Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Lives among coral and rubble (Ref. 1602)
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Tailface Sleeper (Calumia godeffroyi) is an Indo-Pacific sleeper goby, distributed from East Africa to the Society Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to Society Islands.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 6 - 7; Analspines: 1; Analsoft rays: 6 - 7
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 36 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.6 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

5 dark bands on body; 2 dark spots at the base of the tail.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Tailface Sleeper is associated with coral reefs and can be found resting on coral and rubble substrates. This species occurs at a depth of 7–30 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 7 - 30 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 0.915 - 70.9
  Temperature range (°C): 26.679 - 29.214
  Nitrate (umol/L): 0.048 - 0.484
  Salinity (PPS): 32.902 - 35.924
  Oxygen (ml/l): 4.441 - 4.728
  Phosphate (umol/l): 0.101 - 0.228
  Silicate (umol/l): 0.506 - 4.319

Graphical representation

Depth range (m): 0.915 - 70.9

Temperature range (°C): 26.679 - 29.214

Nitrate (umol/L): 0.048 - 0.484

Salinity (PPS): 32.902 - 35.924

Oxygen (ml/l): 4.441 - 4.728

Phosphate (umol/l): 0.101 - 0.228

Silicate (umol/l): 0.506 - 4.319
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 7 - 30m.
From 7 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Lives among coral and rubble (Ref. 1602).
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calumia godeffroyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGGTGCTTGAGCAGGAATGGTGGGCACCGCTTTAAGCCTACTAATCCGTGCTGAACTAAGTCAACCCGGTGCCCTACTAGGGGACGATCAGATCTATAATGTTATCGTAACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGAAACTGATTAGTACCTCTAATGATCGGCGCCCCCGACATAGCCTTCCCCCGAATAAATAACATAAGCTTTTGACTCCTTCCTCCTTCTTTTCTCTTGCTTTTAGCATCTTCTGGTGTAGAAGCTGGCGCGGGCACAGGATGAACCGTATACCCCCCACTAGCAGGAAATCTCGCCCACGCAGGTGCTTCTGTAGACCTGACAATTTTTTCACTACATCTAGCCGGTGTTTCATCAATTCTAGGGGCCATTAATTTTATTACCACAATTATTAACATAAAACCCCCAGCGATTTCTCAATACCAAACACCCCTGTTCGTCTGAGCTGTACTAATCACAGCCGTGCTACTATTACTGTCACTTCCAGTCCTTGCCGCCGGCATTACAATACTTTTAACAGACCGAAACCTGAACACAACCTTCTTCGACCCCGCATGAGGAGGGGATCCAATCCTTTACC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calumia godeffroyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Acero, A., Larson, H.K. & Murdy, E.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
The Tailface Sleeper (Calumia godeffroyi) has been assessed as Least Concern, owing to its widespread distribution across the Indian and Pacific Oceans. Although habitat degradation is occurring within parts of its range, this does not appear to represent a major threat to this species. Further research on the abundance of this species is needed to determine if this species is in fact rare.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Many marine eleotrids are rare (Hoese and Roberts 2005). The Tailface Sleeper is widespread but is not commonly observed (E. Murdy pers. comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The coral reefs in some areas of the Tailface Sleeper's range (e.g., in East Africa and Indonesia) have experienced regionalised and localised degradation due to bleaching, industrialisation, water pollution (sedimentation), destructive fishing practices and other human population pressures. In other parts of its range, the reefs are in good condition, so at present habitat degradation is not considered a major threat to the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for Calumia godeffroyi. However, its distribution may cover a number of marine protected area (MPA) designations. Further research on population trends is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!