Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Trachipterus trachypterus (Gmelin, 1789)

Aegean Sea : 9000-171 (1 spc.), 01.08.1993 , Dardanelles, Kepez Lighthouse-Dardanos Small Bay ; 9000-165 (1 spc.), 30.04.1990 , Shore of Ortakent, Bodrum , GökhanGürkan . Sea of Marmara : 9000-531 (1 spc.), Bosphorus, Ortakoey .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 40-40, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

A rare (Ref. 2713), mesopelagic species. Feeds on squid and midwater fishes (Ref. 6392). Swims with head up (Ref. 36731). Eggs and larvae are found frequently near the surface (Ref. 6392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific and eastern Atlantic including Mediterranean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: western Mediterranean and from Morocco to Namibia; also off Table Bay, South Africa (Ref. 2713). Western Pacific: Japan and New Zealand. Southeast Pacific: Chile (Ref. 27363).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 145184
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 4506))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Silvery in color except for front of head, interorbital area, dorsal part of upper jaw, and tip of lower jaw which are black (Ref. 2713). Dusky blotch usually seen on body at bases of 20-28th dorsal rays (Ref. 2713).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 45 - 1275
  Temperature range (°C): 3.146 - 14.239
  Nitrate (umol/L): 11.873 - 41.918
  Salinity (PPS): 34.465 - 35.835
  Oxygen (ml/l): 1.559 - 4.943
  Phosphate (umol/l): 0.670 - 2.910
  Silicate (umol/l): 5.922 - 130.298

Graphical representation

Depth range (m): 45 - 1275

Temperature range (°C): 3.146 - 14.239

Nitrate (umol/L): 11.873 - 41.918

Salinity (PPS): 34.465 - 35.835

Oxygen (ml/l): 1.559 - 4.943

Phosphate (umol/l): 0.670 - 2.910

Silicate (umol/l): 5.922 - 130.298
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 500m.
Recorded at 500 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 100 - 600 m (Ref. 50610)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 45 - 1275
  Temperature range (°C): 3.146 - 14.239
  Nitrate (umol/L): 11.873 - 41.918
  Salinity (PPS): 34.465 - 35.835
  Oxygen (ml/l): 1.559 - 4.943
  Phosphate (umol/l): 0.670 - 2.910
  Silicate (umol/l): 5.922 - 130.298

Graphical representation

Depth range (m): 45 - 1275

Temperature range (°C): 3.146 - 14.239

Nitrate (umol/L): 11.873 - 41.918

Salinity (PPS): 34.465 - 35.835

Oxygen (ml/l): 1.559 - 4.943

Phosphate (umol/l): 0.670 - 2.910

Silicate (umol/l): 5.922 - 130.298
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A rare, mesopelagic species. Feeds on squid and midwater fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trachipterus trachypterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGATTTTTCTCTACTAACCATAAAGACATTGGCACCCTCTACTTAATTTTTGGTGCCTGAGCCGGGATAGTCGGCACAGCACTAAGTCTCCTGATTCGTGCTGAACTAAGCCAACCCGGCGCTCTCCTAGGGGAC---GATCAAATCTATAATGTAATCGTCACCGCTCACGCTTTTGTTATAATTTTCTTTATAGTAATACCAATCATAATCGGGGGCTTTGGTAATTGACTCATTCCCTTAATGATTGGTGCCCCAGATATAGCCTTCCCACGAATAAATAATATAAGTTTCTGACTCCTCCCCCCCTCTTTCCTACTCTTATTAGCATCATCTGGTGTAGAAGCAGGAGCTGGTACCGGGTGAACAGTTTACCCACCCCTGTCAGGCAATTTAGCACATGCGGGGGCCTCTGTAGATCTAACTATCTTCTCCCTCCACCTAGCAGGGGTATCCTCTATTTTAGGAGCTATCAATTTTATTACTACTATTATTAACATAAAACCTCCTGCCATCTCCCAATACCAAACGCCCCTCTTTGTATGAGCCGTGCTTATTACTGCTGTTCTTCTTCTCCTATCTCTTCCAGTACTTGCAGCTGGTATCACCATGCTTCTAACTGATCGTAACCTAAATACCACATTTTTTGACCCTTCAGGAGGAGGAGACCCCATCTTATACCAACACCTGTTCTGATTCTTTGGTCACCCCGAAGTCTATATTCTTATCCTCCCAGGCTTTGGTATAATCTCTCACATCGTTGCTTACTATTCAGGCAAAAAAGAACCTTTTGGCTATATGGGTATGGTGTGAGCTATGATGGCTATTGGCCTTCTAGGATTCATTGTGTGAGCTCACCACATGTTTACTGTCGGCATGGATGTAGACACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trachipterus trachypterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Trachipterus trachypterus

Trachipterus trachypterus, is a ribbonfish of the family Trachipteridae, found in tropical and subtropical seas worldwide. Its length is up to 3 m.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!