Overview

Comprehensive Description

Biology

Found in shallow water down to about 80 m, mainly in seagrass beds (Ref. 3696). Feeds on sessile invertebrates such as tunicates, gorgonians and anemones, as well as on slow-moving crustaceans, sponges (Ref. 3696), hermit crabs and marine plants (Ref. 13442). Oviparous (Ref. 205). Considered an excellent food fish; marketed fresh (Ref. 3696).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Ocean: in tropical and temperate waters (Ref. 3696). Western Atlantic: Massachusetts (USA), Bermuda, and northern Gulf of Mexico to southeastern Brazil. Reported from tip of South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and northern Gulf of Mexico to southeastern Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10; Analspines: 0; Analsoft rays: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 6937))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark markings on head and body; parallel bands on cheek. Pair of prominent spines projecting from in front of eyes suggests cow horns. Second pair of spines at lower rear corners of cuirass (Ref. 26938). Body deep, covered with hexagonal dermal plates (Ref. 37521).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 80 m (Ref. 26938), usually 10 - 30 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 394 specimens in 1 taxon.
Water temperature and chemistry ranges based on 232 samples.

Environmental ranges
  Depth range (m): 0 - 75
  Temperature range (°C): 22.695 - 27.274
  Nitrate (umol/L): 0.289 - 2.736
  Salinity (PPS): 35.556 - 37.190
  Oxygen (ml/l): 4.033 - 4.855
  Phosphate (umol/l): 0.075 - 0.290
  Silicate (umol/l): 0.756 - 5.012

Graphical representation

Depth range (m): 0 - 75

Temperature range (°C): 22.695 - 27.274

Nitrate (umol/L): 0.289 - 2.736

Salinity (PPS): 35.556 - 37.190

Oxygen (ml/l): 4.033 - 4.855

Phosphate (umol/l): 0.075 - 0.290

Silicate (umol/l): 0.756 - 5.012
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 80m.
From 2 to 80 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in shallow waters, mainly over seagrass beds (Ref. 33, 3696). Found in shallow water down to about 80 m (Ref. 3696). Feeds on sessile invertebrates such as tunicates, gorgonians and anemones, as well as on slow-moving crustaceans, sponges (Ref. 3696), hermit crabs and marine plants (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthostracion quadricornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGGACAGCCCTAAGTCTACTCATCCGAGCAGAACTGAGCCAACCAGGCGCCCTTCTTGGAGACGATCAGATTTATAATGTTATCGTCACAGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAACTGACTAGTCCCACTAATAATTGGAGCCCCTGATATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTCCTTCTCCTAGCTTCATCAGGAGTTGAAGCAGGTGCTGGGACAGGCTGAACAGTCTACCCACCCTTAGCGGGTAACCTAGCACACGCAGGAGCATCCGTTGACTTAACCATCTTCTCACTTCATCTGGCTGGAGTTTCCTCAATTCTAGGGGCCATCAATTTTATTACTACTATTATTAATATAAAACCTCCCGCTATCTCCCAATATCAAACACCCCTATTTGTCTGAGCCGTATTAATTACTGCTGTCCTTCTTCTCCTATCACTACCAGTTCTTGCTGCTGGCATTACAATGCTCCTTACAGATCGAAACTTAAATACCACCTTCTTTGACCCGGCAGGAGGAGGAGATCCAATCCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthostracion quadricornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Scrawled cowfish

Acanthostracion quadricornis juvenile

The scrawled cowfish, Acanthostracion quadricornis, belongs to the Ostraciidae family and is closely related to boxfish and trunkfish. They range in size from 8-15 inches, with a maximum length of 18 inches, and can be found at depths between 6 and 80 feet. It is common to occasional in Florida and Bahamas; occasional to uncommon in the Caribbean. It may occur in the Gulf of Mexico, north to Massachusetts, Bermuda and south to Brazil. It has distinctive features such as a scrawled pattern of bluish markings covering its body; a blue line runs from snout to anal fin and it has a sharp spine above each eye. This latter point distinguishes cowfish from trunkfish.

Overall it is coloured blue-green to yellow cast. However, it may darken, pale and change color. Significantly it has two sharp spines in front of anal fin. The scrawled cowfish lives in a wide range of habitats including grass beds. However it is wary. If disturbed it may remain motionless apparently relying on camouflage.

Note

References

  • Humann, P. & Deloach, N., Reef fish identification, Florida, Caribbean, Bahamas, 2003, 481 p., p. 388-389
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!