Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

The checkerboard wrasse hangs out in the sandy patches of a reef. It spends its days looking for food to munch on with its thick lips and large front teeth, and at night hides and rests in the reef.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits sand patches of lagoon and seaward reefs to at least 30 m (Ref. 1602); also on slopes to moderate depths along drop-offs (Ref. 48636). Juveniles common at the bottom of surge channels (Ref. 9710). Feeds mainly on hard-shelled prey, including mollusks, crustaceans and sea urchins (9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

When young, the checkerboard wrasse is only black and white. As it grows up it becomes more and more colorful. The males are usually more colorful than the females, and they are in charge. One male will be in charge of a group of several females.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific, from the Red Sea south to Sodwana Bay, South Africa and east to the Line, Marquesan and Tuamoto islands, north to southern Japan, and south to the southern Great Barrier Reef.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to Sodwana Bay, South Africa and east to the Line, Marquesan and Tuamoto islands, north to southern Japan, south to the southern Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Rowley Shoals (Western Australia), New South Wales (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 270 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

27.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits sand patches of lagoon and seaward reefs at depths of 1 to at least 30 m (Ref. 1602). Feeds mainly on hard-shelled prey, including molluscs, crustaceans and sea urchins (9823).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Some geographical variations between Indian and Pacific Ocean and Red Sea. Adults with one or two yellow saddles over the back and sometimes with small black spot on upper peduncle. Small juveniles black and white, gradually changing with growth to adult pattern (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef associated from 1-30 m. It inhabits sand patches of lagoon and outer seaward reefs to at least 30 m (Myers 1991). It is also found on slopes to moderate depths along drop-offs (Kuiter and Tonozuka 2001).

Juveniles are common at the bottom of surge channels (Lieske and Myers 1994). It feeds mainly on hard-shelled prey, including mollusks, crustaceans and sea urchins (Westneat 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 1602), usually 1 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 188 specimens in 1 taxon.
Water temperature and chemistry ranges based on 142 samples.

Environmental ranges
  Depth range (m): 0.305 - 37.5
  Temperature range (°C): 24.633 - 29.336
  Nitrate (umol/L): 0.016 - 3.114
  Salinity (PPS): 32.185 - 40.307
  Oxygen (ml/l): 4.202 - 4.851
  Phosphate (umol/l): 0.085 - 0.546
  Silicate (umol/l): 0.829 - 5.552

Graphical representation

Depth range (m): 0.305 - 37.5

Temperature range (°C): 24.633 - 29.336

Nitrate (umol/L): 0.016 - 3.114

Salinity (PPS): 32.185 - 40.307

Oxygen (ml/l): 4.202 - 4.851

Phosphate (umol/l): 0.085 - 0.546

Silicate (umol/l): 0.829 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit sand patches of lagoon and seaward reefs to at least 30 m (Ref. 1602). Juveniles common at the bottom of surge channels (Ref. 9710). Feed mainly on hard-shelled prey, including molluscs, crustaceans and sea urchins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

The checkerboard munchs on shrimps, crabs, snails, and urchins. It only eats other animals, so it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Halichoeres hortulanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Halichoeres hortulanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTGGGAGCCTGAGCCGGAATGGTGGGCACAGCCCTGAGCCTACTCATTCGAGCAGAGCTAAGCCAACCCGGGGCTCTCCTTGGAGACGACCAAATTTACAATGTTATCGTTACAGCCCATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGATTTGGAAACTGACTCATTCCCCTGATGATTGGAGCCCCCGACATGGCATTCCCTCGGATAAACAACATGAGCTTCTGACTTCTCCCGCCCTCCTTCCTTCTTCTTCTTGCCTCTTCAGGCGTAGAAGCCGGAGCCGGAACTGGCTGAACCGTCTACCCCCCTCTAGCTGGAAACCTGGCCCACGCCGGAGCATCCGTCGACTTGACAATTTTCTCCCTTCACTTGGCAGGAATCTCGTCAATTCTGGGGGCAATTAACTTTATTACAACAATTATTAACATAAAACCTCCTGCCATTTCTCAATACCAAACACCTCTGTTTGTTTGAGCCGTCCTAATTACAGCAGTCCTCCTTCTTCTCTCCCTCCCCGTACTTGCTGCCGGAATTACAATGCTTCTCACAGACCGAAACCTAAACACCACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTGTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indo-Pacific. There are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. This species is common in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Many people find the checkerboard wrasse perfect as a meal or pet. But humans must be careful that they don’t take too many out of the reef!

Reefs are in danger, and that means so is the home of the checkerboard wrasse!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Checkerboard wrasse

The checkerboard wrasse, Halichoeres hortulanus, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean.[2]

Range[edit]

This species can be found from Red Sea to South Africa and eastward to the Line Islands, the Marquesas, and the Tuamotus, and from southern Japan, south to the southern parts of the Great Barrier Reef.[2]

Description[edit]

This species sports a checkerboard pattern on its sides; males are greener with a yellow dorsal spot. Small juveniles are black and white, gradually changing with growth to the adult pattern. It can reach 27 cm (11 in) in total length.[2]

Diet[edit]

Mainly molluscs, crustaceans, and sea urchins make up its diet.[2]

Habitat[edit]

It is usually found in clear lagoons and on seaward reefs at depths from 1 to 30 m (3.3 to 98 ft).[2] Juveniles are found at the bottom of surge channels or under ledges. Males are territorial over a large area.[3]

Use by humans[edit]

This species is of minor importance to local commercial fisheries and can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Rocha, L. & Craig, M. 2010. Halichoeres hortulanus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 November 2013.
  2. ^ a b c d e f Froese, Rainer and Pauly, Daniel, eds. (2013). "Halichoeres hortulanus" in FishBase. August 2013 version.
  3. ^ Lieske, E. and Myers, R. F. (2004) Coral reef guide; Red Sea London, HarperCollins ISBN 0-00-715986-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!