Overview

Comprehensive Description

Biology

Life history characteristics for the family specify that this group is oviparous, with distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Indian Ocean: known only from the Gulf of Oman.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Oman: Arabian Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 14 - 15; Analspines: 2; Analsoft rays: 14 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 6 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 4 - 7
  Temperature range (°C): 26.151 - 26.151
  Nitrate (umol/L): 3.114 - 3.114
  Salinity (PPS): 36.032 - 36.032
  Oxygen (ml/l): 4.462 - 4.462
  Phosphate (umol/l): 0.546 - 0.546
  Silicate (umol/l): 4.277 - 4.277

Graphical representation

Depth range (m): 4 - 7
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 6m.
From 1 to 6 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacentrus arabicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCCTTAAGCCTCCTCATTCGAGCGGAACTAAGCCAACCAGGCGCACTCTTAGGAGACGACCAAATTTATAACGTCATTGTTACCGCACACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTCTAATTGGAGGCTTCGGAAATTGATTAGTGCCCCTTATACTAGGGGCCCCCGATATGGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTTCTCCTGCTCGCTTCTTCTGGTGTTGAAGCCGGGGCCGGGACAGGTTGAACTGTTTACCCCCCTCTGTCTGGAAATCTCGCCCATGCAGGAGCATCCGTAGACTTAACCATTTTCTCCCTCCACCTGGCAGGTATTTCATCAATTCTAGGGGCAATCAACTTTATTACCACAATTATTAACATGAAACCTCCGGCCATCTCACAGTATCAAACTCCTTTATTTGTTTGAGCCGTCCTAATCACTGCTGTACTTCTTCTCCTTTCTCTCCCCGTTCTAGCTGCTGGTATCACTATGCTCCTAACCGACCGAAATCTTAACACCACATTCTTCGACCCCGCAGGAGGGGGAGATCCAATTCTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacentrus arabicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!