Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in lagoon and seaward reefs from the lower surge zone to a depth of at least 30 m. Solitary juveniles found among rocks or coral (Ref. 58534) of shallow protected, sometimes turbid reefs (Ref. 1602, 48637). Benthopelagic (Ref. 58302). Feeds on leafy macroalgae. It possesses, fewer and larger pharyngeal teeth, compared to the other Zebrasoma spp. (Ref. 33204). The species is never poisonous (Ref. 4795).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Zebrasoma veliferum is found from Christmas Island (Indian Ocean) and Viet Nam eastward to Pitcairn group, Hawaiian Islands, northward to southern Japan, southward to Rottnest Is., and New South Wales, Australia and Rapa, French Polynesia except the Marquesas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: Mozambique (Ref. 41878). Pacific Ocean: Indonesia to the Hawaiian and Tuamoto islands, north to southern Japan, south to the southern Great Barrier Reef, New Caledonia, and Rapa Island. Replaced by the similar Zebrasoma desjardinii in the Indian Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Zebrasoma veliferum is found in the Pacific Ocean from Indonesia and Christmas Island to the Hawaiian and Tuamotu Islands, north to southern Japan, and south to the southern Great Barrier Reef, New Caledonia, and Rapa. This species is also found throughout Micronesia. In the Indian Ocean, Z. veliferum is replaced by a similar species, Z. desjardinii.

Biogeographic Regions: oriental ; australian ; oceanic islands ; pacific ocean

  • Myers, R. 1999. Micronesian Reef Fishes:A Field Guide for Divers and Aquarists. Barrigada, Territory of Guam, U.S.A.: Coral Graphics.
  • Lieske, E., R. Myers. 1996. Coral Reef Fishes: Caribbean, Indian Ocean, and the Pacific Ocean. Princeton, New Jersey: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4 - 5; Dorsal soft rays (total): 29 - 33; Analspines: 3; Analsoft rays: 23 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult Z. veliferum are irregularly ovoid shaped and typically have a body depth that is 1.8 to 2.0 times shorter than the standard length (the length of the fish from the tip of the snout to the base of the caudal fin). The largest specimen recorded of this species was 39.5 cm long. Like other species in the family Acanthuridae, Z. veliferum has a deep compressed body. The front of the snout protrudes giving a concave dorsal and ventral profile of the head.

Zebrasoma veliferum has continuous, unnotched dorsal and anal fins. There are 29 to 33 (rarely 29) rays and 4 to 9 spines in the dorsal fin, 23 to 26 rays and 2 or 3 spines in the anal fin, and 15 to 17 rays in the pectoral fins. The pelvic fins have 3 to 5 rays as well as a spine. The dorsal and anal fins are extremely elevated and rounded, with the longest dorsal ray 2.1 to 2.5 times shorter than the standard length. Unlike other species in the genus Zebrasoma, the caudal spine of Z. veliferum is singular and not broadly joined to the body posteriorly (it folds into a narrow groove). The caudal fin is truncate. Other physical characteristics of Z. veliferum include a complete lateral line, small ctenoid scales, and 22 to 23 vertebrae. They also have up to 16 upper and 18 lower teeth, which are spatulate with denticulate edges.

This species tends to show great variation in color but the overall body pattern is consistent. Posterior to the eye, the body and head of adult Z. veliferum is dark brown to grayish-black with vertical yellow lines and six narrow bands which incline diagonally forward. The anterior bands are white and the posterior are pale gray. Within the bands, the yellow lines are brighter than in the darker spaces between. Anterior to the eye, the head is light gray with many small white spots. The dorsal and anal fins of this species are dark brown with pale blue or green borders. The caudal fin is yellow with a white bar at the base, blue posterior margin, and a black submarginal line.

Juveniles of this species may be mistakenly identified as small angelfish because of their appearance. They have the same oversized dorsal and anal fins as the adults, but their coloration tends to be different. Juveniles have brightly colored yellow bodies with narrow black or gray bars. Their heads have two black bars. With age, the bright yellow color of the body fades.

Range length: 39.5 (high) cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Marshall, T. 1966. Tropical Fishes of the Great Barrier Reef. Sydney, Australia: Angus and Robertson.
  • Field, R., M. Field. 1998. Reef Fishes of the Red Sea:A Guide to Identification. New York, New York: Columbia University Press.
  • Sadovy, Y., A. Cornish. 2000. Reef Fishes of Hong Kong. Hong Kong: Hong Kong University Press.
  • National Marine Fisheries Service, 1984. Ontogeny and Systematics of Fishes. Washington D.C.: American Society of Ichthyologists and Herpetologists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

40.0 cm SL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Smalls juveniles have alternating yellow and black bars. No brush-like patch of setae posteriorly on side of body. Dorsal fin very elevated, the longest ray 2.1 to 2.5 times in SL (Ref 9808).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Zebrasoma veliferum is usually encountered as solitary individuals, but occasionally in pairs, on coral reefs from shallow protected areas to outer reef habitats at least as deep as 40 m (Randall 2001a, b). It grazes on algal turf (Choat et al. 2004). It is classified as a grazer (Choat 1991). Maximum age was given as 27 years by Choat and Robertson (2002a). Maximum age was 30 years in the Great Barrier Reef, Australia (J.H. Choat pers. comm. 2010). Juveniles shelter within branching corals on shallow reef flats as well as reef slopes. It occurs most consistently in high quality, coral reef environments, in lower densities in turbid reef habitats (R.F. Myers pers comm. 2010).

Reproduction

The sexes are separate among the acanthurids (Reeson 1983). There is a possibility of sexual dimorphism in Zebrasomas with cloacas bigger in females (Bushnell et al. 2010). This dimorphic character most probably applies to all Zebrasomas (J.H. Choat pers comm. 2010). It was observed to form spawning aggregations on the Great Barrier Reef (Squire and Samoilys unpub.), it spawns in pairs (Randall 2001a).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 58302), usually 2 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species can be found inhabiting lagoons and seaward reefs from the lower surge zone to a depth of 30 m or more. Solitary juveniles can be found among rocks or corals of shallow and protected reefs, which may be turbid. While feeding, this species can be found in benthic environments.

Range depth: 0 to >30 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: benthic ; reef

  • Randall, J. 2005. Reef and Shore Fishes of the South Pacific:New Caledonia to Tahiti and the Pitcairn Islands. Honolulu: University of Hawai'i Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 76 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 0.5 - 18
  Temperature range (°C): 25.275 - 29.336
  Nitrate (umol/L): 0.047 - 0.862
  Salinity (PPS): 34.131 - 40.307
  Oxygen (ml/l): 4.314 - 4.728
  Phosphate (umol/l): 0.100 - 0.301
  Silicate (umol/l): 1.005 - 4.752

Graphical representation

Depth range (m): 0.5 - 18

Temperature range (°C): 25.275 - 29.336

Nitrate (umol/L): 0.047 - 0.862

Salinity (PPS): 34.131 - 40.307

Oxygen (ml/l): 4.314 - 4.728

Phosphate (umol/l): 0.100 - 0.301

Silicate (umol/l): 1.005 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Are strict browsers which crop seaweed rather close to its base (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Zebrasoma veliferum is primarily a diurnal herbivore and feeds on benthic algae. Zebrasoma veliferum also feeds on zooplankton when it is abundant.

Animal Foods: zooplankton

Plant Foods: algae

Primary Diet: herbivore (Algivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

These fish live among coral reefs, constantly interacting with each other and with individuals of other species. They are prey for cartilaginous fishes and other bony fishes. They consume benthic algae and occasionally zooplankton. Zebrasoma veliferum is known to be associated with symbiotic microorganisms that reside in its digestive tract. These microorganisms, named Epulopiscium fishelsoni, were thought to be eukaryotic protists at first, but later they were determined to be unusually large bacteria. The size of the bacteria appears to be correlated to the host feeding ecology.

Mycobacterioses, or tuberculosis, are bacterial diseases that affect both freshwater and marine species of fishes. Mycobacterioses are caused by highly resistant bacteria which are difficult to control. These bacteria can be found in both wild and captive Z. veliferum. The most commonly isolated species of these bacteria in Acanthuridae are Mycobacterium fortuitum, M. marinum, and M. chelonae.

Mutualist Species:

Commensal/Parasitic Species:

  • Clements, K., D. Sutton, J. Choat. 1989. Occurrence and Characteristics of Unusual Protistan Symbionts from Surgeonfishes (Acanthuridae) of the Great Barrier Reef, Australia. Marine Biology, 102(3): 403-412.
  • Prearo, M., R. Zanoni, B. Dall'Orto, E. Pavoletti, D. Florio, V. Penati, C. Ghittino. 2004. Mycobacterioses: Emerging Pathologies in Aquarium Fish. Veterinary Research Communications, Volume 28, Supplement 1: 315-317.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

This species is prey for anything near the reef that is large enough to consume it. An example of such a predator is the whitetip reef shark, Triaenodon obesus. To avoid predation, Z. veliferum typically feeds during the day and hides among the reef at night. This species also has a sharp caudal spine that may act to deter predators. To advertise this protection, the tail fin is aposematic: the bright yellow coloration most likely serves as warning to predators.

Known Predators:

Anti-predator Adaptations: aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Members of this species communicate with each other and with other species of fishes in a number of ways. Like most other ray-finned fishes, this species uses visual displays as a means of communication. Color changes are observed in males during arousal, either during intraspecific competition or spawning. Also during intraspecific competition, the caudal peduncle spine may be brightly colored and positioned at an angle toward the competitor. Like many other species of fish, Z. veliferum also uses pheromones to communicate. These chemical signals can be detected by conspecifics or by closely related species.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual

  • Moyle, P., J. Cech. 2004. Fishes: An Introduction to Ichthyology. Upper Saddle River, New Jersey: Prentice-Hall, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Paired spawning (Ref. 240).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

As with other species in the family Acanthuridae, this species has a specialized pelagic, dispersing larval stage before the juvenile stage. This is referred to as the acronurus larval stage. This particular larval stage is responsible for the broad geographical distribution found within this species.

This species has small (less than 1 mm) pelagic eggs with a single oil droplet. When the poorly-developed larvae hatch (after about 1 day), they soon develop serrate ridges on the head. The pelvic and second dorsal spines form next followed by the second anal spine. Next, the head and trunk become deepened. The body becomes kite-shaped, accentuated by the long pelvic, dorsal, and anal spines. Small, triangular scales form in vertical rows. Late in the larval stage, the juvenile coloration becomes evident and the caudal peduncle spine develops.

Development - Life Cycle: metamorphosis

  • Thresher, R. 1984. Reproduction in Reef Fishes. Neptune City, New Jersey: T.F.H. Publications.
  • Rocha, L., A. Bass, R. Robertson, B. Bowen. 2002. Adult Habitat Preferences, Larval Dispersal, and the Comparative Phylogeny of Three Atlantic Surgeonfishes (Teleostei: Acanthuridae). Molecular Ecology, Volume 11, Issue 2: 243.
  • Bonhomme, F., S. Planes. 2000. Some Evolutionary Arguments About What Maintains the Pelagic Interval in Reef Fishes. Environmental Biology of Fishes, 59: 365-383.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

This species is relatively long-lived, living up to about 25 years. The oldest recorded individual in the wild was 27 years old. There is not sufficient information available on the longest-lived individual in captivity.

Range lifespan

Status: wild:
27 (high) years.

Typical lifespan

Status: wild:
25 (high) years.

  • Sale, P. 2002. Coral Reef Fishes:Dynamics and Diversity in a Complex Ecosystem. San Diego, California: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Both paired and group spawning have been documented among this species. As with other acanthurids, group spawning is the most common. Color changes can be seen during this time. Just prior to spawning, individuals of this species form large groups. This usually occurs in winter or early spring, but it can occur throughout the year. Reproduction is usually polygynandrous: both males and females have multiple mating partners.

Mating System: polygynandrous (promiscuous)

Reproduction among Z. veliferum typically occurs on a lunar cycle with peak activity during the winter or early spring. Occasionally, there is reproductive activity throughout the year. Spawning usually occurs at dusk and involves groups, but pair-spawning has also been observed. The eggs are pelagic and hatch after one day. Zebrasoma veliferum becomes sexually mature between one and two years of age.

Breeding season: Typically this species reproduces during the winter or early spring but there is also some activity throughout the year

Average time to hatching: 1 days.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Zebrasoma veliferum invests its energy producing gametes and spawning, but no parental care has been reported within this species.

Parental Investment: no parental involvement

  • Myers, R. 1999. Micronesian Reef Fishes:A Field Guide for Divers and Aquarists. Barrigada, Territory of Guam, U.S.A.: Coral Graphics.
  • Lieske, E., R. Myers. 1996. Coral Reef Fishes: Caribbean, Indian Ocean, and the Pacific Ocean. Princeton, New Jersey: Princeton University Press.
  • Randall, J. 2005. Reef and Shore Fishes of the South Pacific:New Caledonia to Tahiti and the Pitcairn Islands. Honolulu: University of Hawai'i Press.
  • Thresher, R. 1984. Reproduction in Reef Fishes. Neptune City, New Jersey: T.F.H. Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Zebrasoma velifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Zebrasoma veliferum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGAACAGCTCTAAGCCTACTCATCCGAGCAGAACTCAGCCAACCGGGCGCTCTCCTTGGAGACGACCAGATCTACAATGTAATCGTTACAGCACATGCATTTGTAATGATTTTCTTTATAGTTATACCAATCATGATCGGGGGGTTCGGAAACTGGTTAATTCCACTAATGATTGGAGCTCCTGACATAGCATTCCCACGAATGAATAACATGAGCTTTTGACTTCTCCCACCGTCCTTCCTCCTTCTCCTTGCCTCCTCAGGCGTTGAAGCCGGAGCTGGCACAGGATGGACAGTATACCCCCCTCTGGCAGGCAATCTAGCGCATGCTGGAGCATCCGTAGATTTAACTATCTTCTCCCTTCATCTCGCAGGGATTTCATCAATTCTAGGGGCTATTAATTTTATTACAACCATCATTAACATAAAACCCCCTGCTATTTCACAATACCAAACTCCCCTATTTGTGTGGGCAGTCCTAATTACAGCTGTCTTACTTCTCCTCTCTCTCCCAGTTCTCGCTGCAGGGATTACAATGCTCCTTACAGACCGGAATTTAAATACTACCTTCTTCGACCCCGCAGGAGGAGGGGATCCTATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zebrasoma veliferum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Zebrasoma veliferum is widespread in the Pacific region. It is occasionally to locally common in most parts of its range, however occurs in low densities. It is harvested for the aquarium trade, but is not a major component (average of 4,000 fish/year from 1992-2001). There are no major threats known and it occurs in a number of marine protected areas in parts of its distribution. It is therefore listed Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zebrasoma veliferum is not currently on the IUCN Red List, CITES appendices, or the United States Endangered Species Act list.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Zebrasoma veliferum is common in most parts of its range but not locally abundant. It was recorded as more abundant in offshore stations sampled at the Nha Trang Bay MPA and was found to be associated with branching corals (Nguyen and Phan 2008). It is common in Milne Bay Province, Papua New Guinea and in Raja Ampat, Indonesia (Allen 2003, 2003b). It is occasional in Palawan Province, Philippines (Werner and Allen 2000, Palawan Council for Sustainable Development unpub. data).

It is rare in the Guam fishery (<1% of the acanthurid fishery - Division of Aquatic and Wildlife Resources unpub. data). There was an average of 4,000 fish/year from 1992-2001 exported from a number of locations (most come from the Philippines) (Global Marine Aquarium Database accessed 19 March 2010). In 2007 in Hawaii, 57 lbs. were landed as bycatch, 93 lbs. in 2004. This species is not targeted (Division of Aquatic Resources unpub. data).

In Moorea, French Polynesia, SPOT satellite images allowed estimation of the surface area of fringing reef (1,076 ha), barrier reef (3,788 ha) and outer slope (493 ha). A total of 84,118 individuals were recorded in this area in fish visual surveys conducted from 1990-1993 (Lecchini et al. 2006). It is uncommon in the American Samoa National Park (National Park of Samoa Checklist of Fishes, accessed 21 April 2010).

In the central Philippines, density and biomass of herbivorous fish in reserves had positive relationships with duration of reserve protection. Acanthuridae and Labridae (parrotfishes) were the major families that increased in biomass inside reserves with duration of reserve protection. For Z. veliferum, mean biomass of 0.19 kg per 500 m2 was recorded at one reserve (5 to 7 years of protection) (Stockwell et al. 2009). It is common but not abundant in the Philippines (R. Abesamis and C. Nanola pers comm. 2010). Frequency of occurrence is <10% in the Philippines based on Underwater Visual Census (C. Nanola pers comm. 2010).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Zebrasoma veliferum is a component of subsistence fisheries and is found in localities where coral reef degradation is prevalent.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

The sharp spine on the caudal peduncle of Z. veliferum has the capability of inflicting deep, painful wounds to a person trying to grasp one of these fish live. Also, in the larval stage, fish of this species have venomous second dorsal, second anal, and pelvic spines. This venom is lost during transformation to the juvenile stage. Furthermore, this species is ciguatoxic and can be poisonous to humans if eaten. Finally, the mycobacterioses carried by Z. veliferum are potential zoonoses that can cause skin infections and lesions in humans.

Negative Impacts: injures humans (carries human disease, poisonous , venomous )

  • Halstead, B. 1978. Poisonous and Venomous Marine Animals of the World. Princeton, New Jersey: The Darwin Press, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is quite common in the aquarium trade, probably because it is relatively large, showy, and one of the easiest species of Acanthuridae to keep in captivity if bought when young.

Positive Impacts: pet trade

  • Lawrence, E., S. Harniess. 1991. An Instant Guide to Aquarium Fish. New York: Gramercy Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Zebrasoma veliferum

The sailfin tang (Zebrasoma veliferum) is a marine reef tang in the fish family Acanthuridae. They may live at water depths of 1 - 60 m (3 - 200 ft) or more. The fish grow to a maximum length of 40 cm (15.8 in). It has an extensive range throughout Oceania, the Indian Ocean, and the South Pacific. Zebrasoma veliferum is a popular fish in the aquarium trade. They are herbivorous fish specializing in filamentous algae. Though their skin is light beige with stripes, it can turn dark brown under stress.

Description[edit]

This species is one of the largest members of its genus. The largest scientifically measured sailfin tang was 40.0 cm (15.7 in).

The body of the sailfin tang is disc-shaped with a much elevated dorsal fin and a big anal fin. It has an extended snout. Compared to the other members of the genus Zebrasoma, the sailfin tang has larger but fewer pharyngeal teeth. On each side of the caudal peduncle is a single sharp spine (the so-called scalpel) which is used for defence and to establish dominance. When the fish is not using its scalpel, it is folded down inside a groove.

The sailfin tang is decorated with broad, pale yellow bands that alternate with darker bands over its body. The bending extends into both dorsal and anal fins. On the darker bands are yellow dots and stripes. The caudal fin is yellow. The head of the fish is white adorned with yellow dots. A dark band with yellow dots runs across the eye and another dark band with dots is located right behind the eye.

Juvenile specimens look similar to the adult fish, but with more yellow colouring.[1] They are also nearly identical to the unrelated adult Moorish idol.

References[edit]

  1. ^ Community, Aquatic. "Appearance". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!