Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

Wide, if sporadic, range in the Atlantic and Indo-West Pacific, on outer continental shelves and upper slopes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cosmopolitan: Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs on or near the seabed on outer continental shelves and upper slopes at 98 to 1,000 m. Eats bony fishes, small dogfish sharks, skates, squid and crustaceans. Ovoviviparous (aplacental viviparous) with one to six (mostly four to six) pups per litter, born at 30 to 45 cm total length (TL). Matures at around 110 cm (males) to 140 cm (females) with maximum length approximately 170 cm. Although there is limited information on the biology of this species, gulper sharks are considered to have very low rates of population increase and to be very vulnerable to over-exploitation by fisheries. For example, Graham et al. (1997) report documented declines of 99.5% in abundance of Centrophorus species off southern New South Wales, Australia, where this species is known to occur in small numbers.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 465 - 465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 250 - 720m.
From 250 to 720 meters.

Habitat: bathydemersal. A little-known but common deepwater dogfish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centrophorus niaukang

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATCTTTGGTGCATGAGCAGGAATAGTGGGCACAGCTCTTAGCTTACTTATTCGTACAGAATTAAGCCAACCGGGAACACTTCTGGGGGATGATCAAATCTACAATGTTATTGTGACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTTATGCCTGTGATAATCGGCGGGTTCGGAAACTGATTAGTACCTTTAATGATTGGTGCACCAGATATAGCTTTCCCCCGAATAAATAATATAAGCTTTTGACTATTACCCCCCTCTCTCTTATTACTTTTAGCCTCTGCTGGTGTTGAAGCGGGCGCTGGAACCGGCTGAACGGTTTACCCTCCTCTTGCTGGTAATATAGCCCATGCTGGAGCATCCGTAGATTTAGCCATCTTCTCACTTCATTTAGCCGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCCATTTCTCAATATCAAACGCCACTCTTTGTTTGATCTATCCTTGTAACCACCGTTCTTCTCCTACTTGCTCTCCCTGTCCTTGCCGCTGCAATTACAATACTGTTAACTGACCGTAATCTAAATACAACATTTTTTGACCCTGCAGGAGGAGGAGACCCCATTCTTTACCAACATTTANNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centrophorus niaukang

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
Fowler, S.L. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Shark Specialist Group Australia & Oceania Regional Group, Fowler, S. & Musick, J.A. (Shark Red List Authority)

Contributor/s

Justification
Deepwater gulper sharks are highly vulnerable to population depletion through fisheries bycatch because of their highly K-selected biology. This species is very widely, but patchily distributed world-wide. Records are sparse and it is probably not abundant. The virtually complete absence of data on extent of occurrence, population size, or any indicator of population trend might be considered to warrant a Data Deficient assessment, but a Near Threatened assessment reflects widespread concern that bycatch of this biologically highly-vulnerable species has been occurring and will continue to occur in deepwater fisheries, possibly through a significant proportion of this species' range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population and subpopulation size unknown; common in some areas, not in others.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Targeted widely (Northeast Atlantic, southern Africa, the Maldives, Australia, China, Taiwan and probably elsewhere) by line and trawl fisheries for its liver oil, which is rich in squalene, and meat for human consumption. Also a bycatch of mixed species deepwater trawl fisheries. Identification problems compounded by an absence of routine data collection at species level in most of these fisheries means that there are no available data on trends in catch per unit effort in most of these fisheries, but where such data are available significant declines have been recorded.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!