Hydrolagus novaezealandiae — Details

Ratfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Inhabits the outer continental shelf and upper slope (Ref. 26346). Feeds on crustaceans, shellfish, worms and small fish (Ref. 26346). Maximum length 87 cm without tail filament (Ref. 26346), assumed to have 96 cm TL. Marketed as fillets (Ref. 26346).

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Southwest Pacific: endemic to New Zealand.

Armitage, R.O., D.A. Payne, G.J. Lockley, H.M. Currie, R.L. Colban, B.G. Lamb and L.J. Paul (eds.) 1994 Guide book to New Zealand commercial fish species. Revised edition. New Zealand Fishing Industry Board, Wellington, New Zealand, 216 p. (Ref. 9258) http://www.fishbase.org/references/FBRefSummary.php?id=9258&speccode=11878

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

Widespread throughout New Zealand, though uncommon around North Island, Challenger Plateau and Campbell Plateau. Depth range 32 to approximately 800 m; most abundant in 150 to 500 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

New Zealand Exclusive Economic Zone

Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

New Zealand.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Anal spines: 0; Analsoft rays: 0

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 870 mm OT

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

96.0 cm TL (male/unsexed; (Ref. 26346))

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Dark grey dorsally, with silver-white markings, pale silver-grey ventrally (Ref. 26346).

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

bathydemersal; marine; depth range 25 - 950 m (Ref. 26346), usually 100 - 600 m (Ref. 89422)

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535
McMillan, P.J., M.P. Francis, G.D. James, L.J. Paul, P.J Marriott, E. Mackay, B.A. Wood, L.H. Griggs, H. Sui and F. Wei 2011 New Zealand fishes. Volume 1: A field guide to common species caught by bottom and midwater fishing. New Zealand Aquatic Environment and Biodiversity Report No. 68. 329 p. (Ref. 89422) http://www.fishbase.org/references/FBRefSummary.php?id=89422&speccode=391

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology

Inhabits outer continental shelf and upper continental slope over soft sediments. Feeds on benthic invertebrates. Dark ghost sharks lay eggs in hard cases, depositing them in pairs on the seabed. Males mature at 52 cm caudal length (CL) (snout to posterior end of upper caudal fin) and females at 62 cm CL. Maximum length is about 80 cm CL.

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 2772 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1811 samples.

Environmental ranges
  Depth range (m): 49 - 1245
  Temperature range (°C): 3.573 - 15.209
  Nitrate (umol/L): 6.126 - 33.832
  Salinity (PPS): 34.285 - 35.319
  Oxygen (ml/l): 3.904 - 6.736
  Phosphate (umol/l): 0.388 - 2.303
  Silicate (umol/l): 0.000 - 53.393

Graphical representation

Depth range (m): 49 - 1245

Temperature range (°C): 3.573 - 15.209

Nitrate (umol/L): 6.126 - 33.832

Salinity (PPS): 34.285 - 35.319

Oxygen (ml/l): 3.904 - 6.736

Phosphate (umol/l): 0.388 - 2.303

Silicate (umol/l): 0.000 - 53.393

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 25 - 950m.
From 25 to 950 meters.

Habitat: bathydemersal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Inhabits the outer continental shelf and upper slope. Feeds on crustaceans, shellfish, worms and small fish.

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Oviparous, young hatch from egg case at about 9-12 cm (Ref. 26346).

Cox, G. and M. Francis 1997 Sharks and rays of New Zealand. Canterbury Univ. Press, Univ. of Canterbury. 68 p. (Ref. 26346) http://www.fishbase.org/references/FBRefSummary.php?id=26346&speccode=2535

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrolagus novaezealandiae

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTCCTTTTTGGTGCTTGAGCGGGCATGGTAGGCACTGCCCTTAGCCTTTTAATCCGAGCTGAATTAAATCAGCCGGGCGCCCTAATAGGGGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATACCAATTATGATTGGGGGTTTTGGAAACTGACTTGTGCCTTTAATAATTGGGGCCCCCGACATAGCCTTTCCCCGAATAAACAACATAAGTTTTTGACTTCTTCCCCCCTCTTTCCTTTTACTCCTAGCCTCAGCAGGAGTAGAAGCAGGAGCCGGCACCGGATGAACTGTTTACCCTCCTCTAGCCGGTAATCTAGCACATGCCGGGGCATCTGTAGACCTGACCATTTTCTCCCTTCATTTAGCCGGGATTTCTTCAATTTTGGCCTCTATCAATTTCATTACTACAATTATTAACATAAAACCCCCATCAATCACCCAATATCAAACACCCCTATTTGTATGATCTATTTTAATTACTACAGTACTTCTCTTGCTATCTTTACCCGTTTTAGCAGCCGGTATTACAATATTACTAACAGATCGTAACCTAAATACAACATTCTTCGACCCAGCAGGAGGGGGGGATCCGATTTTATACCAGCACTTGNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Hydrolagus novaezealandiae

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2003

Assessor/s

Francis, M.P. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s

Kyne, P.M. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification

Hydrolagus novaezealandiae is an endemic species with a widespread distribution throughout New Zealand, though uncommon around North Island, Challenger Plateau and Campbell Plateau. Productivity unknown but may be low. Caught commercially by bottom trawlers (ca 2,000 tonnes per year), but managed by ITQs. Biomass indices are variable, but possibly increasing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trends

Population

Learn more about this article

Population

Trawl survey biomass indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range are variable, but possibly increasing

Population Trend

Stable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

Large commercial catch of around 2,000 tonnes per year in bottom trawl fishery. Trawl survey biomass indices (1992 to 2000) from Chatham Rise in 200 to 800 m depth range are variable, but possibly increasing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

Managed under ITQs since 1998.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: minor commercial; price category: high; price reliability: reliable: based on ex-vessel price for this species

Armitage, R.O., D.A. Payne, G.J. Lockley, H.M. Currie, R.L. Colban, B.G. Lamb and L.J. Paul (eds.) 1994 Guide book to New Zealand commercial fish species. Revised edition. New Zealand Fishing Industry Board, Wellington, New Zealand, 216 p. (Ref. 9258) http://www.fishbase.org/references/FBRefSummary.php?id=9258&speccode=11878

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Dark ghost shark

Learn more about this article

The dark ghost shark, Hydrolagus novaezealandiae, is a shortnose chimaera of the family Chimaeridae, found on the continental shelf around the South Island of New Zealand.

References

Froese, Rainer, and Daniel Pauly, eds. (2006). "Hydrolagus novaezealandiae" in FishBase. March 2006 version.
Tony Ayling & Geoffrey Cox, Collins Guide to the Sea Fishes of New Zealand, (William Collins Publishers Ltd, Auckland, New Zealand 1982) ISBN 0-00-216987-8

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!