Overview

Comprehensive Description

Biology

A resident intertidal species with homing behavior (Ref. 32612). Adults are found in shallow rocky shores to 6 m. They feed on benthic invertebrates (Ref. 4785). Eggs are hemispherical and covered with numerous sticky threads that anchor them in the algae on the nesting sites (Ref. 240). Larvae are planktonic which occur primarily in shallow, nearshore waters (Ref. 94114).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tripterygion tripteronotus (Risso, 1810)

Mediterranean Sea : 20400-401 (1 spc.), 06.02.1966 , Incekum, Alanya .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 51-51, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Tripterygion tripteronotum is endemic to the Mediterranean and Black Sea (Zander 1986). It is found throughout the northern Mediterranean, from southeastern Spain to Turkey (Carreras-Carbonell et al. 2007), includingthe Ligurian Sea (Tunesi and Molinari 2005). There is a record from Libya (Jonge 1989), but this may be the sister species T. tartessicum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mediterranean Sea and Black Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

8.0 cm TL (male/unsexed; (Ref. 4785))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a demersal, non-migratory species. It is a resident intertidal species with homing behaviour (Gibson 1999) found in shallow rocky shores to six metres. It feeds on benthic invertebrates.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory; marine; depth range 6 - 12 m (Ref. 80021)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A resident intertidal species with homing behavior. Found in shallow rocky shores to 6 m. Feeds on benthic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tripterygion tripteronotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAATTTATAATGTAATCGTCACTGCACATGCTTTCGTTATAATCTTCTTTATAGTAATACCTATTATGATCGGAGGCTTTGGCAACTGACTAATTCCTTTAATGATTGGGGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTCTGACTTTTACCCCCTTCTTTCCTTCTCCTCTTAGCCTCCTCCGGCGTCGAAGCTGGGGCTGGAACGGGGTGAACAGTATACCCTCCCCTATCGGGAAACCTTGCACACGCTGGAGCCTCGGTGGATCTTACTATTTTTTCCCTTCACTTGGCAGGTATTTCTTCTATCCTAGGAGCTATTAACTTTATTACTACTATTATCAACATGAAGCCTCCTGCTATCTCCCAATATCAGACCCCTTTATTTGTGTGGGCGGTTCTTATTACGGCAGTTCTACTTCTCCTTTCTCTTCCTGTGCTAGCTGCCGGCATCACGATGCTCCTCACAGATCGAAATTTAAACACTACCTTTTTTGACCCTGCTGGCGGGGGGGATCCTATTCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tripterygion tripteronotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Holleman, W.

Reviewer/s
Ralph, G.

Contributor/s
Yokes, B., Pollard, D., Kara, M., Francour, P. & Goren, M.

Justification
Tripterygion tripteronotum is endemic to the Mediterranean and Black Sea. It is widespread and common, with no widespread threats. Therefore, T. tripteronotum is assessed as Least Concern.

History
  • 2011
    Least Concern (LC)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common throughout its range in the Mediterranean, the Sea of Marmara and the Black Sea.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known major threats for this species. It does not have any commercial interest and is not caught by any fishing techniques
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are in place for this species. It was previously assessed as Least Concern, globally and in the Mediterranean(Abdul Malaket al.2011, IUCN 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-black triplefin

The red-black triplefin (Tripterygion tripteronotum) is a species of fish in the family Tripterygiidae, the threefin blennies. It is widespread in the eastern Atlantic Ocean and the Mediterranean Sea.[1] In the Black Sea it occurs off the coasts of the Crimea and Ukraine.[2][3]

References[edit]

  1. ^ Tripterygion tripteronotum at www.fishbase.org.
  2. ^ Movchan Yu.V. (2009) Fish of Ukraine (taxonomy, nomenclature, notes). Zbirnyk prats Zoologichnogo muzeyu, №40: 47-87. (in Ukrainian) [1]
  3. ^ Black Sea Fishes Check List


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!