Overview

Comprehensive Description

Biology

Prefers coral reefs and clear water. In the Gulf of Mexico, it occurs in clear deep reefs (at least 45 m). At Bermuda and the West Indies, the species is common in shallow water, but it usually hides in caves or under ledges during the day. The species is protogynous with females maturing at 16 cm TL and transforming to males at about 20 cm. Males are territorial. Feeds mainly on small fishes and crustaceans. May follow morays and snake eels to feed on flushed preys. Wary, but approachable (Ref. 9710).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

General
Cephalopholis fulva is a western Atlantic species ranging from South Carolina (USA) and Bermuda to southern Brazil, including Atol das Rocas and Fernando de Noronha (Froese and Pauly 2006, Teixeira 2005), Trindade Island (Gasparini and Floeter 2001), and St. Paul’s Rocks (Feitoza et al. 2003).

Specific
Antigua and Barbuda, Bahamas, Barbados, Belize, Bermuda, Brazil, Cayman Islands, Colombia, Cuba, French Guiana, Grenada, Haiti, Jamaica, Martinique, Mexico, Netherlands Antilles, Panama, Puerto Rico, Saint Lucia, Saint Vincent and the Grenadines, South Africa, Trinidad and Tobago, United States, British Virgin Islands, and U.S. Virgin Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: South Carolina, USA and Bermuda to southern Brazil.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 14 - 16; Analspines: 3; Analsoft rays: 9
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 410 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 11 years (Ref. 36271)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body and fins red; many small blue spots edged with black line scattered on body; dorsal edge of caudal peduncle with 2 prominent black spots; a pair of black blotches on tip of lower jaw (Ref. 13608).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Cephalopholis fulva is a reef-associated, non-migratory species, that prefers coral reefs and clear water from depths of 1 to 40 m. Found above rocks and coral heads, rarely in the water column, usually hides in caves or under ledges during the day. In the Gulf of Mexico, it occurs in clear deep reefs (at least 45 m). At Bermuda and the West Indies, the species is common in shallow water, but it usually hides in caves or under ledges during the day. Wary, but approachable. Cleaned by Pederson's cleaner shrimp (Periclimenes pedersoni), scarlet striped cleaner shrimp (Lysmata grabhami), and goby (Gobiosoma evelynae and others) as observed on the coral reefs in Bonaire, Netherlands Antilles. Also cleaned by Thalassoma noronhanum observed at Fernando de Noronha Archipelago off northeastern Brazil (Froese and Pauly 2006).

Reproduction
The species is protogynous with females maturing at 16 cm TL and transforming to males at about 20 cm (Coehlo 2001). Males are territorial and form harems. Mature females transform to males at a length of about 20 cm. Spawning occurs just before sunset over several days, and a male will spawn daily with each of the several females in his harem. Spawning is pelagic and occurs in small groups composed of one male and multiple females. Fecundity estimates range from about 150,000 to 282,000 eggs per female; with eggs 0.95 mm in diameter and having a single oil globule. Larvae are reported to have a long period of larval duration with a large capability of dispersion (Freitas et al. 2003).

Although ripe ovaries are found from November to March off the west coast of Puerto Rico, spawning activity appears to be limited to several days around the last quarter and new moon phases during January and February (Figuerola et al. 1997). In some areas, the spawning season may be protracted. For example, off the central coast of Brazil, the period of reproductive activity can last up to ten months (Coelho 2001). However, shorter spawning periods were observed in other areas (Heemstra and Randall 1993, Shapiro 1987, apud Araújo and Martins 2006).

Feeding
Feeds mainly on small fishes and crustaceans (Sazima et al. 2005, Randall and Bishop 2004, Gasparini et al. 2001, Francini-Filho et al. 2000). May follow morays and snake eels to feed on flushed prey. The coney is a diurnal sit-and-wait predator, occasionally roving near the bottom, or following bottom-disturbing grubbers (Francini-Filho et al. 2000, Sazima 1986). Juveniles mimic damselfish and feed opportunistically on fishes within damselfish schools (Sazima et al. 2005). Coney is alert and opportunistic predator, as other epinepheline groupers and would be expected to inspect almost every moving animal (Sazima and Grossman 2005). Coney is the dominant carnivore in Atol das Rocas (and nearby Fernando de Noronha), and in some tropical coastal sites like Tamandaré and Guarapari Islands (Ferreira et al. 2004).

Age, growth and maturity
Potts and Manooch (1999) examined the otoliths from 55 coney that were collected during 1979 to 1997 from North Carolina to the Dry Tortugas, Florida. The maximum reported age was 11 years and maximum size was 39.7 cm (15.7 in) TL. Araujo and Martins (2005) reported and size-ranges of 172 to 428 mm total length (TL) and maximum observed ages of 25 years, a maximum age well above that previously reported for coney. The von Bertalan¡y growth equation was TLt¼316(17e70.138(tþ5.301). Natural mortality rate is estimated as 0.18 (Ault et al. 1998). The estimated theoretical growth parameters show that coney grows fast in early life, achieving about 60% of the theoretical maximum size in the first year and then growing very slowly after the first few years (Araújo and Martins 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 2 - 150 m (Ref. 26938), usually 2 - 35 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1028 specimens in 1 taxon.
Water temperature and chemistry ranges based on 769 samples.

Environmental ranges
  Depth range (m): 0.4 - 88
  Temperature range (°C): 23.665 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.667 - 37.096
  Oxygen (ml/l): 4.285 - 4.888
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.4 - 88

Temperature range (°C): 23.665 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.667 - 37.096

Oxygen (ml/l): 4.285 - 4.888

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Prefers coral reefs and clear water. In the Gulf of Mexico, it occurs in clear deep reefs (at least 45 m). At Bermuda and the West Indies, the species is common in shallow water, but it usually hides in caves or under ledges during the day. Males are territorial. Feeds on fish and benthic invertebrates (Ref. 33). Carnivore (Ref. 33499, 57616). Also cleaned by Thalassoma noronhanum observed at Fernando de Noronha Archipelago off northeastern Brazil (Ref. 36301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mature females transform to males at a length of about 20 cm. Spawning occurs just before sunset over several days, and a male will spawn daily with each of the several females in his harem. Fecundity estimates range from about 150,000 to 282,000 eggs per female; with eggs 0.95 mm in diameter and having a single oil globule.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis fulva

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCTCTTAGCCTCTTAATCCGGGCTGAACTTAGCCAACCCGGTGCCCTACTCGGCGACGATCAAATCTACAATGTAATCGTTACGGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGATTCGGAAACTGACTTATTCCATTAATAATTGGTGCCCCCGACATGGCATTCCCTCGAATGAACAATATAAGCTTCTGGCTCCTTCCACCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCTGGTGCTGGTACTGGCTGAACAGTTTACCCACCCCTAGCTGGTAACCTAGCCCATGCAGGTGCCTCTGTTGACCTAACTATCTTCTCCCTACACTTAGCAGGTATTTCCTCAATCCTGGGGGCAATCAACTTCATTACCACAATTATCAACATGAAACCTCCTGCCATTTCTCAATATCAAACACCCCTATTTGTTTGAGCTGTCCTAATTACAGCTGTTCTTCTTCTCCTCTCCCTTCCTGTCCTTGCCGCCGGTATTACAATGCTTCTAACAGACCGAAATCTTAACACCACCTTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis fulva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ferreira, B.P., Gaspar, A.L.B., Marques, S., Sadovy, Y., Rocha, L., Choat, J.H., Bertoncini, A.A. & Craig, M.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis fulva is listed as Least Concern owing to its relatively wide distribution and relative abundance in fished areas and because it occurs in marine protected areas in several locales within its distributional range. However, fishing pressure for the species appears to be increasing owing to a shift to smaller target species following the demise of larger commercially valuable fishes. Therefore, the coney is now exploited on a heavier, more commercial basis than in the past and warrants occasional re-evaluation as more fisheries data become available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Common even in intensively fished areas (Sadovy 1992, Heemstra and Randall 1993, Froese and Pauly 2000, Roberts pers. obs.), including in western Atlantic and Trindade (Gasparini and Floeter 2001).

Fisheries-dependent data
Cephalopholis fulva is caught in mixed catches in shallow waters in Caribbean. A decrease in catch was observed in the 80’s following an increase in the in trap effort (Bannerot et al. 1987). Morris et al. (2000) states that coney is a very important species in the commercial fisheries of the West Indies. Scarce in sampling fisheries in Caribbean sea (Martinique) (Gorbet 1990). In St. Paul’s Rocks is was considered rare in 2001. Authors think that this minor population originated from Fernando de Noronha where is very common (Feitoza et al. 2003).

Genetic flow: Freitas et al. (2003), using isozymes’ electrophorese, analysed samples from populations of Cephalopholis fulva, from the Atol das Rocas (mid Atlantic) and the Northeastern Brazilian Coasts, and found no genetic difference, concluding that there is genetic flow between the Atoll and the coast (genic identity, I = 1,000; FST = 0,048 P>0,05). They speculated that the high homogeneity might be associated to a elevated dispersion capability and larval production.

Santa Lucia
The fisheries database shows 2005 annual fish landings for Cephalopholis fulva of 4.59 tons (S. Scott, Senior Fisheries Biologist, Department of Fisheries, Ministry of Agriculture, Forestry and Fisheries, Point Seraphine, Castries, Saint Lucia, pers. comm.).

Brazil
Coney is a relatively abundant species of the line fishing fleet between Cabo São Tomé and Salvador (Brazilian Coast) and also along the northeastern Brazilian coast, where it is the most abundant serranid registered in artisanal catch (Lessa and Nóbrega, 2000). In this area, is caught together with lutjanid species and is one of the species responsible for characterizing the typologies in the reef fishery of northeastern Brazil (Fredou et al. 2006). Artisanal catch data from northeastern Brazil showed coney to represent 2.4% of total abundance and occurred in 15% of catches overall (Fredou et al. 2006). However, these figures may underestimated take of coney, which is also used as live bait, consumed on board or taken home and thus not registered in statistics. Klippel et al. (2005) estimated landings of coney in the Abrolhos-Vitória area as 1,116 t/year, almost six times higher than reported in official statistics. Catch per unit effort estimated for the region varied between 0.03 and 3.35 kgs/fisher/day (Klippel et al. 2005).

Fishery-independent data
Coney was the most abundant serranid during surveys in Brazilian reefs using UVC (mean/m²) and significantly more abundant in unfished areas (Ferreira et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General
The main threats to Coney are overfishing.

Overfishing
In the Caribbean Sea and South Atlantic Ocean the status of coney is considered unknown (Status of Fisheries, 1997-2006), although the species is considered at lower risk extinction. Although this species is very important in the West Indian commercial fisheries, coney are a relatively small, early reproducing fish, and coney are shown to be common even in intensively fished areas (Sadovy 1992, Heemstra and Randall 1993, Morris et al. 2000).

Honduras
In Nassava Island (one of nine National Wildlife Refuges administered by the US Fish and Wildlife Service as part of the Caribbean Islands National Wildlife Refuge Complex), grouper considered common in the 1970s and 1990s, were rare during a study conducted by McClellan and Miller in 2002, and preliminary analysis suggests serial overfishing is occurring (Miller 2003). In Haiti, since large grouper species are extremely rare within fish community in recent years, smaller grouper such as coney are now targeted (Miller 2003).

Brazil
The collapse of the Abrolhos-Vitoria (17 to 18° S) fisheries in the 1980s led fishers to turn to other resources. By the end of the 80’s, a new market developed with the deep frozen or fast frozen techniques. The mains targets for this fishery are lutjanids and smaller serranids, including coney and yellow tail snapper (from Martins et al. 2005).

In the 1990s, coney was one of the species most used as live bait in commercial fisheries in Northeast of Brazil for catch of large fishes, such as black grouper and was also traditionally consumed by fishermen and their families. Today, however, coney has been reduced in commercial fisheries to the point where they are now kept for personal consumption rather then utilized it as bait. As a result, others small species (e.g. Holocentrus adscensionis) are exploited as bait. (Rezende, S., pers. comm.).

According to Araújo and Martins (2006), coney has a maximum age comparable to larger serranids, suggesting comparable natural mortality rates, and thus, susceptibility to fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Brazil this is a common species in several marine protected areas, including APA dos Corais; Atol das Rocas; Fernando de Noronha in Brazil, as well as several protected areas in the Caribbean. There is a bag size limit in Florida for all groupers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cephalopholis fulva


A Grouper from the Western Atlantic that occasionally makes its way into the aquarium trade. It grows to a size of 41cm in length.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!