Overview

Brief Summary

Biology

The adults spawn in May and June, and the eggs are deposited into depressions in the riverbed. As in river lampreys, a number of males mate with one female (5). The larvae (known as ammocoetes) live for three to seven years in the sand or mud, and filter organic matter from the water for nourishment (5). As they mature they develop eyes and the sucker-like mouth, and as sexual maturity is approached they stop feeding entirely. A few weeks after spawning the adults die (5). Unlike river and sea lampreys this species does not migrate out to sea, but spends the whole life-cycle in fresh water (it is not anadromous) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Lampreys are some of the most primitive vertebrates alive today, they are known as cyclostomes, which means 'round mouths' and refers to the fact that they are jawless, having instead a round sucker-like mouth. A further primitive characteristic is that the skeleton consists of cartilage and not bone (2). Lampreys are similar in shape to eels, and have a series of uncovered round gill openings (known as gill pores) on the sides of the head and a single nostril on the upper surface of the head (4). The brook lamprey is the smallest of the British lampreys (4), and has two dorsal (back) fins which are in close contact (2). It is grey-blue to green in colour and during the spawning period the areas around the mouth and the anal opening become rusty red (5). Brook lampreys are also known as 'pride' (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults are found in the lowland, piedmont and montane zone in clear, well oxygenated brooks (Ref. 59043). They live exclusively in freshwater; in middle and upper reaches of small streams and rivers, occasionally in lakes. Larvae lie buried in the substrate while adults live in the open water (Ref. 57699). Sexually mature adults have been observed burrowing in fine sand (Ref. 89241). Larvae of this species can serve as mid-term bio-indicators (Ref. 57699). They live in detritus-rich sands or clay sediments (Ref. 59043). Larval life is 5+ to 6+ years, with the smaller individuals of the latter year class delaying metamorphosis by one year. Metamorphosis occurs in September in the Czech Republic (Ref. 89241). Filter feeding larvae, non-feeding adults (= non-parasitic). Reproduction takes place upstream, from April to May (Ref. 30578). Duration of the life cycle is believed to last 6 years on average. Communal spawning in the same redd by L. fluviatilis and L. planeri has been reported in the River Tywi Basin, Wales (UK), in April, at a water temperature of 11 °C. Both species participated in constructing a redd about 23 cm in diameter and 5-8 cm deep, consisting of pebbles, gravel, and coarse sand. In the river Yeo, England (UK), peak spawning activity varies between 26 March and 24 April when water temperatures reach 10-11 °C. As the spawning season progresses, male:female ratios shift from 3.54:1 to 1.60:1. In the Czech Republic, both sexes participate in the redd construction in shady areas of streams that are 1-8 m in width and a few centimeters to 0.8 m in depth. Spawning occurs between 1 and 17 June at water currents 1-4 m/s and water temperatures 10-16 °C (Ref. 89241). Because of its small size and the mediocre quality of its meat, it is rarely fished. The larvae are utilized as bait (Ref. 30578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Great Britain north to Scottish highlands, rivers draining to North Sea north to Scotland and about Stavanger (Norway), Baltic Sea basin, Atlantic as far south as Adour drainage (France, Spain) and an isolated population in Tagus (Portugal), Mediterranean basin in France and western Italy (south to about Tevere drainage). Locally in Ireland, upper Volga, upper Danube and some of their tributaries, and Pescara drainage on Adriatic coast of Italy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe: Great Britain north to Scottish highlands, rivers draining to North Sea north to Scotland and about Stavanger (Norway), Baltic Sea basin, Atlantic as far south as Adour drainage (France, Spain) and isolated populations in Sado, Tagus and Douro drainages (Portugal), Mediterranean basin in France and western Italy (south to about Cilento drainage). Locally in Ireland, upper Volga, upper Danube and some of their tributaries and Pescara drainage on Adriatic coast of Italy. Appendix III of the Bern Convention (protected fauna).
  • Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p. (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The brook lamprey has declined in some areas of the UK but is relatively widespread and common in parts of England. In Scotland it is generally absent north of the Great Glen (7). In Europe it extends from Sweden to France (6), and has declined in parts of this range (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 2163)); max. reported age: 7 years (Ref. 12315)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Poorly developed fins, dorsal fins in contact in mature adults, blue-green back, yellow flanks, white ventral portion (Ref. 2163). Diagnostic features: Adults: 8.6-17.0 cm TL. Body proportions, as percentage of TL (based on 16 specimens measuring 10.6-13.3 cm TL): prebranchial length, 10.9-12.6; branchial length, 7.5-9.9; trunk length, 44.4-53.3; tail length, 25.4-31.4; eye length, 2.3-2.9; disc length, 5.2-7.0. Urogenital papilla length, as a percentage of branchial length, in ten spawning males measuring 11.1-14.0 cm TL, 21.4-52.6. Trunk myomeres, 60-65. Dentition: supraoral lamina, 2 unicuspid teeth; infraoral lamina, 7-9 teeth, usually all unicuspid, but occasionally one lateralmost bicuspid; 3 endolaterals on each side; endolateral formula, typically 2-3-2; 2 rows of anterials; first row of anterials, 9 unicuspid teeth; exolaterals absent; posterials absent; transverse lingual lamina, 9-13 unicuspid teeth, the median one enlarged; longitudinal lingual laminae each with about 9 unicuspid teeth. Velar tentacles, 4-6, with tubercles. Body coloration (preserved), dorsal and lateral aspects grayish, ventral surface whitish, dorsal fins and caudal fin yellowish. Some specimens display a prominent dark blotch at the apex of the second dorsal fin. The iris is yellow. Lateral line neuromasts unpigmented. Unpigmented caudal fin except for spawning individuals in which it is "weakly peppered". Caudal fin shape, spade-like (Ref. 89241). Sigmund Freud (Ref. 72450, 72451 ) described the development of the central nervous system of brook lamprey.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
Found in the lowland, piedmont and montane zone in clear, well oxygenated brooks. Ammocoetes live in detritus-rich sands or clay sediments.

Biology:
Non-predatory, freshwater resident. Timing of spawning season depends on latitude when temperature exceeds 9°C, starting in February in Italy and mid-June in Finland. Spawning individuals cease their normal daylight avoidance reaction and reproduce on sunny days. Males dig a shallow nest in habitats with moderate current. Spawners form large aggregations. Dies after spawning. Single individuals may survive until September. Ammocoetes stage usually lasts 21/2-3 1/2 years. Feeds on detritus and micro-organisms, starts metamorphosis in June-July (fully transformed individuals usually found in September), overwinters and spawns following spring. There are indications that L. planeri might be an heterogeneous (polyphyletic) assemblage of several lineages evolved independently from different populations of L. fluviatilis (see family introduction).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This freshwater species lives in small streams, rivers and lakes (6) with clean gravel beds to spawn in and silt or sand for the larvae (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults do not feed after metamorphosis (Ref. 6258). The species inhabits mostly submontane brooks and rivulets, the bed is mostly natural, the bottom sandy or gravelly with muddy places (Ref. 57699).
  • Maitland, P.S. and R.N. Campbell 1992 Freshwater fishes of the British Isles. HarperCollins Publishers, London.368 p. (Ref. 6258)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

They build small depressions in the gravel in the river bed in which they spawn. Adults die after spawning. Larvae hatch after 3-4 days.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampetra planeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAGCAGGAAATTTAGCCCACACAGGGGCCTCTGTTGACTTA---ACAATTTTCTCCCTTCACCTAGCTGGTATTTCATCAATTCTAGGGGCAGTCAACTTTATCACAACAATTTTTAATATAAAGCCCCCAACTATAACACAATACCAAATTCCTTTATTTGTTTGATCCGTTTTAATTACTGCAGTCCTCCTTCTTCTATCACTTCCTGTACTTGCAGCC---GCCATTACTATACTTTTAACAGATCGTAATTTAAATACATCTTTCTTCGACCCTGCAGGGGGAGGAGACCCAATTCTTTACCAACATCTATTTTGATTCTTTGGACATCCTGAAGTTTATATTCTAATCTTACCAGGCTTTGGAATTATCTCTCATGTAGTTGCCTATTACTCCGGAAAAAAA---GAACCATTTGGATATATAGGAATAGTCTGAGCAATAATGGCTATTGGGTTGCTAGGGTTTATTGTATGAGCCCATCACATATTTACAGTAGGAATAGATGTTGATACACGAGCCTACTTTACATCAGCCACAATAATTATTGCCATCCCAACAGGAGTTAAAGTTTTTAGCTGACTA---GCTACTCTCCATGGCGGA---AAAATCGTATGACACACCCCCATACTATGGGCCTTAGGCTTTATTTTCTTATTCACTGTAGGAGGACTCACCGGAATCGTTTTATCCAACTCATCACTAGATATTATCCTTCATGATACTTACTATGTAGTAGCCCACTTCCATTATGTA---TTATCCATAGGAGCTGTTTTCGCAATCATGGCGGGCTTCGTCCACTGATTCCCACTATTCACGGGCTATACACTTAACGAAACCTGATCAAAAGCACACTTTGTAATTATGTTTACTGGTGTAAATCTTACATTCTTCCCCCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lampetra planeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Freyhof, J.

Reviewer/s
Kottelat, M. & Smith, K.

Contributor/s
Kottelat, M.

Justification
Still rare in some areas, but populations have markedly recovered following earlier pollution problems in central Europe.

European Union 27 = LC. Same rationale as above.


History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed on Annex III of the Bern Convention and Annex II of the EC Habitats Directive (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is likely that the brook lamprey has been affected by pollution, river engineering works and changes in land use (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A number of areas have been proposed as candidate Special Areas of Conservation (SACs) for the brook lamprey. The areas chosen support healthy populations and reflect the geographical range of the brook lamprey in the UK as well as the range of habitat features required by the species (7). Although this should help to improve the conservation status of this primitive fish in the UK, it has been noted that further measures will be required to maintain the species (7). Draft Action Plans have been produced for the three lamprey species found in the UK in order to guide their conservation (2). The Life in UK Rivers Project is helping to conserve this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: public aquariums; bait: usually
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European brook lamprey

The European brook lamprey (Lampetra planeri, also known as the brook lamprey and the western brook lamprey) is a small European lamprey species that exclusively inhabits freshwater environments. This species should not be confused with the North American species Lampetra richardsoni, which is also known as the Western brook lamprey.

Description[edit]

This lamprey is the most common of the northern European species and is also the smallest. Adult brook lamprey measure from 12 to 14 cm (4.7 to 5.5 in). The very elongate body is dark blue or greenish above, lightening to yellowish off-white on the sides and pure white below. Like all lampreys these fish lack paired fins and possess a circular sucking disc instead of jaws. They have a single nostril and seven small gill openings on either side behind the eye. The teeth are blunt and they can be told from the closely related river lamprey (Lampetra fluviatilis) by the fact that the two dorsal fins are more closely linked together.[1]

Distribution[edit]

Although they are found in small streams, as their name suggests, they are also found in larger rivers throughout northern Europe as well as southern France, Italy, Sardinia, the Balkans and the upper reaches of the Volga. It is also found in southeast Alaska.

Biology[edit]

Unlike most species of lamprey, the adults do not migrate to the sea and do not have a parasitic phase. Adult brook lamprey do not feed and in springtime spawn in gravel close to the soft sediment in which they were previously resident. Adult brook lamprey spawn in small groups and die soon after spawning. The eggs hatch within a few days, after which the young larvae bury themselves in soft sediment with only the mouth protruding. The young lampreys are blind filter feeders, feeding on detritus and other organic matter for three to five years before maturing. Metamorphosis begins in the third or fourth year and is complete after the maturation of the gonads. Eyes and suction disk also develops during this time, while the intestinal tract degenerates and loses its function. The full transformation can take up to a year. Thus, these fish develop their teeth precisely when they are no longer able to eat. However, lampreys have been observed gripping stones with their teeth in order to build nests, showing that the teeth do in fact have a purpose.

References[edit]

  1. ^ "Brook lamprey: Lampetra planeri". NatureGate. Retrieved 2013-12-15. 
  • Animal, Smithsonian Institution, 2005
  • Fishbase
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!