a more southern distribution. (FishBase)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; marine; depth range 0 - 700 m (Ref. 11892), usually 30 - 250 m (Ref. 11892)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 30 samples.

Environmental ranges
  Depth range (m): 15 - 590.5
  Temperature range (°C): -0.482 - 24.821
  Nitrate (umol/L): 2.763 - 37.620
  Salinity (PPS): 33.718 - 35.018
  Oxygen (ml/l): 3.016 - 7.552
  Phosphate (umol/l): 0.269 - 2.402
  Silicate (umol/l): 4.953 - 87.522

Graphical representation

Depth range (m): 15 - 590.5

Temperature range (°C): -0.482 - 24.821

Nitrate (umol/L): 2.763 - 37.620

Salinity (PPS): 33.718 - 35.018

Oxygen (ml/l): 3.016 - 7.552

Phosphate (umol/l): 0.269 - 2.402

Silicate (umol/l): 4.953 - 87.522
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mackerel icefish are marine animals. They’re a shallow water, costal fish and live in upper continental shelf regions. Their range of depth is from 0-770 m, with only older adults inhabiting the deeper portions of that range. C. gunnari live in waters -1.86° C to 3 ° C. 6° C is considered the lethal temperature (Kock 2003).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 700m.
Recorded at 700 meters.

Habitat: pelagic. Feeds mainly on krill and mysids. Utilized as a food fish (Ref. 4931).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Within each upper shelf habitat that supports a C. gunnari population, there appear to be migrations throughout development. Most juveniles (<15 cm) were found in the southern and eastern part of the shelf, or otherwise inshore regions. As fish grow older, they moved to the north of the shelf. Only the oldest fish were observed in the deepest, which corresponded to the most north, sections of the shelf. (Kock 2005a)

While it is still possible that migrations between shelf habitats of the mackerel icefish exist, there has been no report of the in pelagic waters beyond any of the shelf breaks. Also, clear genetic differences have been observed, even between three populations close enough to migrate, making migrations of C. gunnari less likely. (Kuhn 2006)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Due to their spawning, the eggs of C. gunnari are present in the water column and it has been thought that the fish could be distributed and dispersed in this manner, yet the genetic differences of populations suggest there isn't, in reality, much dispersal of fish from their primary habitat. (Kock 2005a).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Mackerel icefish are an important part of Antarctic ecosystems. They primarily consume krill, mysids, and hyperiids (small crustaceans), very occasionally eating small fish. In turn, they are eaten by several species of fish. Also, Ade´ lie and chinstrap penguins feed on them at a low rate. Occasionally, arctic fur seals or gentoo penguins will eat mackerel icefish as well. Lastly, humans fish and consume C. gunnari as well. (Kock 2005b)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Mackerel icefish generally become less active and more benthic as they age. Larvae and juveniles are pelagic, active predators of krill. There is some evidence they become more sedentary as they age.

There is no evidence of nesting or guarding a nest in C. gunnari. They reproduce by spawning during 2-3 months of the fall, directly before which they move inshore. (Kock 2005a)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Age estimations have varied greatly for C. gunnari, with variation among populations common as well. A life expectancy of 5-6 years of age has been suggested for populations on northern grounds due to physiological constraints. Other estimates, from South Georgia indicate most fish don’t live past 6 to 7 years. Bouvetoya and the southern Scotia Arc sustain the oldest fish that reach at least 12 to 15 years of age (Kock and Everson 2003).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mackerel icefish become sexually mature at 3 years of age, with the exception of the southern Scotia Arc where they don’t reach maturity till a year later. Upon sexual maturity, they spawn for 2-3 months yearly. Some populations begin to spawn as early as late February and others do not finish their spawning until as late as September. This variation is the result of the different locations of each population and natural variation from year to year (review article). Feeding conditions serve as a trigger for what proportion of a population spawn each year. Kock (1990) estimated that 10–20% of theadult fish do not spawn each year. This proportion may increase to 60% in those years when krill is scarce atSouth Georgia and the fish suffer from malnutrition. Generally, they greatly reduce feeding directly before spawning. They also move closer to shore before spawning to preferred grounds, with males starting this mild migration about a month before females (Everson et al. 2001). C. gunnari have absolute fecundity typically around 2 – 8,000 eggs with a relative fecundity usually in the order of 5-20. Differences between years have been observed in relative fecundity. These differences may be related to the actual condition of the fish (Alekseeva and Alekseev 1997) which may vary considerably between years and even within a season (Everson and Kock 2001). Relative fecundity sometimes decreased with increasing length and weight of the females, such as in C. gunnari (Alekseeva and Alekseev 1997). Eggs of C. gunnari range from 2.6 to 4.1 mm in diameter (Kock 1981) and are demersal, or exist at the sea floor (Everson et al. 2001). Incubation after fertilization takes approximately 3 months, wich is short in comparison to the other icefish (Duhamel 1995). The hatching larvae are 13-17mm in size (Duhamel 1995). Time of hatching varies by location, and appears to happen for several months (North 1990; Everson et al. 2000a). After hatching, they live as active, pelagic predators of krill, becoming increasingly sedentary with age (Kock 2001).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Larvae hatch around 17 to 20 mm then grow at a rate of 0.08 to 0.35 mm daily. C. gunnari, for example, grows about 10 mm per month (Alekseeva and Alekseev 1997). They continue relatively rapid growth of 6-10 cm a year until they reach sexual maturity around 3 years of age. After that they continue growing at a rate of around 5 - 7 cm a year (Kock 2005a).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Champsocephalus gunnari

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTNTACTTAATNTTCGGCGCTTGAGCCGGGATAGTGGGCACCGCCCTTAGCCTGCTCATCCGAGCAGAGCTTAGCCAGCCTGGCGCCCTATTGGGGGACGACCAAATTTATAATGTGATTGTTACCGCTCACGCCTTCGTAATAATCTTCTTTATAGTTATACCTATCATAATTGGAGGCTTTGGAAACTGGCTCATCCCCCTGATGATTGGAGCCCCGGATATGGCCTTCCCCCGAATAAACAACATGAGCTTCTGACTCCTCCCTCCCTCATTCCTCCTATTATTAGCTTCTTCAGGCGTGGAAGCTGGGGCAGGTACGGGATGAACCGTATACCCCCCCCTATCTGGAAACTTAGGCCACGCAGGAGCATCCGTTGATTTAACTATTTTCTCTCTACACTTAGCTGGCATTTCTTCTATTTTAGGGGCAATTAACTTTATCACAACAATTATTAATATGAAACCCCCTGCCATCTCTCAATACCAAACACCCCTCTTTGTGTGAGCCGTCTTAATTACTGCTGTTCTTCTTCTCCTCTCACTTCCTGTACTAGCTGCCGGCATTACTATGCTTCTCACGGACCGTAACCTCAACACCACCTTCTTTGACCCGGCCGGGGGCGGANACCCCATCCTTTACCAACACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Champsocephalus gunnari

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

C. gunnari are currently at reduced population levels, but are actively being protected through limitations on catching areas and sizes. The current icefish mackerel fishery has been certified by the international Marine Stewardship Council as sustainable and well managed. (MCS 2012)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

From the early 1970s to beginning of the1990s mackerel icefish made up the largest commercial fish catches of any species for large sections of its distribution in response to earlier depletion of Notothenia rossi populations. Catches before regulation of well over 50,000 tons were common (Kuhn 2006). Currently commercial fishing of C. gunnari is only permitted on a limited scale for the populations of South Georgia, Heard Island, and McDonald Island where populations have recovered in some degree from unregulated exploitation. C. gunnari stocks in the entire Scotia Arc remain at least one order of magnitude larger in the mid-1970 when fisheries were established (Kock 2005b) and fishing there has been prohibited sine 1990 (Kuhn 2006).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fishing has been regulated and thus currently constitutes only a minor threat to mackerel icefish populations. Other threats however have prevented stocks from returning to pre-exploitation levels. Increased predation, especially by Antarctic fur seals, in response to declines in other prey and krill threatens C. gunnari populations and inhibits their recovery. Also, inability to deal with climactic changes has been suggested as other threat (Kock 2001).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mackerel Icefish are exploited as a source of food and consumed by people.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mackerel icefish

The mackerel icefish, Champsocephalus gunnari, is a fish found only in the Southern Ocean. They are mainly to be found near Heard and McDonald Islands, Îles Kerguelen and islands in the south Atlantic such as South Georgia.[2]

Larval stage

Due to overfishing, the United Nations Food and Agriculture Organization (FAO) considers the species "depleted".[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!