Overview

Comprehensive Description

Biology

Inhabits coral reefs with clear water (Ref. 13628). Young may be found in seagrass beds and other heavily vegetated bottoms. Feeds mainly on soft algae, but has been observed to graze on live corals like, Montastraea annularis (Ref. 6496). Produces a significant amount of sediment through bioerosion using its strong beak-like jaws and constantly re-growing teeth (Ref. 6485). Protogynous; strictly diurnal, spends the night sleeping on the bottom (Ref. 5221). Found singly or small in small groups.
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description: This type shares the characteristic markings of larval and transitional Sparisoma. Recruits become distinct early on when the leukophores on the base of their caudal fin coalesce into a distinct white bar and they develop rows of round white spots, with the two above the pectoral fin most visible. Characteristically, there are no melanophores extending into the white bar (at least until about 15 mm SL, but by then the white bar and rows of white spots are clearly prominent).

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The species is known from Bermuda and Florida (USA) to Venezuela.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southern Florida (USA), Bermuda, Bahamas, and throughout the Caribbean Sea to Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 640 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

64.0 cm TL (male/unsexed; (Ref. 3802)); max. published weight: 1,600 g (Ref. 26340)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: The larvae of all Sparisoma may well be identical, and DNA sequencing is required to identify species. Transitional recruits develop the basic markings probably shared by all members of the genus, but small juveniles of Sparisoma acquire distinct patterns that separate most, if not all, regional species. S. viride diverges from the remainder of the genus the earliest, with some individuals smaller than 10 mm SL showing a distinct pattern of markings, in particular an undivided prominent white bar on the caudal fin base.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relationship between fork length (FL) and maximum body depth (D): D = 0.10 + 0.33(FL); FL = -0.40 + 3.06(D), for n = 79, length range (cm, FL) = 13.5-25.5 (Ref. 3191). A distinctive, colorful and abundant fish. Young adults and females with scales outlined in darker gray; often bright red below. Super males green, with bright yellow spot at upper edge of gill cover, yellow bar at base of tail, curved orange-yellow mark on caudal fin rays (Ref. 26938). Initial phase fish with a brown head, the scales of the upper two-thirds of the body with pale centers and dark brown edges, the lower third of body and fins bright red. Terminal phase males are green with three diagonal orange bands on upper half of head
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef and seagrass associated from 1-50 m. It inhabits coral reefs with clear water. It feeds mainly on soft algae, but has been observed to graze on live corals. It produces a significant amount of sediment through bioerosion using its strong beak-like jaws and constantly re-growing teeth (Gygi 1975). It is a protogynous hermaphrodite. It is found solitary or small in small groups. Young may be found in seagrass beds and algae-rich areas of the reef.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 49m.
From 3 to 49 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 50 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4041 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2693 samples.

Environmental ranges
  Depth range (m): 0.225 - 32.8
  Temperature range (°C): 24.448 - 28.067
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.217 - 36.613
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.225 - 32.8

Temperature range (°C): 24.448 - 28.067

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.217 - 36.613

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Has been observed to graze on live corals like Montastrea annularis probably due to the absence of adequate seagrasses and large seaweeds in the area (Ref. 6496). Also cleaned by Thalassoma noronhanum observed at Fernando de Noronha Archipelago off northeastern Brazil (Ref. 36301) and by Elacatinus figaro observed off the coast of São Paulo, southeastern Brazil (Ref. 40102). Herbivore (Ref. 33499, 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The type of reproductive behavior is related to the color phase of the males involved.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sparisoma viride

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGCACTGCTTTAAGCCTTCTCATCCGAGCTGAACTAAGCCAACCCGGGGCCCTTCTCGGAGACGACCAAATCTATAACGTAATTGTTACTGCTCACGCGTTCGTAATGATCTTTTTTATGGTCATACCCATCATGATTGGAGGCTTTGGAAACTGACTTATTCCCCTCATGATTGGAGCACCCGACATGGCCTTCCCACGAATAAATAACATGAGCTTTTGACTTCTTCCGCCCTCCTTCCTTTTACTACTTGCCTCTTCTGGCGTTGAAGCAGGTGCAGGAACAGGATGAACTGTTTATCCCCCACTAGCAGGGAACCTTGCACACGCAGGAGCATCCGTAGACCTAACAATTTTCTCCCTTCACCTCGCAGGGATTTCCTCAATTCTTGGAGCTATTAACTTCATCACAACTATTATTAATATGAAACCCCCTGCTATCTCCCAATATCAAACACCTCTATTWGTGTGAGCTGTCTTAATTACAGCCGTTCTCCTTCTGTTATCCCTGCCCGTTCTCGCCGCAGGAATCACGATACTCCTTACTGACCGTAATCTCAACACTACGTTCTTTGACCCGGCAGGAGGGGGAGACCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sparisoma viride

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Rocha, L.A., Choat, J.H., Clements, K.D., Russell, B., Myers, R., Lazuardi, M.E., Muljadi, A., Pardede, S. & Rahardjo, P.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is widely distributed in the western North Atlantic, and is very common. Even though it is caught in the multispecies fisheries and targeted in many places for its relatively large size, there are no indications of global population declines. It is listed as Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common throughout its range (L. Rocha pers comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. Even though fisheries on these and other medium to large-sized parrotfish species in the Caribbean has been steadily increasing, there is no apparent global decline in population sizes (Friedlander and Beets 2008). There are however, severe population declines in reefs close to densily populated areas around Haiti and Jamaica (Hawkins and Roberts 2004).

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range. Fisheries for parrotfishes are permanently closed in Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stoplight parrotfish

The stoplight parrotfish (Sparisoma viride) is a species of parrotfish inhabiting coral reefs in Florida, Caribbean Sea, Gulf of Mexico, Bermuda and as far south as Brazil.[1] Like most of its relatives, it is able to change sex. Its typical length is between 1 and 1.5 ft (30 and 46 cm), but it can reach 2 ft (61 cm) at times. It is normally found during the day at depths between 15 and 80 ft (4.6 and 24.4 m).[1]

Initial phase

The colors of the stoplight parrotfish in the initial phase, when it could be either a male or a female, are dramatically different from those in the terminal phase, when it is definitely a male. In the initial phase, the stoplight parrotfish can rapidly change the color of the scales on its underside from red to white.[citation needed]

The common name, stoplight, comes from the marked yellow spot near the pectoral fin, which is clearly visible only in specimens in the terminal phase.

References[edit]

  1. ^ a b Humann, DeLoach (2002). Reef Fish Identification - Florida Caribbean Bahamas. New World Publications, Inc. ISBN 1-878348-30-2. 

)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!