Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Inhabits the outer continental shelf and upper slope (Ref. 244). Found over muddy or sandy bottoms (Ref. 27436). Feeds on small true shrimps, euphausiid shrimps, squids, and small fishes (Ref. 244). Oviparous (Ref. 50449).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

A. brunneus is found in the eastern Pacific (British Columbia, Canada, to Northern Baja California, Mexico, probably south to Panama, Ecuador, and Peru).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: British Columbia, Canada to northern Baja California, Mexico. Probably south to Panama, Ecuador, and Peru.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northeastern and eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

69.0 cm TL (male/unsexed; (Ref. 96339))
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 680 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dark brown, with conspicuous light posterior margin on fins (Ref. 247).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Apristurus brunneus
Catalog Number: USNM 51708
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Off Southern California, California, United States, Pacific
Depth (m): 657 to 657
Vessel: Albatross
  • Type: Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 542.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A little-known deepwater shark from the outer continental shelf and upper slope from depths of 33 to 950 m. Occurs on or near the bottom, and also well above it. Reproduction is oviparous with a single egg at a time per oviduct. Egg cases are about 5 cm long and 2.5 cm wide, with long tendrils that are probably used to attach them to hard substrates and/or biogenic structures. The incubation period is possibly a year. In Canadian waters females carry egg cases from February to August. Diet includes primarily penaeid shrimps but also euphausiids, squids and small fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 33 - 1306 m (Ref. 96339)
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found over muddy or sandy bottoms.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 78.5 - 1448
  Temperature range (°C): 2.906 - 5.424
  Nitrate (umol/L): 37.822 - 44.810
  Salinity (PPS): 34.027 - 34.534
  Oxygen (ml/l): 0.303 - 1.332
  Phosphate (umol/l): 2.880 - 3.284
  Silicate (umol/l): 70.929 - 155.145

Graphical representation

Depth range (m): 78.5 - 1448

Temperature range (°C): 2.906 - 5.424

Nitrate (umol/L): 37.822 - 44.810

Salinity (PPS): 34.027 - 34.534

Oxygen (ml/l): 0.303 - 1.332

Phosphate (umol/l): 2.880 - 3.284

Silicate (umol/l): 70.929 - 155.145
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 33 - 950m.
From 33 to 950 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds mainly on shrimps; also on euphausiid shrimps, squids and small fishes (Ref. 244).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on small true shrimps, euphausiid shrimps, squids, and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous, with a single egg per oviduct (Ref. 244). Eggs are enclosed in oblong transparent cases with tendrils at each end (Ref. 6885). Embryos feed solely on yolk (Ref. 50449). In Canada, females carry egg cases from February to August (Ref. 244).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apristurus brunneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTTTACCTAATTTTCGGTGCATGAGCAGGAATAGTTGGAATGGGCTTAAGTTTATTAATTCGTGCTGAACTCGGTCAACCTGGGTCTCTTCTAGGAGATGATCAGATTTATAATGTGATCGTCACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTTATACCAGTAATAATTGGTGGCTTTGGAAATTGACTTGTTCCGTTAATAATTGGTGCGCCCGACATAGCATTCCCGCGTATAAATAATATAAGCTTCTGACTCCTTCCCCCCTCTTTCTTACTTCTCTTAGCTTCTGCAGGCGTTGAAGCAGGAGCAGGAACTGGGTGAACTGTTTATCCCCCCTTAGCTGGTAATTTAGCACACGCTGGGCCCTCCGTTGATCTAGCTATCTTTTCCCTTCATCTGGCCGGTATTTCATCTATTTTAGCCTCAATTAATTTTATTACAACCATTATTAATATAAAACCCCCAGCCATTTCCCAGTATCAAACCCCCTTATTTGTTTGGTCAATTCTTATTACCACCGTTCTCCTTCTTCTTTCTCTCCCTGTTCTTGCAGCCGGAATTACAATATTACTTACAGACCGTAACCTTAATACCACATTTTTTGACCCTGCAGGAGGGGGAGACCCAATTCTCTACCAGCACCTATTTTGATTCTTCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apristurus brunneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Huveneers, C. & Duffy, C.

Reviewer/s
Kyne, P.M., Cavanagh, R.D. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
A little-known deepwater shark from the outer continental shelf and upper slope, known from depths of 33 to 950 m in the Eastern Pacific. Reaches a maximum size of 68 cm total length (TL) and is oviparous with the incubation period of eggs possibly one year. Although Apristurus brunneus is reported to be a relatively common bycatch in deepwater trawl fisheries, insufficient catch and biological information is available to assess this species beyond Data Deficient. Species-specific monitoring of catches should be undertaken.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is relatively common where it occurs (Compagno 1984).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commonly taken as bycatch in deepwater trawl fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown catshark

The brown catshark, Apristurus brunneus, is commonly found in the Pacific Ocean, ranging from the northern Pacific waters off the coast of British Columbia and south to the Baja California peninsula in Mexico. They may live as far south as Ecuador and Peru. Brown catsharks are deep-water sharks that live on the outer continental shelf and the upper slope. They have been known to live at depths ranging from 30 to 650 m and live on the bottom, usually in muddy or sandy areas. The brown catshark, when originally described, was called Catulus brunneus.[1]

Physical description[edit]

Brown catsharks have long, slender bodies with broad, bell-shaped snouts. They are dark brown with light-colored markings on the posterior margins of their fins. Their bodies are soft and flabby, with a weak skin that can easily be harmed. Brown catsharks' two dorsal fins are the same size and do not have spines. The first dorsal fin originates to the front of the pelvic fin and the second dorsal fin is located in front of the anal fin's insertion. They typically reach a maximum size of 68 cm in total length, but they average between 30 and 60 cm.

Behavior[edit]

Very little is known about the behavior of brown catsharks; they are believed to be solitary, nocturnal creatures. They are thought to be migratory, but most of the year near the edge of the continental shelf.

Communication specific to brown catsharks is unknown. However, as with most other sharks, including other members of the family Scyliorhinidae, they are believed to have a well-developed sense of smell, and are electroreceptive, which allows them to detect electricity emitted by other animals, and may also allow them to detect magnetic fields, which aides in navigation.

Food habits and predation[edit]

Brown catsharks feed on many bottom-dwelling species, including small shrimp, euphausiids, squid, and small fish. It is unknown whether brown catsharks are important predators within their ecosystem.

Reproduction[edit]

Reproduction in brown catsharks is oviparous, with a single egg at a time per oviduct. Egg cases are usually about 5 cm long and 2.5 cm wide. The egg cases are transparent and have long tendrils that are probably used to attach them to hard structures. The incubation period is possibly a year. In Canadian waters, females carry egg cases from February to August; however, the carrying time for warmer waters is unknown.

Conservation status and economic impact[edit]

Brown catsharks are not listed as endangered on the IUCN Red List or the CITES list. They are not known to be a vulnerable or threatened species. They are, however, listed on the IUCN list as needing to be reclassified.

The only known negative impact that brown catsharks have on humans is the frequent bycatch of deep-water fishing trawlers, which while not economically significant, can cause damage to nets, as well as time lost in removing the bycatch from the viable catch.

See also[edit]

References[edit]

  1. ^ Castro, Jose; Peebles, Diane (2011-08-11). The Sharks of North America. ISBN 9780195392944. 

Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!