Overview

Comprehensive Description

Biology

A resident intertidal species with homing behavior (Ref. 32612). Found in shallow rocky shores to 6 m. Feeds on benthic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Mediterranean and Black Sea in western, northern and eastern Mediterranean (including Algeria), and also around border of Egypt and Libya in the southeastern region, and in the northwestern Black Sea. It has been recorded in the Ligurian Sea (Tunesi and Molinari 2005). Record from Libya (Jonge 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mediterranean Sea and Black Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

8.0 cm TL (male/unsexed; (Ref. 4785))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a demersal, non-migratory species. It is a resident intertidal species with homing behaviour (Gibson 1999) found in shallow rocky shores to 6 m. It feeds on benthic invertebrates.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; non-migratory; marine; depth range 6 - 12 m (Ref. 80021)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A resident intertidal species with homing behavior. Found in shallow rocky shores to 6 m. Feeds on benthic invertebrates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tripterygion tripteronotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAAATTTATAATGTAATCGTCACTGCACATGCTTTCGTTATAATCTTCTTTATAGTAATACCTATTATGATCGGAGGCTTTGGCAACTGACTAATTCCTTTAATGATTGGGGCCCCTGATATAGCATTCCCTCGAATAAATAACATGAGCTTCTGACTTTTACCCCCTTCTTTCCTTCTCCTCTTAGCCTCCTCCGGCGTCGAAGCTGGGGCTGGAACGGGGTGAACAGTATACCCTCCCCTATCGGGAAACCTTGCACACGCTGGAGCCTCGGTGGATCTTACTATTTTTTCCCTTCACTTGGCAGGTATTTCTTCTATCCTAGGAGCTATTAACTTTATTACTACTATTATCAACATGAAGCCTCCTGCTATCTCCCAATATCAGACCCCTTTATTTGTGTGGGCGGTTCTTATTACGGCAGTTCTACTTCTCCTTTCTCTTCCTGTGCTAGCTGCCGGCATCACGATGCTCCTCACAGATCGAAATTTAAACACTACCTTTTTTGACCCTGCTGGCGGGGGGGATCCTATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tripterygion tripteronotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Yokes, B., Pollard, D., Kara, M.H., Francour, P. & Goren, M.

Reviewer/s
Livingstone, S., Polidoro, B. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common in the Mediterranean. It has no major threats. It is currently assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common throughout its range in the Mediterranean, the Sea of Marmara and the Black Sea.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no known major threats for this species. It does not have any commercial interest and is not caught by any fishing techniques
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-black triplefin

Red-black triplefin (Tripterygion tripteronotum) is a species triplefins, widespread in the Eastern Atlantic and the Mediterranean Sea.[1] In the Black Sea it is presented off the coasts of the Crimea, Ukraine.[2][3]

References

  1. ^ Tripterygion tripteronotum at www.fishbase.org.
  2. ^ Movchan Yu.V. (2009) Fish of Ukraine (taxonomy, nomenclature, notes). Zbirnyk prats Zoologichnogo muzeyu, №40: 47-87. (in Ukrainian) [1]
  3. ^ Black Sea Fishes Check List
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!