Overview

Comprehensive Description

Biology

Occurs in aggregations over soft bottoms of the inner continental shelf, often near coral reefs (Ref. 9840). Ovoviviparous (Ref. 50449). Size at birth at about 55 cm WD (Ref. 6871). Common catch of the demersal tangle net, bottom trawl and, to a lesser extend, longline fisheries. Utilized for its meat, skin (high value) and cartilage (Ref.58048). By-catch of prawn trawlers (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species has a wide, but poorly defined, range (White et al. 2006).

Indian Ocean
Western Indian Ocean: South Africa (Last and Compagno 1999), Suez, Egypt (R. Bonfil pers. comm.). Eastern Indian Ocean: Andaman Sea (Kuiter and Debelius 1994), Maldives (Anderson and Hafiz 1997), Myanmar.

Pacific Ocean
Northwest Pacific: Ryukyu Islands (Yoshigou and Yoshino 1999). Western central Pacific: South China Sea and Sulu Sea off Sabah (Fowler et al. 1999), Indonesia, Thailand, Vietnam and north to Myanmar, northern tropical Australia including the Java Sea, down to New South Wales (Last and Stevens 1994, Whittington and Last 1994), Caroline Islands (Homma et al. 1994), Orangere Bay, Papua New Guinea (P. Kailola pers. Comm.), Eiao, Marquesas Islands (J. Randall pers. Comm.), and Apia, Samoa (Jordan and Seale 1906, Manjaji 2004), Philippines, Micronesia.

Large aggregations occasionally occur on atolls of the Great Barrier Reef and throughout the Caroline Islands (Last and Stevens 1994).

FAO Fishing Area: 51, 57, 61, 71.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: possibly widespread from South Africa to Micronesia. Possible synonym of Himantura gerrardi. Frequently confused with Himantura jenkinsii (Ref. 9840).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

183 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 18.5 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Uniformly tan to brownish pink dorsally. Inhabits lagoon and seaward sand flats from the intertidal to at least 200 m. Occurs in large aggregations (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Himantura fai
Catalog Number: USNM 51712
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan, V. Kellogg, M. Sindo, R. Allardice & K. Jordan
Year Collected: 1902
Locality: Samoa: Apia, Upolu, Samoa, Samoa Islands, Pacific
Vessel: Wheeling
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Found over soft substrates on the inner continental shelf, from the intertidal to at least 200 m depth. Reproduction is viviparous with histotrophy (White et al. 2006). Males reach maturity at 115.4?122.4 cm disc width (DW), but size at maturity for females is unknown (White and Dharmadi 2007). Maximum size is at least 184 cm DW and size at birth is reported at 30?55 cm DW (Manjaji 2004, White et al. 2006). Little is known of its biology and diet, but it is presumed to feed on bottom-dwelling invertebrates (White et al. 2006).

Images taken by divers indicate that this species aggregates on sandy bottoms and coral reefs (M. Manjaji pers. Obs. 2007). This species has sometimes been observed to sit on top of each other (up to ten animals) (W. White pers. Obs. 2007) and has also been observed "catching a ride" on other larger ray species (in Ningaloo Marine Park, W Australia) (W. White pers. Obs. 2007) .

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 16 - 133
  Temperature range (°C): 22.136 - 28.308
  Nitrate (umol/L): 0.385 - 5.480
  Salinity (PPS): 34.387 - 35.279
  Oxygen (ml/l): 3.612 - 4.657
  Phosphate (umol/l): 0.083 - 0.661
  Silicate (umol/l): 0.777 - 9.614

Graphical representation

Depth range (m): 16 - 133

Temperature range (°C): 22.136 - 28.308

Nitrate (umol/L): 0.385 - 5.480

Salinity (PPS): 34.387 - 35.279

Oxygen (ml/l): 3.612 - 4.657

Phosphate (umol/l): 0.083 - 0.661

Silicate (umol/l): 0.777 - 9.614
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205). Size at birth ~ 55 cm WD (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Himantura fai

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATCTTCGGTGCATGAGCAGGGATAGTGGGTACTGGTCTTAGCTTGCTTATTCGTACAGAACTAAGCCAACCAGGCGCACTACTGGGTGATGATCAGATTTATAACGTGATCGTTACCGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCTATTATAATCGGCGGCTTCGGTAATTGACTAGTTCCCCTAATAATTGGCGCCCCAGACATAGCCTTTCCCCGAATAAACAACATAAGCTTTTGACTTCTTCCACCATCCTTCCTACTACTCTTGGCATCTGCAGGAGTGGAAGCTGGGGCTGGAACAGGTTGAACAGTCTACCCCCCATTGGCCGGCAACCTAGCACATGCTGGAGCCTCTGTGGACCTAGCAATCTTTTCACTACACTTAGCTGGTGTCTCCTCTATCCTGGCCTCCATTAATTTCATCACTACAATTATTAACATGAAACCACCGGCAATCTCACAATACCAAACGCCCCTCTTCGTATGATCCATCCTTATCACAGCCGTACTCCTACTGCTATCTCTCCCTGTTTTAGCAGCAGGTATTACAATACTTCTTACAGATCGTAATCTCAACACAACCTTCTTTGATCCTGCAGGAGGAGGAGATCCGATCCTCTACCAACACTTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Himantura fai

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Manjaji, B.M., White, W.T. & Fahmi

Reviewer/s
Valenti, S.V. & Notarbartolo di Sciara, G. (Shark Red List Authority)

Contributor/s

Justification
This stingray has a wide, but poorly defined range in the Indian and Western Pacific Oceans. It is frequently misidentified for H. jenkinsii. It is taken as a utilised bycatch of tangle/gillnet, trawlnet, and dropline fisheries throughout Southeast Asia and parts of the Indian Ocean. Inshore fishing pressure is intense throughout this species? range in Southeast Asia and in parts of the Indian Ocean. It is caught in particularly high numbers in the target fishery for rhynchobatids operating in the Arafura Sea. Although no species-specific data are available, overall catches of stingrays are reported to be declining, with fishermen having to travel further and further to sustain catch levels. Given continuing high levels of exploitation throughout its range in Southeast Asia and evidence for declines in catches of stingrays, this sub-population is assessed as Vulnerable. Fisheries in northern Australia are generally well managed and the introduction of Turtle Exclusion Devices (TEDs) and other exclusion devices will have greatly reduced bycatch of this species. The species is considered at minimal threat throughout its wide range off northern Australia, where it is assessed as Least Concern because there is no information to suggest that this sub-population has declined. Little is known of populations throughout the rest of the species? range. Overall, this species is assessed as Least Concern globally due to its wide range off northern Australia and potential refuges in other areas of its range. However, this large species may have limiting life-history characteristics that would make it biologically vulnerable to depletion in fisheries. Therefore efforts should be made to assess and monitor mortality in fisheries and population trends throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common but not abundant in some areas in Indonesia, Malaysia, Philippines (M. Manjaji, Famhi B. Samiengo pers. obs. 2007). Can be relatively common in reef sand adjacent areas along northern Australia (W. White pers. obs. 2007).Large aggregations occasionally occur on atolls of the Great Barrier Reef and throughout the Caroline Islands (Last and Stevens 1994).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is captured by demersal tangle net, bottom trawl and, to a lesser extent, longline fisheries in Indonesia and probably throughout other areas of its range (White et al. 2006). Inshore fishing pressure is high throughout much of this species known range in Southeast Asia.

This species is taken in commercial gillnet fisheries off Indonesia, particularly in the fishery that targets rhynchobatid rays in the Arafura Sea, and retained (Last and Compagno 1999, W. White pers. Obs. 2007). It is thought to be heavily impacted in this area, where more than 600 trawl vessels operate (W. White pers. obs. 2007). The Rhynchobatus species gillnet fishery catches large numbers of stingrays and Himantura fai is important in this fishery. Catches in inshore waters have declined and these vessels are having to travel longer and longer distances to sustain catches. The rhynchobatid fisheries are very intensive in this region, thus the level of exploitation is extremely high. There is also evidence that fishermen in these regions increasingly illegally fish in Australian waters (Chen 1996, W. White, unpubl. data).

In Sabah (Malaysia) and Indonesia, Himantura species are often caught and landed in the inshore fisheries (trawls and longlines) and are also taken by Danish seine fishing gear (M. Manjaji and Fahmi pers. obs. 2007). In Southeast Asia, most specimens caught as bycatch by commercial fisheries (especially trawlers) are landed and sold as food fish.

In Australia, large specimens are caught as byatch in the Australian Northern Prawn Trawl Fishery, but the introduction of Turtle Exclusion Devices (TEDs) and other exclusion devices is thought to have greatly reduced bycatch of this species.

This species may be more vulnerable to depletion given its large size at maturity and maximum size compared to other Himantura species (Manjaji and Fahmi pers. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Malaysia
In Malaysia, the Shark Specialist Group together with various government departments in Sabah and Sarawak States have initiated elasmobranch biodiversity studies since 1996 (Fowler et al. 2002). While the monitoring surveys should continue to ascertain the status and possible threats to this species here, as well as in other portions of its range. Further research is also required on the population, habitat and ecology and life history parameters. The fishery is largely unregulated (licenses being issued, but catches/ landings are not properly monitored), and presently there is no specific conservation actions in place to help address this problem.

Australia
The use of Turtle Excluder Devices (TEDs) and Bycatch Reduction Devices (BRDs) in the Northern Prawn Fishery (NPF) has been compulsory since 2000 (Day 2000). The Northern Prawn Fishery Bycatch Action Plan (1998) also recommends that bycatch reduction targets be established and that bycatch levels be monitored (Day 2000).

Maldives
In 1995, 15 popular dive sites were declared marine protected areas in the Maldives with further protective measures under consideration (Anderson and Hafiz 1997). Himantura fai is one of the species that is fed daily at a popular dive site. The Maldives recognised the large economic value in terms of tourism that ray-watching brought and banned all exports of rays in June 1995 (Anderson and Hafiz 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: low; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pink whipray

The pink whipray (Himantura fai) is a species of stingray in the family Dasyatidae, with a wide but ill-defined distribution in the tropical Indo-Pacific from southern Africa to Polynesia. It is a bottom dweller that generally inhabits shallow water under 70 m (230 ft) deep, in sandy areas associated with coral reefs. Individuals exhibit a high degree of fidelity to particular locations. The pink whipray has a diamond-shaped pectoral fin disc wider than long, with a broad-angled snout and a very long, whip-like tail without fin folds. It has only a few small thorns on its back and is uniform brownish to grayish pink in color, becoming much darker past the tail sting. This large ray can reach 1.8 m (5.9 ft) across and over 5 m (16 ft) long.

Gregarious in nature, the pink whipray has been known to form large active and resting aggregations, and associate with other large ray species. It preys mainly on prawns, but also consumes other benthic invertebrates and bony fishes. This species is aplacental viviparous, in which the unborn young are nourished by histotroph ("uterine milk") produced by the mother. Across much of its range, substantial numbers of pink whiprays are caught incidentally by a variety of fishing gear and marketed for meat, skin, and cartilage. It is also of importance to ecotourism, being attracted to visitors with bait. The International Union for Conservation of Nature (IUCN) has listed this species under Least Concern, due to its wide distribution that includes relatively protected areas, such as northern Australia. However, its population in Southeast Asia is likely declining under heavy fishing pressure, and there it has been assessed as Vulnerable.

Taxonomy[edit]

The illustration that accompanied Jordan and Seale's 1906 description.

The pink whipway was described by American ichthyologists David Starr Jordan and Alvin Seale in the 1906 volume of Bulletin of the Bureau of Fisheries, on the basis of a specimen 37 cm (15 in) across collected off Apia, Samoa.[3] The specific epithet fai means "stingray" in the native languages of Samoa, Tonga, Futuna, and Tahiti.[4] Another common name for this species is Tahitian stingray.[5] In 2004, Mabel Manjaji grouped H. fai with H. gerrardi, H. jenkinsii, H. leoparda, H. toshi, H. uarnak, and H. undulata in the uarnak species complex.[6]

Description[edit]

The pink whipray can be identified by its uniform grayish dorsal coloration, which darkens past the sting.

The pectoral fin disc of the pink whipray is diamond-shaped and thick at the center, measuring about 1.1–1.2 times wider than long. The outer corners of the disc are angular. The snout forms a very obtuse angle, with the tip barely protruding. The small, widely spaced eyes are followed by larger spiracles. There is a short and broad curtain of skin with a finely fringed posterior margin between the long, thin nostrils. The mouth is fairly small and surrounded by prominent furrows; the lower jaw has a small indentation in the middle. There are two large central and two tiny lateral papillae on the floor of the mouth. The teeth are small and arranged into pavement-like surfaces. Five pairs of gill slits are located beneath the disc. The pelvic fins are small and narrow.[2][7]

The tail is extremely long and thin, measuring at least twice the disc length when intact. It lacks fin folds and usually bears a single serrated stinging spine. Adults have small, rounded dermal denticles covering the central dorsal surface of the disc, beginning in front of the eyes and extending to cover the entire tail; there are also small, sharp thorns on the midline, which become densest at the base of the tail. Juveniles are either smooth-skinned or have a sparser covering of flat, heart-shaped denticles. This species is uniform grayish to brownish pink above, becoming dark gray to black on the tail past the sting, and uniformly light below. It grows to at least 1.8 m (5.9 ft) across and over 5 m (16 ft) long.[2][7] Its maximum weight on record is 19 kg (42 lb).[8]

Distribution and habitat[edit]

The pink whipray frequents shallow, sandy habitats.

The exact range of the pink whipray is unclear due to confusion with the Jenkins' whipray (H. jenkinsii). It is believed to be common throughout the tropical waters of the Indo-Pacific, probably occurring all around Indian Ocean periphery from South Africa to northern Australia. Its range extends to the Pacific Ocean, northward to the Philippines, the Ryukyu Islands, and Iriomote, and eastward to various islands including Micronesia, the Marquesas Islands, and Samoa.[1][9][7]

The pink whipray has been recorded from as deep as 200 m (660 ft), but is usually found from the intertidal zone to a depth of 70 m (230 ft). This bottom-dwelling species prefers sandy flats, lagoons, and other soft-bottomed habitats, often near cays and atolls in coral reefs.[2][8] It tends to be found closer to shore during the warm season.[10] Genetic and telemetry studies across Polynesian islands have found that individual rays tend to remain within a local area, with very little between-island movement.[11][12]

Biology and ecology[edit]

Pink whiprays often form groups for natural and artificial reasons.

Small to large gatherings of pink whiprays have been observed over sandy flats and coral reefs in Shark Bay, on the Great Barrier Reef, and in the Caroline Islands.[1][2][10] When resting, up to ten individuals may pile atop one another, sometimes mixing with other species. On Ningaloo Reef, it has been seen "riding" on larger species of rays.[1] The pink whipray feeds primarily on decapod crustaceans, but also takes cephalopods, and teleost fishes. In Shark Bay, penaeid prawns are by far the dominant prey type for rays of all sizes.[13] At Rangiroa Atoll in French Polynesia, sizable feeding aggregations are known to form at night in shallow water.[5] However, at Moorea it tends to be a solitary forager with a large home range.[12]

Like other stingrays, the pink whipray is aplacental viviparous, with the mother supplying her developing embryos with nutrient-rich histotroph ("uterine milk") through specialized uterine structures. The newborns measure 55–60 cm (22–24 in) across.[2] Shark Bay may be a nursery area for this species.[10] Males reach sexual maturity at 1.1–1.2 m (3.6–3.9 ft) across, while the maturation size for females is unknown.[2] Known parasites of the pink whipray include the monogeneans Heterocotyle capricornensis,[14] Monocotyle helicophallus, M. spiremae,[15] M. youngi,[16] Merizocotyle australensis,[15] Neoentobdella parvitesticulata,[17] and Trimusculotrema heronensis,[18] the tapeworm Prochristianella spinulifera,[19] and the isopod Gnathia grandilaris.[20]

Human interactions[edit]

Though not highly dangerous to humans, the pink whipray's venomous sting makes it difficult to handle when it is thrashing in a fishing net. Usually, it must be thrown overboard before the rest of the catch can be sorted.[2] Throughout Indonesia and Malaysia, and probably elsewhere in its range, this species is a regular incidental catch of coastal fisheries using tangle nets, bottom trawls, gillnets, seine nets, and to a lesser extent longlines.[1] When retained, the meat, skin, and cartilage are utilized.[8] Fishing activity in Southeast Asia is intense and largely unregulated, and this large ray may be more vulnerable to depletion than its smaller relatives because of its slower reproductive rate. The population in the Arafura Sea is thought to have been particularly affected by an Indonesian fishery targeting wedgefishes (Rhynchobatus), and Indonesian fishers are also increasingly operating illegally in Australian waters. Off northern Australia, the pink whipray is caught incidentally by the Northern Prawn Fishery (NPF), but bycatch levels have likely fallen significantly since the use of Turtle Excluder Devices (TEDs) and Bycatch Reduction Devices (BRDs) became compulsory in 2000.[1]

The pink whipray is valuable to ecotourism at sites in the Maldives, French Polynesia, and elsewhere; they are attracted to visitors in large numbers by the promise of food.[12][21] The government of the Maldives has taken steps to preserve ray ecotourism by banning all exports of ray products in 1995.[1] In 2005, stingray ecotourism at Moorea brought in over €500,000.[11] However, a 2008 study of Moorea whiprays found a negative effect of ecotourism in the form of bite and impact injuries, stemming from artificially high ray density and interactions with boat traffic at the feeding sites.[12] The International Union for Conservation of Nature (IUCN) has assessed the pink whipray as Least Concern overall, citing its wide distribution that includes refuge regions with few conservation threats. The population off northern Australia, which is one of these refuges, has also been listed under Least Concern. By contrast, the heavily fished Southeast Asian population has been listed as Vulnerable.[1]

References[edit]

  1. ^ a b c d e f g h Manjaji, B.M.; White, W.T.; Fahmi (2004). "Himantura fai". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved August 23, 2010. 
  2. ^ a b c d e f g h Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. pp. 443–444. ISBN 0-674-03411-2. 
  3. ^ Jordan, D.S.; Seale, A. (December 15, 1906). "The fishes of Samoa: Description of the species found in the archipelago, with a provisional check-list of the fishes of Oceania". Bulletin of the Bureau of Fisheries 25: 173–455. doi:10.5962/bhl.title.46247. 
  4. ^ Churchill, W. (1911). The Polynesian Wanderings: Tracks of the Migration Deduced From an Examination of the Proto-Samoan Content of Efaté and Other Languages of Melanesia. The Carnegie Institution of Washington. p. 218. 
  5. ^ a b Michael, S.W. (2005). Reef Sharks and Rays of the World. ProStar Publications. p. 86. ISBN 1-57785-538-8. 
  6. ^ Manjaji, B.M. (2004). Taxonomy and phylogenetic systematics of the Indo-Pacific Whip-Tailed Stingray genus Himantura Müller & Henle 1837 (Chondrichthyes: Myliobatiformes: Dasyatidae) (Ph.D. Thesis). University of Tasmania, Hobart, Tasmania.
  7. ^ a b c Last, P.R.; Compagno, L.J.V. (1999). "Myliobatiformes: Dasyatidae". In Carpenter, K.E.; Niem, V.H. FAO identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Rome: Food and Agricultural Organization of the United Nations. p. 1486. ISBN 92-5-104302-7. 
  8. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2009). "Himantura fai" in FishBase. April 2009 version.
  9. ^ Hidenori, Y.; Tetsuo, Y. (1999). "First record of a stingray, Himantura fai collected from Iriomote Island, the Ryukyu Islands". Japanese Journal of Ichthyology 46 (1): 39–43. 
  10. ^ a b c Vaudo, J.J.; Heithaus, M.R. (2009). "Spatiotemporal variability in a sandflat elasmobranch fauna in Shark Bay, Australia". Marine Biology 156 (12): 2579–2590. doi:10.1007/s00227-009-1282-2. 
  11. ^ a b Gaspar, C. (June 30, 2009). "Pd.D. Thesis Summary: Study of feeding of the pink whiprays, in French Polynesia Himantura fai". Cybium 33 (2): 186. 
  12. ^ a b c d McCoy, B. (2008). "Varying impact of human feeding on Pink Whiprays, Himantura fai, at two sites on Mo'orea". UC Berkeley: UCB Moorea Class: Biology and Geomorphology of Tropical Islands.
  13. ^ Pierce, S.J.; Scott-Holland, T.B.; Bennett, M.B. (April 2011). "Community Composition of Elasmobranch Fishes Utilizing Intertidal Sand Flats in Moreton Bay, Queensland, Australia". Pacific Science 65 (2): 235–247. doi:10.2984/65.2.235. 
  14. ^ Chisholm, L.A.; Whittington, I.D. (November 1996). "A revision of Heterocotyle (Monogenea: Monocotylidae) with a description of Heterocotyle capricornensis n sp from Himantura fai (Dasyatididae) from Heron Island, Great Barrier Reef, Australia". International Journal for Parasitology 26 (11): 1169–1190. doi:10.1016/S0020-7519(96)00113-0. PMID 9024861. 
  15. ^ a b Chisholm, L.A.; Whittington, I.D. (October 1996). "Descriptions of the larvae of six species of monocotylid monogeneans from Himantura fai (Dasyatididae) and Rhinobatos typus (Rhinobatidae) from Heron Island, Great Barrier Reef, Australia". Systematic Parasitology 35 (2): 145–156. doi:10.1007/BF00009823. 
  16. ^ Chisholm, L.A. (September 1998). "A revision of Monocotyle Taschenberg, 1878 (Monogenea : Monocotylidae) with descriptions of three new species from Australia". Journal of Natural History 32 (9): 1259–1290. doi:10.1080/00222939800770631. 
  17. ^ Kearn, G.C.; Whittington, I.D. (March 2005). "Neoentobdella gen nov for species of Entobdella Blainville in Lamarck, 1818 (Monogenea, Capsalidae, Entobdellinae) from stingray hosts, with descriptions of two new species". Acta Parasitologica 50 (1): 32–48. 
  18. ^ Whittington, I.D.; Kearn, G.C. (2008). "Trimusculotrema heronensis sp nov (Monogenea, Capsalidae) from the skin of the pink whipray Himantura fai (Elasmobranchii, Dasyatidae) from Heron Island, Queensland, Australia". Acta Parasitologica 53 (3): 251–257. doi:10.2478/s11686-008-0044-5. 
  19. ^ Beveridge, I.; Jones, M.K. (September 2000). "Prochristianella spinulifera n. sp (Cestoda : Trypanorhyncha) from Australian dasyatid and rhinobatid rays". Systematic Parasitology 47 (1): 1–8. doi:10.1023/A:1006486713630. PMID 10937661. 
  20. ^ Ota Y.; Hirose E. (September 23, 2009). "Gnathia nubila n. sp and a new record of Gnathia grandilaris (Crustacea, Isopoda, Gnathiidae) that parasitizes elasmobranchs from Okinawan coastal waters, Japan". Zootaxa 2238: 43–55. 
  21. ^ Anderson, C.; Waheed, A. (July 2001). "The economics of shark and ray watching in the Maldives". Shark News 13. The IUCN/SSC Shark Specialist Group. Retrieved April 7, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!