Overview

Comprehensive Description

Description: Body relatively thin, narrow and long with a large eye and a terminal, small mouth. Pectoral fins medium, reach to vent. Pelvic fins very short. Dorsal and anal-fin bases long, caudal peduncle short and relatively wide. Melanophores limited to the fin-ray membranes, typically occurring in five groups: at the front, mid, and rear dorsal fin and the front and rear anal fin. Each melanophore group covers from one to five fin spines or rays. Transitional recruits have a mid-dorsal fin ocellus, a white-edged black spot on the upper base of the central caudal-fin rays and a patchy pattern of melanophores along the body with a mid-body bar extending from the dorsal ocellus down onto the anterior anal-fin rays.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults found on shallow patch or seaward reefs down to 55 m (Ref. 9710); juveniles and subadults in shallower (1 to 5 m) coral reefs (Ref. 3726). Feeds on mollusks, sea urchins, crustaceans, and brittle stars (Ref. 9710). Marketed fresh (Ref. 3726).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the western Atlantic from North Carolina, USA and Bermuda to Trinidad and Tobago. In Brazil, it occurs only in the oceanic islands of Fernando de Noronha, Atol das Rocas and St. Paul’s Rocks, and not along the continental coast.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda, throughout the West Indies, Florida, the Carolinas, and Gulf of Mexico; found at the Brazilian oceanic islands of St. Paul's Rocks, Fernando de Noronha and Atol das Rochas. Does not co-occur with H. brasiliensis in Brazilian coastal waters.
  • Rocha, L.A. and R.S. Rosa 2001 Halichoeres brasiliensis (Bloch, 1791), a valid wrasse species (Teleostei: Labridae) from Brazil, with notes on the Caribbean species Halichoeres radiatus (Linnaeus, 1758). J. Ichthyol. Aquat. Biol. 4(4):161-166. (Ref. 48669)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 12
  • Rocha, L.A. and R.S. Rosa 2001 Halichoeres brasiliensis (Bloch, 1791), a valid wrasse species (Teleostei: Labridae) from Brazil, with notes on the Caribbean species Halichoeres radiatus (Linnaeus, 1758). J. Ichthyol. Aquat. Biol. 4(4):161-166. (Ref. 48669)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 510 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

51.0 cm TL (male/unsexed; (Ref. 7251))
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: The fin-ray count of D-IX,11 A-III,12 and Pect-13 indicates Halichoeres and is shared by most of the Caribbean species. Larval H. radiatus are identical to most other larval Halichoeres with five patches of median-fin melanophores and can only be identified by DNA sequencing.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Two pairs of enlarged canines in lower jaw; anterior lateral line scales with 3 or more pores per scale; body depth 2.7-3.6 in SL; distinctive 4 or 5 narrow pale bars along the dorsum, more evident in specimens up to 20 cm SL; yellow margin on caudal fin (Ref. 48669).
  • Rocha, L.A. and R.S. Rosa 2001 Halichoeres brasiliensis (Bloch, 1791), a valid wrasse species (Teleostei: Labridae) from Brazil, with notes on the Caribbean species Halichoeres radiatus (Linnaeus, 1758). J. Ichthyol. Aquat. Biol. 4(4):161-166. (Ref. 48669)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef associated and is found from 1-55 m. Adults are found on shallow patches of coral or rocky reefs or deeper seaward reefs (Lieske and Myers 1994), juveniles and subadults are found in shallower (one to five m) coral reefs (Gomon 1978). It feeds on molluscs, sea urchins, crustaceans, and brittle stars (Lieske and Myers 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 2 - 55 m (Ref. 9710), usually 5 - 45 m (Ref. 27115)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 52 specimens in 1 taxon.
Water temperature and chemistry ranges based on 44 samples.

Environmental ranges
  Depth range (m): 0.4 - 18
  Temperature range (°C): 26.706 - 28.503
  Nitrate (umol/L): 0.174 - 1.474
  Salinity (PPS): 34.217 - 36.594
  Oxygen (ml/l): 4.456 - 4.687
  Phosphate (umol/l): 0.046 - 0.293
  Silicate (umol/l): 2.021 - 3.173

Graphical representation

Depth range (m): 0.4 - 18

Temperature range (°C): 26.706 - 28.503

Nitrate (umol/L): 0.174 - 1.474

Salinity (PPS): 34.217 - 36.594

Oxygen (ml/l): 4.456 - 4.687

Phosphate (umol/l): 0.046 - 0.293

Silicate (umol/l): 2.021 - 3.173
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 55m.
From 2 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cleaned by Elacatinus figaro observed off the coast of São Paulo, southeastern Brazil (Ref. 40102). Also cleaned by Pomacanthus paru observed at the reefs of the Abrolhos Archipelago, off eastern Brazil (Ref. 40094). Micro/macroinvertivore (Ref. 33499).
  • Bardach, J.E. 1959 The summer standing crop of fish on a shallow Bermuda Reef. Limnol. Oceanogr. 4:77-85. (Ref. 4950)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres radiatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGCGCCTGAGCTGGGATGGTAGGCACGGCCTTAAGCCTGCTTATTCGGGCTGAACTAAGCCAACCCGGCGCTCTCCTTGGGGACGACCAAATCTATAACGTAATCGTTACAGCGCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGGTTCGGAAACTGACTGATTCCTCTAATAATTGGGGCCCCAGACATGGCCTTCCCTCGAATGAATAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTTCTCCTCCTCGCCTCTTCTGGCGTTGAAGCCGGAGCCGGAACTGGTTGAACAGTCTACCCTCCTCTAGCAGGAAATCTTGCTCACGCCGGCGCATCCGTAGACCTGACAATTTTCTCCCTTCACTTAGCCGGTATTTCATCAATTTTAGGGGCCATTAACTTCATTACAACAATTATTAATATGAAGCCTCCTGCTATCTCCCAATACCAAACCCCCCTATTTGTATGAGCAGTACTAATTACAGCCGTCCTACTTCTCCTTTCTCTCCCCGTCCTCGCTGCCGGGATTACAATACTTCTAACAGATCGAAACCTAAACACCACTTTCTTTGACCCTGCAGGAGGAGGTGACCCCATTCTATACCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres radiatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the western Atlantic and is common. There are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is considered to be common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Puddingwife wrasse

The puddingwife wrasse, Halichoeres radiatus, is a species of wrasse native to the western Atlantic Ocean from North Carolina to Bermuda, through the West Indies and Gulf of Mexico, to offshore islands of Brazil, being absent from Brazilian coastal waters. It can be found on reefs at depths from 2 to 55 m (6.6 to 180.4 ft), with younger fish up to subadults being found in much shallower waters from 1 to 5 m (3.3 to 16.4 ft). This species can reach 51 cm (20 in) in total length, though most do not exceed 40 cm (16 in). This species is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Rocha, L. & Craig, M. 2010. Halichoeres radiatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Halichoeres radiatus" in FishBase. August 2013 version.

Etymology According to the Marian Webster dictionary Puddingwife is an old no longer in use French term meaning a woman who sells sausage. Podyngwyf, fr. podyng, pudding blood sausage + wyf, wif woman.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!