Overview

Comprehensive Description

Biology

Usually found on sand or mud bottom near rocks and eelgrass, from the coast to a depth of 60 m. A secretive species, it feeds on small fishes and benthic crustaceans during the day (Ref. 9342). Capable of tolerating ample fluctuations of temperature (from 7.5 to 32°C) and survive extreme cold intervals (Ref. 9342). Pelagic spawners (Ref. 56049). Important game fish caught in bays and harbors (Ref. 9342).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: sand-bass (English), cabrilla (Espanol)
 
Paralabrax maculatofasciatus (Steindachner, 1868)


Spotted sand-bass


Body moderately elongate, compressed; body depth 3.0-3.3 in SL; head pointed; mouth large; preopercle finely serrated; lower gill rakers 13-15; dorsal rays X, 13-14,  third spine greatly elevated, about three times longer than second; anal rays III,6-8; pectoral rays 16; 61-68 lateral line scales.


Generally white with numerous black, brown, and orange spots that may coalesce to form dark lines behind lower belly; 6-7 indistinct dark bars on side of body; an oblique bar from eye to lower corner of operculum; smaller fish with a dark line from eye to tail fin; soft dorsal, tail and anal fins densely spotted.


Size: attains 38.1 cm.

Inhabits low-profile, often weed-covered, reefs adjacent to sandy bottoms.

Depth: 1-60 m.

Central California to the Gulf of California, most common in the northern Gulf.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Monterey in California, USA to Mexico, including the Gulf of California. Also reported in Nicaragua (Ref. 13613).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from central California to the tip of Baja, and the Gulf of California. Historically this species has ranged from Monterrey, California to Mazatlan, Mexico (California Fish and Game, 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 60 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 38.1 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 26550)); max. published weight: 900 g (Ref. 40637); max. reported age: 20 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 61 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This reef-associated species inhabits low-profile, often weed-covered, reefs adjacent to sandy substrata areas to depths of 61m. It feeds on small fishes and benthic crustaceans during the day (Heemstra 1995). It is capable of tolerating ample fluctuations of temperature (from 7.5 to 32C) and survive extreme cold intervals (Heemstra 1995). Compared to other species in the area, this species has a limited habitat range and its recruitment is more temperature dependent and variable (California Fish and Game, 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 1 - 24
  Temperature range (°C): 18.831 - 22.443
  Nitrate (umol/L): 0.133 - 4.527
  Salinity (PPS): 33.781 - 35.261
  Oxygen (ml/l): 4.860 - 5.364
  Phosphate (umol/l): 0.352 - 1.086
  Silicate (umol/l): 2.488 - 12.244

Graphical representation

Depth range (m): 1 - 24

Temperature range (°C): 18.831 - 22.443

Nitrate (umol/L): 0.133 - 4.527

Salinity (PPS): 33.781 - 35.261

Oxygen (ml/l): 4.860 - 5.364

Phosphate (umol/l): 0.352 - 1.086

Silicate (umol/l): 2.488 - 12.244
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 61m.
Recorded at 61 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paralabrax maculatofasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTTCTTATTCGAGCCGAGCTCAGCCAACCGGGCGCTCTCTTAGGGGACGACCAGATCTACAATGTAATTGTTACAGCACACGCTTTTGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTTATTCCTCTAATGATTGGAGCTCCTGATATAGCATTCCCTCGAATGAATAACATGAGCTTTTGGCTCCTCCCTCCTTCTTTCCTTCTTCTATTAGCTTCCTCAGGGGTTGAAGCAGGGGCAGGTACAGGCTGAACAGTCTACCCTCCCTTAGCCGGTAACCTGGCTCACGCCGGAGCTTCTGTTGATTTAACAATCTTTTCCCTTCATTTAGCAGGTGTCTCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATTATTAACATGAAACCTCCTGCTATTTCTCAATATCAAACACCTTTATTTGTTTGAGCTGTTTTAATTACTGCAGTACTTCTTCTTCTATCCCTCCCAGTCCTTGCCGCAGGTATCACAATACTTTTAACGGACCGAAATTTAAATACAACATTCTTTGATCCTGCAGGAGGTGGAGACCCCATCCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Paralabrax maculatofasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Smith-Vaniz, B, Robertson, R., Dominici-Arosemena, A., Molina, H., Salas, E., Guzman-Mora, A.G.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is restricted to southern California, Baja California, and the Gulf of Mexico.The population in southern California is expected to be stable with the implementation of a system of effective no-take Marine Protected Areas. It is listed as Least Concern. However, given that it is still heavily fished in the Gulf of California, this species should continue to be carefully monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is considered common in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species. The impact of fishing on this species population is unknown. Population trends are difficult to interpret as this species responds positively to ENSO events, which enhance its recruitment (California Fish and Game, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, commercial fishing of this species is banned, and size limits apply for sport fishing. This species' distribution includes a number of Marine Protected Areas in southern California currently being developed that will offer greatly enhanced protection. However, it is heavily fished in the Gulf of California, and Marine Protected Areas in this portion of its range may not be providing effective protection for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!