Overview

Comprehensive Description

Biology

Prefers warm, well-oxygenated water, mainly larger rivers and lakes. All but the largest form roving schools of like-sized fish; aptly described as fierce and voracious. Feeds on whatever prey is most abundant but Brycinus, Micralestes, Barbus, and Limnothrissa are favored (Ref. 7248). Useful food fish in some areas (Ref. 4967).
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Hydrocynus vittatus is known from most of sub-Saharan Africa from Senegal to Ethiopia, and south to South Africa.

Central Africa: Hydrocynus vittatus is found throughout the Congo River basin. In Lower Guinea, it is found in the Cross and Sanaga basins.

Eastern Africa: This species is known from Lake Tanganyika and major affluent rivers, including Malagarasi river, as well as Lake Albert and Murchison Nile, Lake Turkana (Seegers et al. 2003) and Lake Rukwa. It is also present in the Lower Shire river, Rufigi and Ruaha Rivers. According to Hopson and Hopson (1982) in the Turkana Basin this species is principally riverine and ecological changes in the lake level have tended to inhibit incursions of H. vittatus into the lake. However, an erroneous identification by Worthington and Ricardo (1936) for H. forskahlii is also possible. In the latter case H. vittatus most likely does not occur in Kenya (Seegers et al. 2004).

Northeast Africa: It is present in the Ghazal and Jebel systems, White and Blue Niles, and Nile to Lake Nasser (also known as Lake Nubia).

Southern Africa: It occurs in the Zambezi and Okavango (but not the Kafue or Lake Malawi), south to the Save, Limpopo and Phongolo systems (Skelton 2001). It has also been found in Lake Kariba (Losse 1998).

Western Africa: In West Africa, this species occurs in the basins of the Chad, Niger/Benue, Ouémé, and Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Niger/Bénoué, Ouémé, Senegal, Nile, Omo, Congo, Lufira, Lualaba, Luapula, Zambeze, Limpopo, Rovuma, Shore, Rufiji , Ruaha, Wami, and Ruvu. Lakes - Bangwéolo, Moéro, Tanganyika, Upemba, Rukwa and Malagarazi. Also Okavango and lower reaches of coastal systems south to Pongolo (Ref. 7248). Also found in Lake Kariba (Ref. 27602).
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 8; Analspines: 3; Analsoft rays: 12
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 700 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

105 cm FL (male/unsexed; (Ref. 40637)); 70 cm FL (female); max. published weight: 28.0 kg (Ref. 40637); max. reported age: 8 years (Ref. 2754)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body profile less slender than H. forskalii. Eye < 70% of interorbital space. Long gill rakers. Tips of adipose and dorsal fins black. Forked edge of caudal fin black.
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Zambezi River Demersal Habitat

This taxon is one of a number of demersal species in the Zambezi River system of southern Africa. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 fish species present in the Zambezi River, including eel and shark taxa. The largest native demersal species present are the 117 centimeter (cm) long tiger fish (Hydrocynus vittatus), the 175 cm African mottled eel (Anguilla bengalensis labiata), the 120 cm Indonesian shortfin eel (Anguilla bicolor bicolor), the 200 cm Giant mottled eel (Anguilla marmorata), the 150 cm African longfin eel (Anguilla mossambica), the 183 cm Sampa (Heterobranchus longifilis), the 150 cm Cornish jack (Mormyrops anguilloides) and the 700 cm largetooth sawfish (Pristis microdon).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Kunene River Demersal Habitat

This taxon is one of a number of demersal species in the Kunene River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Kunene River rises in the central highlands of Angola, and thence flows southward to form a major element of the border between Namibia and Angola before the final discharge is to the Atlantic Ocean in the vicinity of the Angola-Benguela Front. The geometry of the Kunene riparian zone is distinctly narrow, with rugged arid landscapes persisting on both sides of the river over long distances, and a virtual lack of any extensive floodplains.

There is a relatively high rate of endemism of aquatic biota in the Kunene. Proposed expansion of dams on the Kunene poses a threat to biodiversity in the river, especially regarding proposals at Epupa Falls. However, a greater threat to the Kunene is a plan by Angola to greatly expand withdrawal of water from the river to expand irrigated agriculture by 600,000 hectares; not only will this action significantly diminish downriver flow rates, but also add considerable nitrate, herbicide and pesticide substances to the river.

The catchment area of the Kunene Basin is approximately 106,560 square kilometres (41,143 square miles) in area, of which 14 100 km² (13%) lies within Namibian territory. Its mean annual discharge is 174 cubic meters per second (6145 cubic feet per second) at its mouth on the Atlantic. Water quality of the Kunene River is relatively high, since the human population density and agricultural intensity is relatively low, including a conspicuous absence of overgrazing. However, bacteria and other microbial pathogens pose a material threat to Kunene water quality, due to the fact that only a small fraction of the domestic wastewater in Angola is treated;

Regarding freshwater bivalves, the central reaches of the Kunene manifest particularly high endemism, similar to parts of the Okavango, Chobe, Upper Zambezi and Etosha Pan basins. The bivalve Etheria elliptica, which also occurs in the Upper Zambezi, is a freshwater mussel in the family Etheriidae, known from a limited extent of the central Kunene River in Angola. It is threatened by proposed dam construction on the Kunene.

There are two endemic denmersal fish in the Kunene: the 26 centimeter (cm) long demersal Kunene happy (Sargochromis coulteri) and the demersal fish Hippopotamyrus longilateralis.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Hydrocynus vittatus is a demersal, potamodromous species. It prefers warm, well-oxygenated water, mainly larger rivers and lakes. All but the largest form roving schools of like-sized fish; aptly described as fierce and voracious. Hydrocynus vittatus feeds on whatever prey is most abundant but Brycinus, Micralestes, Barbus, and Limnothrissa are favoured (Skelton 1993). It is a useful food fish in some areas (Eccles 1992). Breeding takes pace on a very few days each year, when the first good rains have swollen rivers and streams, usually in December and January at which time it undertakes a spawning migration up rivers and into small streams (Jackson 1961). The females spawn a great number of eggs in very shallow water, among the stems of grasses and other submerged and partly submerged vegetation and here the young live until the falling of the flood water forces them out of this refuge (Jackson 1961).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Very abundant in Lake Rukwa but absent from Nyasa basin (Ref. 4967). Frequency of occurence in Caprivi: abundant in sandy streams, abundant on rocky streams, common in standing deep water (Ref. 37065).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Hydrocynus vittatus (Hydrocynus vittatus (characid fish)) preys on:
Insecta
Diptera
Sarortherdon macrochir
Haplochromis darlingi
Tilapia rendalli

Based on studies in:
Africa, Lake McIlwaine (Lake or pond)

This list may not be complete but is based on published studies.
  • B. E. Marshall, The fish of Lake McIlwaine. In Lake McIlwaine: the eutrophication and recovery of a tropical man-made lake (J. A. Thornton, Ed.) Vol 49 Monographia Biologicae, D. W. Junk Publishers, The Hague, pp. 156-188, from p. 180 (1982).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hydrocynus vittatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hydrocynus vittatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTCTACCTACTTTTTGGTGCTTGAGCTGGTATAGTGGGGACTGCTCTTAGCCTCCTAATCCGGGCTGAGCTAAGTCAGCCCGGATCTCTCCTCGGAGACGACCAGATTTATAATGTTATTGTTACAGCACATGCATTCGTAATAATCTTCTTCATGGTGATGCCAATTATAATCGGCGGCTTCGGGAACTGACTGGTGCCCCTAATAATTGGCGCCCCTGACATAGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTGCCGCCATCCTTCCTTCTTCTCTTGGCTTCCTCAGGGGTGGAAGCAGGGGCCGGGACAGGCTGAACAGTATACCCCCCTCTTGCTGGAAATCTTGCCCACGCAGGCGCCTCCGTTGATCTAACTATCTTCTCTCTTCACCTTGCAGGGGTCTCTTCAATTCTTGGTGCAATTAATTTCATCACAACCATTATCAACATGAAACCCCCTGCCATCTCACAATACCAAACCCCTTTATTCGTGTGGGCTGTTTTAATTACAGCTGTACTCCTACTGCTCTCCCTCCCCGTGCTAGCCGCAGGGATCACAATGCTTCTAACGGACCGGAACTTAAACACCACCTTCTTTGACCCTGCTGGAGGGGGAGACCCAATTCTTTACCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Bills, R., Cambray, J., Getahun, A., Hanssens, M., Marshall, B., Moelants, T. & Tweddle, D.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution. Although it is locally depleted by heavy fishing pressure, it is generally common and abundant, and is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central, eastern, north eastern, southern and western Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is generally common and widespread. In Lake Kariba on the Middle Zambezi River, its population fluctuated considerably, mostly in relation to the abundance of the introduced clupeid Limnothrissa miodon which now forms a major part of its diet (Kenmuir 1973, Marshall 1985). It is commercially exploited in Lake Rukwa, forming about 3.9% of the yield. In Mtera dam, species composition in the catches show a decline from 26.1% in 1987 to 14.3% in 1991, and 7% in 1996.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Tigerfish have declined in some rivers in southern Africa due to pollution, water abstraction and obstructions such as dams and weirs that prevent passage. Unregulated gillnet fisheries locally threaten the species. East African populations are threatened by heavy fishing pressure, silt loading due to agricultural activities/ deforestation, and pollution due to pesticides for agricultural use. Threats from other regions are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected in some reserves in southern Africa. It has been successfully artificially bred in captivity (Skelton 2001). Management of local gillnet fisheries is needed in many riverine fisheries, as is construction of fishways around weirs and dams.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hydrocynus vittatus

Hydrocynus vittatus, the African tigerfish, tiervis or ndweshi[2] is a predatory freshwater fish distributed throughout much of Africa. This fish is generally a piscivore but it has been observed leaping out of the water and catching barn swallows in flight.[3][4]

Appearance[edit]

The African tigerfish is overall silvery in colour, with thin black stripes running horizontally. It has an elongated body and a red, forked caudal fin with a black edge. Its head is large, as well as its teeth, of which there are eight per jaw. The teeth are sharp and conical which are used to grasp and chop prey.[5] They are able to replace their teeth simultaneously on the upper and lower jaws.[6] Males are larger and more full-bodied than females.[5] It grows to a length of 105 centimetres (41 in) SL.[2]

Distribution[edit]

This species' distribution covers the Niger/Bénoué, Ouémé River, Senegal River, Nile, Omo River, Congo River, Lufira, Lualaba River, Luapula, Zambezi, Limpopo River, Rovuma, Shire River and Wami River; as well as Lakes - Lake Bangweulu, Moéro, Tanganyika, Upemba, Rukwa and Malagarazi. It is also found in the Okavango Basin and lower reaches of coastal systems south to the Pongola River and in man-made Lake Kariba and Schroda Dam.[2]

Ecological significance[edit]

Tigerfish are an important food and income source for locals. Not only do they provide a natural source of protein, the presence of the fish also promotes tourism through recreational and sport fishing. As a result their ecological and economical importance, African tigerfish have been extensively studied by conservation groups and university researchers.[6]

Habitat and ecology[edit]

African tigerfish mainly live near the bottom of the large freshwater rivers and lakes they inhabit.[1] During the day they tend to be found closer to the surface and then move towards the bottom at night.[6] They thrive in highly oxygenated water in warm climates.[1]

Population and conservation status[edit]

This species is common and widespread over most of its range. In the most studied population, that of Lake Kariba on the Middle Zambezi River, the population fluctuated markedly, apparently in direct relation to the abundance of the introduced clupeid Limnothrissa miodon which forms a major part of its diet. There is a commercial fishery in Lake Rukwa, where it forms about 3.9% of the yield.

Hydrocynus vittatus have declined in some river systems in southern Africa as a result of pollution, water abstraction and obstructions by dams and weirs that prevent migration. It is locally threatened by unregulated gillnet fisheries and has been placed on the South African protected species list. In east Africa, threats to populations include overfishing, reductions in water quality due to agricultural activities and deforestation, and pesticide pollution.[1] According to the IUCN Red List of Threatened Species, tigerfish are of least concern with a wide distribution but are protected in some reserves.[6]

Behaviour[edit]

Smaller African tigerfish can be found roaming the waters in schools containing similar sized fish. Larger African tigerfish tend to live and hunt alone.[1] The breeding habits of this fish are somewhat illusive[6] but it is thought that breeding may take place over a couple days during December or January. The timing depends on when the rivers and streams begin to swell due to the start of the rainy season. Females will lay their eggs in submerged vegetation in shallow water close to the shore.[1] Hatchling African tigerfish will remain in the safety of the vegetation until the water levels become low enough to force them further into the water.[1] These fish may migrate up to 100 km within the stream or river they inhabit.[7]

Feeding behaviour[edit]

These fish are fierce hunters and are mostly piscivorous and tend to eat whatever fish is most available. Smaller fish will hunt in large schools while larger African tigerfish hunt alone. Favoured prey fish include cichlids, Gobiidae, Cyprinidae, and Clariidae. Insects and zooplankton may also be part of the African tigerfish’s diet, especially during juvenile stages of life.[1][6]

A highly unusual feeding behavior has been confirmed in the Schroda Dam population of Hydrocynus vittatus. The fish jump out of the water and catch barn swallows Hirundo rustica on the wing as they fly near the surface of the lake feeding on insects. This behaviour was speculated previously but this was the first time it had been observed during a specific research project. The researchers observed an average success rate of 25% for predation attempts, with as many as twenty birds caught per day over a relatively small lake (4.1 x 106 m³). African tigerfish were observed to pursue the birds from the surface further below the water. The depth of pursuit will affect the fish’s perception of the bird due to light refraction in the water. It is thought that these tigerfish will pursue the bird at a depth that allows the individual to perceive the birds the easiest. This is the only documented instance of a freshwater fish exhibiting this particular behavior.[3][4] Other freshwater fish have been observed catching birds that are swimming or floating on the water, but not catching them mid-flight.[3][4]

Pet trade[edit]

Due to its ferocious appearance, people may be tempted to keep the African tigerfish as a pet. However, this is generally not recommended and should only be attempted by those with advanced skills in keeping freshwater aquariums.[5] These fish can get extremely large and require at least a 2400 L tank.[5][8] They do not get along well with any fish smaller than them (even of their own species) since smaller fish make up a majority of their diet.[5] As they grow larger, these fish can become very difficult to handle. This is especially true because of their aggressive nature and sharp teeth.[8] For these reasons, having this fish as a pet is not recommended. If someone is set on having one, they need to check their local wildlife laws to determine if import of this fish is legal. It is illegal to import this species into Texas, Utah, and Florida.[9][10]

References[edit]

  1. ^ a b c d e f g h "’’Hydrocynus vittatus’’". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. 2010. 
  2. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2013). "Hydrocynus vittatus" in FishBase. December 2013 version.
  3. ^ a b c O'Brian, G.C.; Jacobs, F., Evans, S. W. & Smit, N. J. (2013). "First observation of African tigerfish Hydrocynus vittatus predating on barn swallows Hirundo rustica in flight". Journal of Fish Biology 84 (1): 263–266. doi:10.1111/jfb.12278. Retrieved 10 January 2014.  Includes a video.
  4. ^ a b c Ella Davies (13 January 2014). "African tigerfish catch swallows in flight". Nature News. BBC. Retrieved 13 January 2014.  Includes a video.
  5. ^ a b c d e African Tiger Fish, Animal-World Pet and Animal Information
  6. ^ a b c d e f Smit, N.J.; Wepener, V.; Vlok, W.; Wagenaar, G.M. (Jan 2013). "Conservation of tigerfish, Hydrocynus vittatus, in the Kruger National Park with the emphasis on establishing the suitability of the water quantity and quality requirements for the Olifants and Luvuvhu rivers". Water Research Commission. 
  7. ^ Hydrocynus vittatus, Encyclopedia of Life
  8. ^ a b "Hydrocynus vittatus". Seriously Fish. 
  9. ^ Tropical Fish Keeping
  10. ^ African Tiger Fish Hydrocynus vittatus, Live Aquaria
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!