Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on the outer continental shelves and upper slopes, probably reaching depths greater than 750 m (Ref. 31367). Probably the largest gulper shark (Ref. 31367). Ovoviviparous (Ref. 50449). Utilized as fishmeal and for human consumption (Ref. 31367); meat, fins (low value) and liver oil (very high value) (Ref.58048). Fished off Taiwan for its large river rich in squalene (Ref. 247). Diet consists primarily on bony fishes and cephalopods, but also elasmobranchs and crustaceans (Ref. 58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Wide, if sporadic, range in the Atlantic and Indo-West Pacific, on outer continental shelves and upper slopes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: southern Mozambique and Natal, South Africa (Ref. 11228). Possibly occurring in Maldives (Ref. 31367). Western Pacific: Japan, off northeastern Taiwan (Ref. 247), South China Sea, and probably Australia. North Atlantic (Ref. 31367). Often confused with Centrophorus granulosus and Centrophorus lusitanicus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan: Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

160 cm TL (male/unsexed; (Ref. 31367))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark grey in color (Ref. 31367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs on or near the seabed on outer continental shelves and upper slopes at 98 to 1,000 m. Eats bony fishes, small dogfish sharks, skates, squid and crustaceans. Ovoviviparous (aplacental viviparous) with one to six (mostly four to six) pups per litter, born at 30 to 45 cm total length (TL). Matures at around 110 cm (males) to 140 cm (females) with maximum length approximately 170 cm. Although there is limited information on the biology of this species, gulper sharks are considered to have very low rates of population increase and to be very vulnerable to over-exploitation by fisheries. For example, Graham et al. (1997) report documented declines of 99.5% in abundance of Centrophorus species off southern New South Wales, Australia, where this species is known to occur in small numbers.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 200 - 900 m (Ref. 55584)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 465 - 465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 250 - 720m.
From 250 to 720 meters.

Habitat: bathydemersal. A little-known but common deepwater dogfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205). Gives birth to litters of 1-6 pups after an unknown gestation period (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centrophorus niaukang

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACAGCTCTTAGCTTACTTATTCGTACAGAATTAAGCCAACCGGGAACACTTCTGGGGGATGATCAAATCTACAATGTTATTGTGACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTTATGCCTGTGATAATCGGCGGGTTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGATATAGCTTTCCCCCGAATAAATAATATAAGCTTTTGACTATTACCCCCCTCTCTCTTATTACTTTTAGCCTCTGCTGGTGTTGAAGCGGGCGCTGGAACCGGCTGAACGGTTTACCCTCCTCTTGCTGGTAATATAGCCCATGCTGGAGCATCCGTAGATTTAGCCATCTTCTCACTTCATTTAGCCGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCCATTTCTCAATATCAAACGCCACTCTTTGTTTGATCTATCCTTGTAACCACCGTTCTTCTCCTACTTGCTCTCCCTGTCCTTGCCGCTGCAATTACAATACTGTTAACTGACCGTAATCTAAATACAACATTTTTTGACCCTGCAGGAGGAGGAGACCCCATTCTTTACCAACATTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centrophorus niaukang

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Fowler, S.L. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group, Fowler, S. & Musick, J.A. (Shark Red List Authority)

Contributor/s

Justification
Deepwater gulper sharks are highly vulnerable to population depletion through fisheries bycatch because of their highly K-selected biology. This species is very widely, but patchily distributed world-wide. Records are sparse and it is probably not abundant. The virtually complete absence of data on extent of occurrence, population size, or any indicator of population trend might be considered to warrant a Data Deficient assessment, but a Near Threatened assessment reflects widespread concern that bycatch of this biologically highly-vulnerable species has been occurring and will continue to occur in deepwater fisheries, possibly through a significant proportion of this species? range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population and subpopulation size unknown; common in some areas, not in others.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Targeted widely (Northeast Atlantic, southern Africa, the Maldives, Australia, China, Taiwan and probably elsewhere) by line and trawl fisheries for its liver oil, which is rich in squalene, and meat for human consumption. Also a bycatch of mixed species deepwater trawl fisheries. Identification problems compounded by an absence of routine data collection at species level in most of these fisheries means that there are no available data on trends in catch per unit effort in most of these fisheries, but where such data are available significant declines have been recorded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Taiwan gulper shark

The Taiwan gulper shark, Centrophorus niaukang, is a locally common, large deepwater shark.The Taiwan gulper shark is a junior synonym of gulper shark, Centrophorus granulosus (White & al.2013) [1]

Physical characteristics[edit]

The Taiwan gulper shark has no anal, two dorsal (with small spines) and a caudal fin with a more vertical rear edge. The maximum length of the shark is 154 centimetres (61 in).

Distribution[edit]

The Taiwan gulper shark is distributed patchily throughout the world, on outer continental shelves and upper slopes in the Atlantic, Indian, and Pacific oceans.

Habits and habitat[edit]

The Taiwan gulper shark lives at depths around 250 metres (820 ft).

See also[edit]

Notes[edit]

  1. ^ White, W.T.; Ebert, J.P; Gavin, G.J.P; Naylor, H.; Hsuan-Ching, H.; Clerkin, P.; Cotton, C.F. (2013). "Revision of the genus Centrophorus (Squaliformes: Centrophoridae): Part 1— Redescription of Centrophorus granulosus (Bloch & Schneider), a senior synonym of C. acus Garman and C. niaukang Teng.". Zootaxa 3752 (1). pp. 35–72. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!