Overview

Comprehensive Description

Biology

Adults found on mud bottoms, from 305 (Ref. 2850) to 2,740 m depth (Ref. 2850). Young-of-the-year juveniles are pelagic and found on the surface and near-shore waters (Ref. 28499). Generally localized, but some juveniles have been found to migrate over 2,000 miles in 6 or 7 years (Ref. 28499). Feed on crustaceans, worms and small fishes (Ref. 4925). Most of the catch is marketed in Japan (Ref. 28499). Utilized fresh, dried or salted and smoked (Ref. 9988), can be steamed, pan-fried, broiled, boiled, microwaved and baked (Ref. 9988). The liver oil is rich in vitamin A and D (Ref. 4925). Reported to reach 57 kg in Ref. 2850. The US North Pacific sablefish fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_1268.htm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Bering Sea coasts of Kamchatka, Russia and Alaska southward to Hatsu Shima Island, southern Japan and Cedros Island, central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Bering Sea coasts of Kamchatka, Russia and Alaska southward to Hatsu Shima I., southern Japan and Cedros I., central Baja California, Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Bering Sea to central Baja California and to central Honshu, Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 19 - 27; Dorsal soft rays (total): 16 - 20; Analspines: 3; Analsoft rays: 15 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 9988)); max. reported age: 65 years (Ref. 39324)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal fins well separated; 2nd dorsal fin sub equal to anal fin in size and form, and opposite in position. Reaches over 1 m in SL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; oceanodromous (Ref. 51243); marine; depth range 0 - 2740 m (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults found on mud bottoms, from 305-1,829 m depth. Young-of-the-year juveniles are pelagic and found on the surface and nearshore waters.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2632 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1695 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): 1.765 - 14.572
  Nitrate (umol/L): 0.462 - 44.379
  Salinity (PPS): 31.271 - 34.642
  Oxygen (ml/l): 0.303 - 7.285
  Phosphate (umol/l): 0.450 - 3.485
  Silicate (umol/l): 3.501 - 174.122

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): 1.765 - 14.572

Nitrate (umol/L): 0.462 - 44.379

Salinity (PPS): 31.271 - 34.642

Oxygen (ml/l): 0.303 - 7.285

Phosphate (umol/l): 0.450 - 3.485

Silicate (umol/l): 3.501 - 174.122
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 2740m.
Recorded at 2740 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Adults found on mud bottoms, from 305 (Ref. 2850) to 2,740 m depth (Ref. 2850). Young-of-the-year juveniles are pelagic and found on the surface and near-shore waters (Ref. 28499). Generally localized, but some juveniles have been found to migrate over 2,000 miles in 6 or 7 years (Ref. 28499). Feed on crustaceans, worms and small fishes (Ref. 4925). Is an omnivorous predatory fish of the continental slope of the northern Pacific. Its food includes planktonic, benthic, nectobenthic and nectonic organisms (Ref. 42024).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 114 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anoplopoma fimbria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTTTATCTAGTATTTGGTGCATGAGCCGGAATAGTAGGCACAGCATTAAGCCTTCTCATCCGAGCAGAGTTAAGCCAACCTGGCGCCCTCTTGGGCGACGACCAAATCTATAACGTAATTGTTACTGCGCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGCGGGTTTGGAAACTGACTCATCCCACTAATGATCGGAGCTCCCGATATAGCATTCCCTCGAATAAACAACATAAGCTTTTGATTACTCCCCCCTTCTTTCCTGCTTCTTCTCGCCTCTTCTGGTGTAGAAGCCGGGGCAGGGACAGGGTGAACAGTATACCCCCCTCTCGCCAGTAACTTGGCCCATGCCGGAGCATCCGTTGATCTAACCATCTTCTCCCTCCACTTAGCAGGTATCTCCTCAATTCTCGGGGCAATTAACTTTATTACAACCATTATTAACATGAAACCTCCTGCTATCTCTCAGTATCAGACGCCCCTTTTCGTATGGGCCGTTCTCATCACTGCAGTCCTTCTCCTTCTCTCCCTTCCAGTCCTAGCTGCTGGCATTACAATGCTCCTAACAGACCGAAATTTAAACACCACCTTCTTCGACCCAGCAGGCGGGGGTGACCCCATTCTTTACCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anoplopoma fimbria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: likely future use; aquarium: public aquariums; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sablefish

The sablefish, Anoplopoma fimbria, is one of two members of the fish family Anoplopomatidae and the only species in the Anoplopoma genus. In English, common names for it include sable (USA), black cod (USA, UK, Canada), blue cod (UK), bluefish (UK), candlefish (UK), coal cod (UK), coalfish (Canada), beshow and skil(fish) (Canada), although many of these names also refer to other, unrelated, species.[1] In the USA, FDA accepts only "sablefish" as the Acceptable Market Name; ‘black cod” is considered a vernacular (regional) name and should not be used as a Statement of Identity for this species.[2] The sable fish is found in muddy sea beds in the North Pacific at depths of 300 to 2,700 m (1000 to 9000 ft) and is commercially important to Japan.

The white flesh of the sablefish is soft-textured and mild flavored. It is considered a delicacy in many countries. When cooked its flaky texture is similar to Patagonian toothfish (Chilean sea bass). The meat has a high fat content and can be prepared in many ways including baking, broiling, grilling, smoking, frying or served as sushi.

Contents

Ecology [edit]

The sablefish (Anoplopoma fimbria) is a species of deep sea fish common to the North Pacific ocean. Adult sablefish are opportunistic feeders, preying on fish (including walleye pollock, eulachon, capelin, herring, sandlance, and Pacific cod), squid, euphausiids, jellyfish (Yang and Nelson 2000). Sablefish are long-lived, with a maximum recorded age of 94 years (Kimura et al. 1998).

Nutrition [edit]

Sablefish are very high in long-chain omega 3 fatty acids, EPA and DHA. It contains approximately as much as wild salmon.[citation needed][3]

In popular culture [edit]

Sablefish made an appearance in the HBO comedy series Curb Your Enthusiasm (Season 5, Episode 1) as an ingredient in the "Larry David Sandwich" sold at a local delicatessen.

Notes [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!