Overview

Comprehensive Description

Hydrolagus novaezealandiae ,

11 specimens - ANSP 174646-4, male, 715 mm TL, 505 mm PCL, 410 mm BDL ; ANSP 174646-5, female, 655 mm TL, 388 mm PCL, 300 mm BDL ; ANSP 174646-6, male, 670 mm TL, 440 mm PCL, 348 mm BDL ; ANSP 174646-7, female, 700 mm TL, 552 mm PCL, 432 mm BDL ; ANSP 174646-8, male, 655 mm TL, 533 mm PCL, 425 mm BDL ; ANSP 174646-9, female, 698 mm TL, 390 mm PCL, 296 mm BDL ; ANSP 174646-10, male, 480 mm TL, 375 mm PCL, 288 mm BDL ; ANSP 174646-11, female, 650 mm TL, 384 mm PCL, 303 mm BDL ; ANSP 174646-12, male, 614 mm TL, 454 mm PCL, 365 mm BDL ; ANSP 174646-14, male, 762 mm TL, 487 mm PCL, 373 mm BDL ; ANSP 174646-15, male, 635 mm TL, 393 mm PCL, 306 mm BDL; all from Northern Campbell Plateau, New Zealand (48°55.02-55.08'S, 167°2.75-7.29'E), 03 Mar. 1995 , GRV “TANGAROA” (cruise TAN 9502/095) .

  • Lewis A. K. Barnett, Dominique A. Didier, Douglas J. Long, David A. Ebert (2006): Hydrolagus mccoskeri sp. nov., a new species of chimaeroid fish from the Galápagos Islands (Holocephali: Chimaeriformes: Chimaeridae). Zootaxa 1328, 27-38: 36-36, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:682471C6-2C88-4399-B207-3716238191A6
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits the outer continental shelf and upper slope (Ref. 26346). Feeds on crustaceans, shellfish, worms and small fish (Ref. 26346). Maximum length 87 cm without tail filament (Ref. 26346), assumed to have 96 cm TL. Marketed as fillets (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Widespread throughout New Zealand, though uncommon around North Island, Challenger Plateau and Campbell Plateau. Depth range 32 to approximately 800 m; most abundant in 150 to 500 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southwest Pacific: endemic to New Zealand.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 870 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

96.0 cm TL (male/unsexed; (Ref. 26346))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Dark grey dorsally, with silver-white markings, pale silver-grey ventrally (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits outer continental shelf and upper continental slope over soft sediments. Feeds on benthic invertebrates. Dark ghost sharks lay eggs in hard cases, depositing them in pairs on the seabed. Males mature at 52 cm caudal length (CL) (snout to posterior end of upper caudal fin) and females at 62 cm CL. Maximum length is about 80 cm CL.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 25 - 950 m (Ref. 26346), usually 100 - 600 m (Ref. 89422)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2772 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1811 samples.

Environmental ranges
  Depth range (m): 49 - 1245
  Temperature range (°C): 3.573 - 15.209
  Nitrate (umol/L): 6.126 - 33.832
  Salinity (PPS): 34.285 - 35.319
  Oxygen (ml/l): 3.904 - 6.736
  Phosphate (umol/l): 0.388 - 2.303
  Silicate (umol/l): 0.000 - 53.393

Graphical representation

Depth range (m): 49 - 1245

Temperature range (°C): 3.573 - 15.209

Nitrate (umol/L): 6.126 - 33.832

Salinity (PPS): 34.285 - 35.319

Oxygen (ml/l): 3.904 - 6.736

Phosphate (umol/l): 0.388 - 2.303

Silicate (umol/l): 0.000 - 53.393
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 25 - 950m.
From 25 to 950 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits the outer continental shelf and upper slope. Feeds on crustaceans, shellfish, worms and small fish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, young hatch from egg case at about 9-12 cm (Ref. 26346).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrolagus novaezealandiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTCCTTTTTGGTGCTTGAGCGGGCATGGTAGGCACTGCCCTTAGCCTTTTAATCCGAGCTGAATTAAATCAGCCGGGCGCCCTAATAGGGGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATACCAATTATGATTGGGGGTTTTGGAAACTGACTTGTGCCTTTAATAATTGGGGCCCCCGACATAGCCTTTCCCCGAATAAACAACATAAGTTTTTGACTTCTTCCCCCCTCTTTCCTTTTACTCCTAGCCTCAGCAGGAGTAGAAGCAGGAGCCGGCACCGGATGAACTGTTTACCCTCCTCTAGCCGGTAATCTAGCACATGCCGGGGCATCTGTAGACCTGACCATTTTCTCCCTTCATTTAGCCGGGATTTCTTCAATTTTGGCCTCTATCAATTTCATTACTACAATTATTAACATAAAACCCCCATCAATCACCCAATATCAAACACCCCTATTTGTATGATCTATTTTAATTACTACAGTACTTCTCTTGCTATCTTTACCCGTTTTAGCAGCCGGTATTACAATATTACTAACAGATCGTAACCTAAATACAACATTCTTCGACCCAGCAGGAGGGGGGGATCCGATTTTATACCAGCACTTGNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus novaezealandiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2003

Assessor/s
Francis, M.P. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Kyne, P.M. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
Hydrolagus novaezealandiae is an endemic species with a widespread distribution throughout New Zealand, though uncommon around North Island, Challenger Plateau and Campbell Plateau. Productivity unknown but may be low. Caught commercially by bottom trawlers (ca 2,000 tonnes per year), but managed by ITQs. Biomass indices are variable, but possibly increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Trawl survey biomass indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range are variable, but possibly increasing

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Large commercial catch of around 2,000 tonnes per year in bottom trawl fishery. Trawl survey biomass indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range are variable, but possibly increasing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Managed under ITQs since 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dark ghost shark

The dark ghostshark, Hydrolagus novaezealandiae, is a shortnose chimaera of the family Chimaeridae, found on the continental shelf around the South Island of New Zealand.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!