Overview

Comprehensive Description

Biology

Found on continental slopes and abyssal plains (Ref. 6871). Feeds mainly on fish (including sharks) and cephalopods (Ref. 6871), also gastropods and cetacean meat (Ref. 5578). Ovoviviparous (Ref. 205), with 13 to 29 young per litter, born at 27-31 cm (Ref. 26346). Utilized as fishmeal, dried and salted for human consumption, or as a source of squalene (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 The Portuguese dogfish Centroscymnus coelolepis can reach 1.2 m in length. It is uniformly dark chocolate brown to golden brown in color. Like similar species it has no anal fin and the pelvic fins are positioned far back under the second dorsal. It can be identified by its short, stocky appearance and its very short snout. Its body, unlike similar species, does not taper abruptly from the pectoral region. It also has very small spines on both its dorsal fins. The tail is short but broad and the rear edge of its upper lobe is notched.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Grand Banks to Cuba
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

A wide but patchy distribution in the Atlantic (Iceland to South Africa, and including the western Mediterranean; Grand Banks to Delaware Bay) and western Pacific (off Japan, New Zealand and Australia (from Cape Hawke, New South Wales to Beachport (South Australia), including Tasmania).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Grand Banks to Delaware, USA; Cuba (Ref. 26340). Eastern Atlantic: Iceland south along Atlantic slope to the southwestern Cape coast of South Africa; also western Mediterranean. Western Pacific: off Japan, New Zealand, and Australia (Ref. 6871, 31367). Western Indian Ocean: Seychelles (Ref. 76802).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan in tropical and temperate seas, including western Mediterranean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern North Atlantic; Faroe Bank, Faroe-Shetland Channel and Iceland in the east; West Greenland; Davis Strait; and outer slopes of the fishing banks in the west, southward to Georges Bank.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Compagno, L.J.V., 1984; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen,J., Tortonese,E., 1984
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 6871))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 107 cm TL.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Compagno, L.J.V., 1984; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen,J., Tortonese,E., 1984
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dorsal fins with very small spines, very short snout, lanceolate upper teeth and bladelike lower teeth with short, oblique cusps, stocky body that does not taper abruptly from pectoral region, very large lateral trunk denticles with smooth, circular, acuspidate crowns in adults and subadults (Ref. 247). Uniformly golden brown to dark brown in color (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters.Usually occurs in water temperatures of 5-13°C, on or near bottom.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
On or near the bottom of the continental slope and abyssal plain in depths from 270 to 3,700 m. In Australia, catch rates are generally highest in depths greater than 1,000 m (Daley et al. 2002). Surveys conducted in Portugal never found this species in depths shallower than 800 m. There appears to be sex and size segregation by depth. The diet consists mainly of fish (including sharks) and cephalopods along with benthic invertebrates and cetacean species. Off southern Australia, teleost prey included relatively large demersal species such as alepocephalids and orange roughy, as well as small lantern fishes.

Population parameters in Australia are as follows (Daley et al. 2002):

Size at birth: 30 cm total length (TL)
Max size: 120 cm TL
Male maturity: 75 cm TL
Female maturity: 95 cm
Age at maturity: ?
Longevity: ?
Litter size: 12 (8-19)
Gestation:? (non-seasonal)
Breeding cycle: non-continuous

Maturity in Japan and in the north east Atlantic is reported at between 70 and 86 cm in males and at about 100 cm in females (Yano and Tanaka 1988, Girard and Du Buit 1999), with maximum size attained at 158 cm TL. There is evidence of size segregation by depth with smaller specimens at greater depths and pregnant females at shallower depths (Yano and Tanaka 1988, Girard and Du Buit 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 150 - 3700 m (Ref. 55584), usually 400 - 2000 m (Ref. 35388)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 390 specimens in 1 taxon.
Water temperature and chemistry ranges based on 267 samples.

Environmental ranges
  Depth range (m): 424 - 3650
  Temperature range (°C): 2.523 - 11.768
  Nitrate (umol/L): 15.127 - 35.809
  Salinity (PPS): 34.344 - 35.761
  Oxygen (ml/l): 1.607 - 6.392
  Phosphate (umol/l): 0.862 - 2.400
  Silicate (umol/l): 6.198 - 73.866

Graphical representation

Depth range (m): 424 - 3650

Temperature range (°C): 2.523 - 11.768

Nitrate (umol/L): 15.127 - 35.809

Salinity (PPS): 34.344 - 35.761

Oxygen (ml/l): 1.607 - 6.392

Phosphate (umol/l): 0.862 - 2.400

Silicate (umol/l): 6.198 - 73.866
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The Portuguese dogfish is a bathydemersal species found on continental shelves and abyssal plains from a depth of 150 m down to over 3000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 270 - 3700m.
From 270 to 3700 meters.

Habitat: bathydemersal. Found on continental slope and abyssal plain (Ref. 6871). Feeds mainly of fish and cephalopods (Ref. 6871). Ovoviviparous, with 13 to 17 young per litter (Ref. 6871). Males mature at about 85 cm, females at 100 cm (Ref. 6871). Utilized in the eastern Atlantic for fishmeal, and dried salted for human consumption. Source of liver oil (Ref. 6871).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bathydemersal; marine; depth range 180 - 1600 m. Found on the outermost continental shelves and upper slopes, mostly below 275 m. At high latitudes, may move up to the surface especially during the winter. Bottom water temp. are from 3.5 to 4.5°C, but sometimes down to 1°C. Segregation by sex and size as well as by movement into shallower water and by increase in school size is sometimes seen.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Compagno, L.J.V., 1984; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen,J., Tortonese,E., 1984
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found almost exclusively on the lower slope of the Catalan Sea, western Mediterranean (Ref. 40720). Found on continental slopes and abyssal plains (Ref. 6871); usually in water temperature of 5-13°C (Ref. 5951). Feeds mainly on fishes (including sharks) and cephalopods (Ref. 6871), also gastropods and cetacean meat (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on crustaceans, cephalopods, jellyfish and small fishes.
  • Bigelow, H. B. and Schroeder, W.C., 1953; Compagno, L.J.V., 1984; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen,J., Tortonese,E., 1984
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on squid and bottom fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Ovoviviparous (Ref. 6871), with 13 to 29 young per litter (Ref. 26346). Born at 27-31 cm (Ref. 26346). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ovoviviparous
  • Bigelow, H. B. and Schroeder, W.C., 1953; Compagno, L.J.V., 1984; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen,J., Tortonese,E., 1984
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Centroscymnus coelolepis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Centroscymnus coelolepis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATCTTTGGTGCATGAGCAGGAATAGTGGGCACGGCTCTTAGTCTACTTATTCGAGCAGAATTAAGCCAACCTGGTACACTTTTAGGAGATGATCAAATCTACAATGTTATTGTAACTGCTCACGCTTTCGTAATAATCTTTTTTCTAGTAATGCCTGTAATAATTGGTGGATTCGGAAATTGACTAGTGCCTTTAATAATTGGTGCACCAGATATAGCTTTCCCACGAATAAATAATATAAGCTTTTGATTATTACCCCCGTCCCTCCTTCTACTTCTAGCCTCCGCTGGTGTAGAAGCAGGAGCCGGAACTGGCTGAACAGTATACCCTCCTCTTGCAAGTAATATAGCTCATGCAGGAGCATCTGTAGATTTAGCCATCTTTTCCCTCCATTTGGCTGGTATTTCCTCAATTCTAGCCTCTATTAATTTTATTACAACTATTATTAATATGAAACCACCAGCTATTTCCCAATATCAAACACCACTTTTTGTTTGATCTATCCTTGTAACTACTGTCCTCCTTCTCCTAGCTCTTCCCGTCCTTGCAGCTGCAATTACAATATTATTAACCGACCGTAATTTAAACACGACATTTTTTGATCCAGCGGGGGGAGGGGACCCCATTCTCTATCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Stevens, J. & Correia, J.P.S. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Cavanagh, R.D. (Shark Red List Authority) & Graham, K.

Contributor/s

Justification
Mainly a bycatch species taken by trawl and hook, although with some limited targeting, for its flesh and oil. Catches in Australia have been increasing in the last few years with relaxation of mercury laws and fishers looking for non-quota species in the South East Trawl Fishery. However, appropriate data on biomass or trends in abundance are lacking. The productivity of this species is likely to be low (although age estimates and annual fecundity are currently unknown) and further increases in catches should be viewed with concern. This species is of much lower abundance than D. calcea or C. crepidater and, although the quantitative data on populations are lacking, its lower abundance, demersal habits (not appearing to range into midwater) and suspected low productivity warrant a Near Threatened assessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Relatively common in the eastern North Atlantic where it is targeted off Portugal. Also relatively common off Japan, south eastern Australia and New Zealand. No data are available on population sizes or on long term trends in abundance.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This shark has been exploited commercially for a long time. In Japan exploitation peaked during World War II, (because the livers are rich in squalene: 22 to 49% by weight), but quickly declined due to decreasing numbers caught. Taken by trawl, hook and gillnet both as a target and bycatch species for its liver oil and flesh. Important fisheries for this species exist in Suruga Bay, Japan and Portugal where it is targeted by a deepwater longline fishery. Between 1986 and 1999 catches in Portugal varied between about 300-900 tonnes with an increasing trend. The price of landed wet weight in Portugal has also been increasing since 1986 (US$1.5/kg in 1986 to US$3.5/kg in 1999), which suggests that demand is driving the fishing industry to continue exploitation. However, CPUE data were lacking and it is not currently possible to assess changes in abundance and biomass from any areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
2002 regulations in the South East Trawl fishery in Australia prohibits the landings of livers unless the accompanying carcass is also landed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Portuguese dogfish

The Portuguese dogfish or Portuguese shark (Centroscymnus coelolepis) is a species of sleeper shark of the family Somniosidae. This globally distributed species has been reported down to a depth of 3,675 m (12,057 ft), making it the deepest-living shark known. It inhabits lower continental slopes and abyssal plains, usually staying near the bottom. Stocky and dark brown in color, the Portuguese dogfish can be distinguished from similar-looking species (such as the kitefin shark, Dalatias licha) by the small spines in front of its dorsal fins. Its dermal denticles are also unusual, resembling the scales of a bony fish. This species typically reaches 0.9–1 m (3.0–3.3 ft) in length; sharks in the Mediterranean Sea are much smaller and have distinct depth and food preferences.

Relatively common, the Portuguese dogfish is an active hunter capable of tackling fast, large prey. It feeds mainly on cephalopods and fishes, though it also consumes invertebrates and cetacean carrion. This shark has acute vision optimized for detecting the bioluminescence of its prey, as sunlight does not reach the depths at which it lives. The Portuguese dogfish is aplacental viviparous, with the young provisioned by yolk and perhaps uterine fluid. The females give birth to up to 29 young after a gestation period of over one year. Valued for its liver oil and to a lesser extent meat, Portuguese dogfish are important to deepwater commercial fisheries operating off Portugal, the British Isles, Japan, and Australia. These fishing pressures and the low reproductive rate of this species have led the International Union for Conservation of Nature (IUCN) to assess it as Near Threatened.

Taxonomy[edit]

Black and white drawing of a dogfish from the side
Early illustration of a Portuguese dogfish.

The first scientific description of the Portuguese dogfish was published by Portuguese zoologists José Vicente Barbosa du Bocage and Félix António de Brito Capello, in an 1864 issue of Proceedings of the General Meetings for Scientific Business of the Zoological Society of London.[2] They created the new genus Centroscymnus for this shark, and gave it the specific epithet coelolepis, derived from the Greek koilos ("hollow") and lepidos ("fish scale") and referring to the structure of the dermal denticles.[3] The type specimen, caught off Portugal, has since been destroyed in a fire.[2]

Distribution and habitat[edit]

One of the widest-ranging deepwater sharks, the Portuguese dogfish is patchily distributed around the world.[4] In the western Atlantic, it occurs from the Grand Banks of Newfoundland to the U.S. state of Delaware. In the eastern Atlantic, it is found from Iceland to Sierra Leone, including the western Mediterranean Sea, the Azores and Madeira, as well as from southern Namibia to western South Africa.[2] In the Indian Ocean, this species has been caught off the Seychelles.[5] In the Pacific, this shark occurs off Japan, New Zealand, and Australia from Cape Hawke, New South Wales, to Beachport, South Australia, including Tasmania.[1]

The deepest-living shark known,[6] the Portuguese dogfish has been reported at depths of 150 m (490 ft) to 3,675 m (12,057 ft) from the lower continental slope to the abyssal plain, and is most common between 400 m (1,300 ft) and 2,000 m (6,600 ft).[1][7] This species is found deeper in the Mediterranean, seldom occurring above a depth of 1,500 m (4,900 ft) and being most common at 2,500–3,000 m (8,200–9,800 ft).[8] The deep Mediterranean has a relatively constant temperature of 13 °C (55 °F) and a salinity of 38.4 ppt, whereas in the deep ocean the temperature is generally only 5 °C (41 °F) and the salinity 34–35 ppt.[9] The Portuguese dogfish is essentially benthic in nature, though young sharks can be found a considerable distance off the bottom.[2][10] There is depth segregation by size and sex; pregnant females are found in shallower water, above 1,200–1,500 m (3,900–4,900 ft), while juveniles are found deeper.[1][8][11] There may be several separate populations in the Atlantic, and sharks in the Mediterranean and off Japan appear to be distinct as well.[12]

Description[edit]

Side view of a dark brown shark
The Portuguese dogfish can be distinguished from similar species by its tiny dorsal fin spines.
Dorsal and ventral view of the Portuguese dogfish's head, showing the broad, flattened snout and wide mouth.

The Portuguese dogfish typically reaches a length of 0.9 m (3.0 ft) for males and 1.0 m (3.3 ft) for females, though specimens up to 1.2 m (3.9 ft) long have been recorded.[13] Sharks in the Mediterranean are smaller, growing no more than 65 cm (26 in) long.[4] This species has a flattened, broadly rounded snout that is shorter than the mouth is wide. The nostrils are preceded by short flaps of skin.[2] The eyes are large and oval in shape, positioned laterally on the head and equipped with a reflective tapetum lucidum that produces a yellow-green "eye shine".[14] The mouth is wide and slightly arched, with moderately thick, smooth lips and short furrows at the corners extending onto both jaws. The upper teeth are slender and upright with a single cusp, numbering 43–68 rows. The lower teeth have a short, strongly angled cusp and number 29–41 rows; their bases interlock to form a continuous cutting surface.[13] The five pairs of gill slits are short and nearly vertical.[15]

The body of the Portuguese dogfish is thick and cylindrical except for the flattened belly. The two dorsal fins are small and of similar size and shape, each bearing a tiny grooved spine in front. The first dorsal fin originates well behind the pectoral fins, while the second dorsal originates over the middle of the pelvic fin bases. The pectoral fins are medium-sized with a rounded margin. There is no anal fin. The caudal fin has a short but well-developed lower lobe and a prominent ventral notch near the tip of the upper lobe.[2] The very large dermal denticles change in shape with age: in juveniles, they are widely spaced and heart-shaped with an incomplete midline ridge and three posterior points, while in adults they are overlapping, roughly circular, smooth, and flattened with a round central concavity, superficially resembling the scales of bony fishes.[16] Young sharks are a uniform blue-black in color, while adults are brown-black; there are no prominent fin markings.[13] In 1997, a partially albino individual, with a pale body but normal eyes, was caught in the northeastern Atlantic. This represented the first documented case of albinism in a deep-sea shark.[17]

Biology and ecology[edit]

Living almost exclusively in the aphotic zone where little to no sunlight penetrates, the Portuguese dogfish is relatively common and the dominant shark species in deeper waters.[11][14] The large, squalene-rich liver of this shark allows it to maintain neutral buoyancy and hover with minimal effort; males contain more squalene in their livers than females.[18] A tracking study in the Porcupine Seabight has found that the Portuguese dogfish has an average swimming speed of 0.072 m/s (0.24 ft/s), and does not remain in any particular area for long.[19] This species may be preyed upon by larger fishes and sharks.[13] Known parasites of this species include monogeneans in the genus Erpocotyle,[20] and the tapeworms Sphyriocephalus viridis,[21] S. richardi, and Anthobothrium sp.[22]

An active predator of mobile, relatively large organisms, the Portuguese dogfish feeds mainly on cephalopods (including Mastigoteuthis spp.) and bony fishes (including slickheads, orange roughy, lantern fishes, and rattails). It has also been known to take other sharks and invertebrates (such as the medusa Atolla wyvillei), as well as scavenging from whale carcasses.[1][23] The Portuguese dogfish has more acute vision than many other deepsea sharks: in addition to having a large pupil and lens, and a tapetum lucidum, its eyes also contain a high concentration of ganglion cells mostly concentrated in a horizontal streak that is densest at the center; these cells impart highly sensitive motion detection along the horizontal plane. The visual system of this species appears adapted for detecting bioluminescence: the maximum absorption of its visual pigments correspond to the wavelengths of light emitted by favored prey, such as the squids Heteroteuthis dispar, Histioteuthis spp., Lycoteuthis lorigera, and Taningia danae.[14]

In the Mediterranean sea, the Portuguese dogfish is one of the most common deepwater sharks along with the blackmouth catshark (Galeus melastomus) and the velvet belly lantern shark (Etmopterus spinax), and the only shark abundant below a depth of 1,500 m (4,900 ft).[8] By inhabiting deeper water, Portuguese dogfish in the Mediterranean may reduce competition with the other two species.[4] The smaller size of Mediterranean sharks relative to those from the rest of the world may be due to limited food availability and/or the warmer, saltier environment. Some 87% of the diet of Portuguese dogfish in the Mediterranean consists of cephalopods. Bony fishes are a secondary food source, while immature sharks favor the shrimp Acanthephyra eximia, the most common decapod crustacean in their environment.[9] Unlike in other regions, Mediterranean sharks seldom scavenge.[8]

Life history[edit]

The Portuguese dogfish is aplacental viviparous, with the female retaining eggs internally until they hatch. The embryos are sustained by yolk, and possibly also by uterine fluid secreted by the mother.[12] Figueiredo et al. (2008) reported that there are two breeding seasons per year off Portugal, from January to May and from August to December, with only a fraction of the population reproductively active at a time. However, previous accounts have described continuous reproduction with females in various stages of pregnancy present year-round.[12][24] The ovarian follicles take some time to mature; they are ovulated into the uterus at a diameter of 5–6 cm (2.0–2.4 in).[13] Studies of females have found no traces of sperm inside their reproductive tracts, which suggests that fertilization occurs immediately following copulation, which may also trigger ovulation. The reproductive cycles of Portuguese dogfish in the Atlantic and Pacific are generally similar; sharks off Japan tend to produce larger numbers of smaller oocytes than elsewhere, while sharks off the British Isles exhibit a larger litter size and birth size (but smaller oocytes) than those off Portugal. There is a record of a hermaphroditic specimen with an ovary on its right side and a testis on its left.[12]

Early in development, the embryos are sexually undifferentiated, unpigmented, and possess filamentous external gills; the external yolk sac in this stage weighs 120–130 g (4.2–4.6 oz). Recognizable sex organs develop by an embryonic length of 92 mm (3.6 in), and tissue differentiation is complete by a length of 150 mm (5.9 in). Body pigmentation appears when the embryo is 100–150 mm (3.9–5.9 in) long; the external gills regress at around the same time. An internal yolk sac develops when the embryo is 140 mm (5.5 in) long, which begins to take in yolk as the external yolk sac shrinks; by the time the embryo is 233–300 mm (9.2–11.8 in) long the external yolk sac has been completely resorbed.[12] Off Portugal, the young seem to be born in May and December following a gestation period of over a year. As they near giving birth, the females undergo ovarian atresia (regression of the follicles), suggesting that they enter a resting period afterwards.[24] The litter size ranges from 1 to 29 (typically 12), and is not correlated with female size.[1][12] Parturition may occur in a yet-unknown nursery area, as newborns are rarely ever caught.[12] The length at birth has been reported as 23–30 cm (9.1–11.8 in) in the Atlantic,[12][25] and 30–35 cm (12–14 in) in the Pacific.[26][27]

Aside from the distinctive Mediterranean population, Portuguese dogfish attain sexual maturity at similar sizes around the world: males and females mature at 90–101 cm (35–40 in) and 85–115 cm (33–45 in) respectively off the Iberian Peninsula,[12][24][25] 86 cm (34 in) and 102 cm (40 in) respectively west of the British Isles,[28] 70 cm (28 in) and 95–100 cm (37–39 in) respectively in Suruga Bay, Japan,[26] and 82–90 cm (32–35 in) and 99–110 cm (39–43 in) respectively off southeastern Australia.[27][29] In the Mediterranean, males mature at around 53 cm (21 in) long.[30]

Human interactions[edit]

Black and white photo of a row of small sharks lying side-by-side on the deck of a fishing boat
The Portuguese dogfish is an important component of several deepwater fisheries.

The Portuguese dogfish is too small and occurs too deep to pose a danger to humans.[13] This species has long been commercially fished, using hook-and-line, gillnets, and trawls. It is mainly valued for its liver, which contains 22–49% squalene by weight and is processed for vitamins. The meat may also be sold fresh or dried and salted for human consumption, or converted into fishmeal.[1][7] An important fishery for the Portuguese dogfish exists in Suruga Bay for liver oil; catches peaked during World War II, but declined soon after from over-exploitation.[1] In the past few years, catches by the South East Trawl Fishery off Australia have been increasing, as fishers have been seeking out species not covered by commercial quotas following the relaxation of seafood mercury regulations. Shark landings in this fishery are affected by a prohibition on landing livers without the rest of the carcass.[1]

Until recently, Portugal was the only European country to utilize the Portuguese dogfish. An important bycatch of the black scabbardfish (Aphanops carbo) longline fishery, between 300 and 900 tons of this shark were landed annually from 1986 to 1999. Its per-weight value has been increasing since 1986, and thus exploitation is likely to continue.[1] Around 1990, French bottom trawlers began to fish for Portuguese dogfish and leafscale gulper sharks (Centrophorus squamosus) west of the British Isles for meat and livers; these two species are together referred to as siki. The siki catch peaked at 3,284 tons in 1996 before declining to 1,939 tons in 1999. The French have since been joined by Norwegian, Irish, and Scottish longliners and trawlers, making the Portuguese dogfish a significant component of deepwater fisheries in the northwest Atlantic.[10][11] While stocks off Portugal seem to be stable for now, stocks off the British Isles have diminished substantially in recent years; this may reflect the disparity between the artisanal Portuguese fishery and the commercial French fishery.[12] The International Union for Conservation of Nature (IUCN) has assessed this species as Near Threatened, because of its commercial value and low reproductive productivity.[1]

References[edit]

  1. ^ a b c d e f g h i j k "Centroscymnus coelolepis". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2003. Retrieved October 4, 2009. 
  2. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. p. 55–56. ISBN 92-5-101384-5. 
  3. ^ Lineaweaver, T.H. and R.H. Backus (1970). The Natural History of Sharks. Lippincott. p. 239. 
  4. ^ a b c Tosti, L., R. Danovaro, A. Dell'anno, I. Olivotto, S. Bompadre, S. Clo and O. Carnevali (August 2006). "Vitellogenesis in the deep-sea shark Centroscymnus coelolepis". Chemistry and Ecology 22 (4): 335–345. doi:10.1080/02757540600812016. 
  5. ^ Baranes, A. (2003). "Sharks from the Amirantes Islands, Seychelles, with a description of two new species of squaloids from the deep sea". Israel Journal of Zoology 49 (1): 33–65. doi:10.1560/N4KU-AV5L-0VFE-83DL. 
  6. ^ Priede I.G., R. Froese, D.M. Bailey, O.A. Bergstad, M.A. Collins, J.E. Dyb, C. Henriques, E.G. Jones, and N. King (2006). "The absence of sharks from abyssal regions of the world's oceans". Proceedings of the Royal Society B 273 (1592): 1435–1441. doi:10.1098/rspb.2005.3461. PMC 1560292. PMID 16777734. 
  7. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Centroscymnus coelolepis" in FishBase. November 2009 version.
  8. ^ a b c d Sion, L., A. Bozzano, G. D'Onghia, F. Capezzuto and M. Panza (December 2004). "Chondrichthyes species in deep waters of the Mediterranean Sea". Scientia Marina. 68 (Supplement 3): 153–162. 
  9. ^ a b Carrasson, M., C. Stefanescu and J.E. Cartes (1992). "Diets and bathymetric distributions of two bathyal sharks of the Catalan deep sea (western Mediterranean)". Marine Ecology Progress Series 82 (1): 21–30. doi:10.3354/meps082021. 
  10. ^ a b Clarke, M.W., L. Borges and R.A. Officer (April 2005). "Comparisons of trawl and longline catches of deepwater elasmobranchs west and north of Ireland". Journal of Northwest Atlantic Fishery Science 35: 429–442. 
  11. ^ a b c Clarke, M.W., P.L. Connolly and J.J. Bracken (2001). "Aspects of reproduction of the deep water sharks Centroscymnus coelolepis and Centrophorus squamosus from west of Ireland and Scotland". Journal of the Marine Biological Association of the United Kingdom 81 (6): 1019–1029. doi:10.1017/S0025315401005008. 
  12. ^ a b c d e f g h i j Veríssimo, A., L. Gordo and I. Figueiredo (2003). "Reproductive biology and embryonic development of Centroscymnus coelolepis in Portuguese mainland waters". ICES Journal of Marine Science 60 (6): 1335–1341. doi:10.1016/S1054-3139(03)00146-2. 
  13. ^ a b c d e f Burgess, G. and Bester, C. Biological Profiles: Portuguese Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on October 17, 2009.
  14. ^ a b c Bozzano, A. (December 2004). "Retinal specialisations in the dogfish Centroscymnus coelolepis from the Mediterranean deep-sea". Scientia Marina. 68 (Supplement 3): 185–195. 
  15. ^ Yano, K. and S. Tanaka (1983). "Portuguese shark, Centroscymnus coelolepis from Japan, with notes on C. owstoni". Japanese Journal of Ichthyology 30 (3): 208–216. 
  16. ^ Taniuchi, T. and J.A.F. Garrick (1986). "A new species of Scymnodalatias from the southern oceans, and comments on other squaliform sharks". Japanese Journal of Ichthyology 33 (2): 119–134. 
  17. ^ Deynat, P.P. (September 30, 2003). "Partial albinism in the Portuguese dogfish Centroscymnus coelolepis (Elasmobranchii, Somniosidae)". Cybium 27 (3): 233–236. 
  18. ^ Hernandez-Perez, M., R.M. Rabanal Gallego and M.J. Gonzalez Carlos (2002). "Sex difference in liver-oil concentration in the deep-sea shark, Centroscymnus coelolepis". Marine and Freshwater Research 53 (5): 883–886. doi:10.1071/MF01035. 
  19. ^ Bagley, P.M., A. Smith and I.G. Priede (August 1994). "Tracking movements of deep demersal fishes in the Porcupine Seabight, north-east Atlantic Ocean". Journal of the Marine Biological Association of the United Kingdom 74 (3): 473–480. doi:10.1017/S0025315400047603. 
  20. ^ Pascoe, P.L. (1987). "Monogenean parasites of deep-sea fishes from the Rockall Trough (N.E. Atlantic) including a new species". Journal of the Marine Biological Association of the United Kingdom 67 (3): 603–622. doi:10.1017/S0025315400027326. 
  21. ^ Bussieras, J. (1970). "Nouvelles observations sur les cestodes tetrarhynques de la collection du Musee Oceanographique de Monaco. I. Sphryiocephalus alberti Guiart, 1935". Annales de Parasitologie Humaine et Comparee 45: 5–12. 
  22. ^ Guitart, J. (1935). "Cestodes parasites provenant des campagnes scientifiquesde S.A.S. le Prince Albert ler de Monaco (1886–1913)". Résultats des Campagnes Scientifiques accomplies sur son Yacht par Albert Ier Prince Souverain de Monaco publiés sous sa Direction avec le Concours de M. Jules Richard 91: 1–100. 
  23. ^ Mauchline, J. and J.D.M. Gordon (1983). "Diets of the sharks and chimaeroids of the Rockall Trough, northeastern Atlantic Ocean". Marine Biology 75 (2–3): 269–278. doi:10.1007/BF00406012. 
  24. ^ a b c Figueiredo, I., T. Moura, A. Neves and L.S. Gordo (July 2008). "Reproductive strategy of leafscale gulper shark Centrophorus squamosus and the Portuguese dogfish Centroscymnus coelolepis on the Portuguese continental slope". Journal of Fish Biology 73 (1): 206–225. doi:10.1111/j.1095-8649.2008.01927.x. 
  25. ^ a b Bañón, R., C. Piñeiro and M. Casas (2006). "Biological aspects of deep-water sharks Centroscymnus coelolepis and Centrophorus squamosus in Galician waters (north-western Spain)". Journal of the Marine Biological Association of the United Kingdom 86 (4): 843–846. doi:10.1017/S0025315406013774. 
  26. ^ a b Yano, K. and S. Tanaka (1988). "Size at maturity, reproductive cycle, fecundity and depth segregation of the deep sea squaloid sharks Centroscymnus owstoni and C. coelolepis in Suruga Bay, Japan". Bulletin of the Japanese Society of Scientific Fisheries 54 (2): 167–174. doi:10.2331/suisan.54.167. 
  27. ^ a b Daley, R., J. Stevens and K. Graham. (2002). Catch analysis and productivity of the deepwater dogfish resource in southern Australia. FRDC Final Report, 1998/108. Canberra: Fisheries Research and Development Corporation.
  28. ^ Girard, M. and M.H. Du Buit (1999). "Reproductive biology of two deep-water sharks from the British Isles, Centroscymnus coelolepis and Centrophorus squamosus (Chondrichthyes: Squalidae)". Journal of the Marine Biological Association of the United Kingdom 79 (5): 923–931. doi:10.1017/S002531549800109X. 
  29. ^ Irvine, S.B. (2004). Age, growth and reproduction of deepwater dogfishes from southeastern Australia. PhD Thesis, Deakin University.
  30. ^ Cló, S., M. Dalú, R. Danovaro and M. Vacchi (2002). Segregation of the Mediterranean population of Centroscymnus coelolepis (Chondrichthyes: Squalidae): a description and survey. NAFO SCR Doc. 02/83
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!