Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits shallow protected lagoons and inshore reefs (Ref. 1602, 48636). Found on silty bottoms with coral and rubble (Ref. 9710). Usually in small groups spread over small area (Ref. 48636). Minimum depth reported from Ref. 27115. Has been reared in captivity (Ref. 35413). Well-known aquarium fish. (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Ryukyu Islands to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Synchiropus splendidus is found in much of the western Pacific including the Philippines, Indonesia, Hong Kong, Australia, and New Guinea (Delbeek, 1989). These fish are also found in the Ryukyu Islands (Randall et al. 1990). Outside of its native range, S. splendidus is primarly a marine aquarium fish (Sandovy et al. 2001).

Biogeographic Regions: oriental (Native ); australian (Native ); pacific ocean (Native )

  • Sadovy, Y., G. Mitcheson, M. Rasotto. 2001. Early development of the mandarinfish, Synchiropus splendidu (Callionymidae), with notes on its fishery and potential for culture.. Aquarium Sciences and Conservation, 3: 253-263.
  • Delbeek, C. 1989. The Mandarin Fish: Synchiropus splendidus. Seascope.
  • Randall, J., A. G.R, S. R.C. 1990. "Fishbase" (On-line). Accessed October 11, 2005 at http://www.fishbase.org/Summary/SpeciesSummary.php?id=12644.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4; Dorsal soft rays (total): 8; Analspines: 0; Analsoft rays: 6 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Mandarin fish are distinctive due to their unusual shape and intense coloration. They have a broad, depressed head and are primarily blue with orange, red, and yellow wavy lines (Delbeek 1989). Mandarin fish are small, reaching a maximum length of 6 cm. Males are notably larger than females (Sadovy et al. 2001). Mandarin fish lack scales and instead have a thick mucus coating that has an unpleasant smell (Sandovy et al. 2005). They have 4 dorsal spines, 8 dorsal soft rays, and no anal spines. In males, the first dorsal spine is greatly elongated, sometimes long enough to reach the caudal peduncle (Delbeek 1989).

Range length: .02 to 6 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • Sadovy, Y., J. Randall, M. Raotto. 2004. Skin structure in six dragonet species (Gobiesociformes; Callionymidae): interspecific differences in glandular cell types and mucus secretion.. Journal of Fish Biology, 66: 1411-1418. Accessed October 11, 2005 at www.blackwell-synergy.com.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 60 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

6.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Rare individuals have a bright red ground color (Ref. 1602). Preopercular spine 0[2-5/0]1 (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 18 m (Ref. 9710), usually 1 - 18 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mandarin fish are tropical, marine fish found in waters with a temperature range of 24 to 26ºC. They are bottom dwelling, found at depths up to 18 m (Randall et al. 1990). During spawning they are pelagic and are seen in the open ocean (Sadovy et al, 2001). Mandarin fish are found on coral reefs and shallow lagoons hidden under foliose and dead coral (Randall et al. 1990). It is difficult to maintain mandarin fish in captivity because of their dietary requirements (Sadovy et al, 2001).

Range depth: 1 to 18 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0.61 - 17
  Temperature range (°C): 28.492 - 29.336
  Nitrate (umol/L): 0.059 - 0.341
  Salinity (PPS): 32.848 - 34.393
  Oxygen (ml/l): 4.279 - 4.641
  Phosphate (umol/l): 0.085 - 0.332
  Silicate (umol/l): 1.328 - 2.712

Graphical representation

Depth range (m): 0.61 - 17

Temperature range (°C): 28.492 - 29.336

Nitrate (umol/L): 0.059 - 0.341

Salinity (PPS): 32.848 - 34.393

Oxygen (ml/l): 4.279 - 4.641

Phosphate (umol/l): 0.085 - 0.332

Silicate (umol/l): 1.328 - 2.712
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 18m.
From 1 to 18 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits shallow protected lagoons and inshore reefs (Ref. 1602). Found on silty bottoms with coral and rubble (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Mandarin fish feed on the bottom. They eat small crustaceans such as amphipods and isopods, small worms and protozoans. Much of its food intake is found living in the reefs and other live rock. If there is a substantial amount of live rock, mandarin fish do not need any other outside source for food. In captivity, the fish usually do not eat prepared food, therefore it becomes difficult to maintain them. They need a great supply of live rock to feed. Mandarin fish have a relatively small mouth, therefore they eat only small food items (Delbeek 1989).

Animal Foods: aquatic or marine worms

Other Foods: microbes

Primary Diet: carnivore (Eats non-insect arthropods, Vermivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Mandarin fish eat small invertebrates (Sadovy et al. 2004). Beyond this, little is known of the role of mandarin fish in the ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mandarin fish secrete mucous which might act to repel predators. The intense coloration also might play a role in avoiding predation by signalling to potential predators that they are toxic (Sadovy et al. 2005). Early development could possibly be an adaptive strategy to reduce the risk of predation (Sadovy et al, 2001). There is no available information on specific predators of the species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mandarin fish secrete mucous that has an unpleasant smell and a bitter taste. They also have a layer of sacciform cells on the skin which produce and release substances with some toxins. It is suggested that this secretion is used as a repellent from predators and other competitive fish. The significance of the vibrant display of colors of the species is not known. However, it probably makes them highly conspicuous when feeding and mating and may be an aposematic warning (Sadovy et al. 2005).

Communication Channels: visual ; chemical

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Pairs ascend in close contact towards the surface where eggs and sperm are released (aquarium observation, Ref. 36808).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Mandarin fish have a short incubation time and larvae that are small and develop quickly. Clutch sizes range from 12 to 205. Eggs measure from 0.7 to 0.8 mm in diameter, are colorless, spherical, and pelagic. The eggs at first are clumped together and then slowly break up into smaller units. The eyes become pigmented and the mouth becomes well developed 36 hours after fertilization. During the flexion stage, which occurs after 8 to 11 days, the caudal fins become distinctive, the pelvic fin rays move distally and the body becomes robust. The larvae are active and feeding at this stage. After 12 to 14 days, which is the settlement stage, juveniles look like the adults with a large head,and a triangular shaped body. In 18 to 21 days, the body darkens to an orange brown color with greenish banding and the dorsal spines are observed. The adult color pattern does not develop until the second month when lengths are from 10 to 15 mm. The swim bladder is retained in adults (Sadovy et al. 2001).

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild mandarin fish are expected to live between 10 to 15 years (Sale, 2002). In captivity, however the lifespan is greatly reduced due to dietary requirements. On average, mandarin fish live between 2 to 4 years in captivity (Delbeek, 1989).

Typical lifespan

Status: wild:
10 to 15 years.

Typical lifespan

Status: captivity:
2 to 4 years.

  • Sale, P. 2002. Coral Reef Fishes : dynamics and diversity in a complex ecosystem. San Diego, CA: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning occurs on areas of the reef where small groups of males and females gather during the night. Mating occurs when the male and the female release sperm and eggs after they align themselves and rise about a meter above the reef. Each female spawns only once each night and may go without spawning for a few days. Since there are few active females, there is much competition amoung the males. The larger and stronger males tend to mate more frequently because there seems to be a sexual preference by the females for larger males (Sadovy, 2001).

Mating System: polygynandrous (promiscuous)

Mandarin fish are pelagic spawners. External fertilization occurs when a male and female are in close contact and swimming upward. Spawning occurs at about weekly intervals where up to 200 eggs are released. This occurs for several months (Delbreek, 1989) Mandarin fish breed year round. The population doubling time is less than 15 months (Randall, 1990).

Breeding interval: Breeding can occur weekly throughout the year.

Breeding season: Breeding occurs year round.

Range number of offspring: 200 (high) .

Average time to hatching: 12 hours.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Mandarin fish have no parental involvement after release and fertilization of eggs.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Synchiropus splendidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Synchiropus splendidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGGTATTTGGTGCATGAGCTGGCATGGTTGGCACTGCTCTAAGCCTTCTTATTCGGGCCGAGCTTAACCAACCCGGCGCTCTCCTTGGTGATGACCAAATTTATAATGTTATTGTTACAGCACATGCATTTGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGAGGCTTTGGTAATTGACTGGTGCCTATAATGATTGGTGCCCCTGACATAGCTTTCCCTCGTATGAATAATATAAGCTTCTGACTTCTACCGCCCTCATTCCTGCTACTTCTAGCCTCATCAGGTGTCGAAGCTGGAGCCGGAACAGGTTGAACCGTATATCCCCCCCTATCAAGCAACCTAGCACATGCTGGAGCCTCTGTAGATTTAACCATTTTTTCTCTTCATCTAGCAGGTATTTCATCCATTCTGGGGGCCATTAATTTTATCACAACTATTACAAATATGAAACCCCCAGCCTTAACCCAGTATCAGACACCCTTATTCGTCTGAGCCGTTTTAATTACAGCTGTACTGCTCCTTCTATCCCTGCCAGTATTAGCTGCAGGTATTACAATACTTCTTACTGATCGAAACCTAAACACCACATTTTTTGATCCGGCAGGCGGAGGGGACCCCATTCTTTACCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Mandarin fish do not have any special conservation status currently (Randall, 1990).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of S. splendidus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The vibrant display colors of mandarin fish make them valuable fish for the aquarium trade (Sadovy, 2001). The aquarium trade of mandarin fish plays a part in the local economies of the Phillipines and Hong Kong. These fish are also used as food in many Asian countries (Sadovy, 2001).

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mandarinfish

The mandarinfish or mandarin dragonet (Synchiropus splendidus), is a small, brightly colored member of the dragonet family, which is popular in the saltwater aquarium trade. The mandarinfish is native to the Pacific, ranging approximately from the Ryukyu Islands south to Australia.

Taxonomy and etymology[edit]

The mandarinfish was first described as Callionymus splendidus in 1927 by Albert William Herre, an American ichthyologist working in the Philippines.[1] It was later placed in genus Synchiropus. The generic name Synchiropus is from Ancient Greek syn-, meaning "together", and -chiropus meaning "hand-foot".[2] The specific epithet splendidus is from Latin for splendid. The common name of the mandarinfish comes from its extremely vivid colouration, evoking the robes of an Imperial Chinese mandarin.[3] Other common names include mandarin goby, green mandarin, striped mandarinfish, striped dragonet, green dragonet and sometimes psychedelic mandarinfish.[4][5][6] The similarly named mandarin fish (Siniperca chuatsi), properly known as the Chinese perch, is only distantly related.

The mandarinfish belongs to the perciform family Callionymidae, the dragonets, which counts 10 genera and more than 182 species. Genus Synchiropus counts 51 species, divided into 10 subgenera. The mandarinfish is in subgenus Synchiropus (Pterosynchiropus) along with the Australian LSD-fish (S. occidentalis) and the LSD- or psychedelic fish (S. picturatus).[7]

Description[edit]

To date, S. splendidus is one of only two vertebrate species known to have blue colouring because of cellular pigment, the other being the closely related psychedelic mandarin (S. picturatus). The name "cyanophore" was proposed for the blue chromatophores, or pigment-containing and light-reflecting cells. In all other known cases, the colour blue comes from thin-film interference from piles of flat, thin and reflecting purine crystals.[8]

Ecology[edit]

The mandarinfish viewed from the front

Mandarinfish are reef dwellers, preferring sheltered lagoons and inshore reefs. While they are slow-moving and fairly common within their range, they are not easily seen due to their bottom-feeding habit and their small size (reaching only about 6 cm). They feed primarily on small crustaceans and other invertebrates.

Diet[edit]

Based on the gut analyses of 7 wild fish Sadovy et al. (2001) determined that the mandarinfish has a mixed diet that consists of harpacticoid copepods, polychaete worms, small gastropods, gammaridean amphipods, fish eggs and ostracods. In the wild, feeding is continuous during daytime; the fish peck selectively at small prey trapped on coral substrate in a home range of many square meters.[9]

Relationship to humans[edit]

Despite their popularity in the aquarium trade, mandarinfish are considered difficult to keep, as their feeding habits are very specific. Some fish never adapt to aquarium life, refusing to eat anything but live amphipods and copepods (as in the wild), though individuals that do acclimatize to aquarium food are considered to be quite hardy and highly resistant to diseases such as marine ich. They are less likely to contract the disease Cryptocaryon, because they do not have the skin type that this common aquarium disease affects.[citation needed] The mandarinfish appeared on a 39 kip postage stamp from Laos issued in 1987, and a 40 cent postage stamp of the Federated States of Micronesia issued on 26 August 1993.[10][11]

Green mandarin in a reef aquarium

References[edit]

  1. ^ Pietsch, T. W.; W. D. Anderson, Jr. (editors) (1997). "Albert William Christian Theodore Herre (1868-1962): A brief autobiography and a bibliography of his ichthyological and fishery science publications, with a foreword by George S. Myers(1905-1985); Collection Building in Ichthyology and Herpetology". American Society of Ichthyology and Herpetology, Special Publications 3: 351–366. 
  2. ^ Humphreys, W. F.; W. A. Shear (1993). "Troglobitic Millipedes (Diplopoda, Paradoxosomatidae) from semi-arid Cape Range, Western Australia: systematics and biology". Invertebrate Taxonomy 7 (1): 173–195. doi:10.1071/IT9930173. 
  3. ^ Mills, Dick (December 1, 2004). The marine aquarium: comprehensive coverage, from setting up an aquarium to choosing the best fishes. Mini Encyclopedia. Barron's Educational Series. p. 200. ISBN 0-7641-2987-2. 
  4. ^ Crow, Richard; Alice Burkhart; Dave Keeley (2002). Pocket Guide to the Care and Maintenance of Aquarium Fish. PRC Publishing. p. 247. ISBN 1-85648-632-X. Retrieved 2009-09-08. 
  5. ^ Hauter, Stan; Debbie Hauter (s.d.). "Striped Mandarinfish Profile". Saltwater Aquariums. About.com. Retrieved 8 September 2009. 
  6. ^ Avila, Marcos A. (s.d.). "Synchiropus picturatus". Saltwater Fish. Age of Aquariums. Retrieved 8 September 2009. 
  7. ^ Fricke, R. (2002). "Annotated Checklist of the Dragonet Families Callionymidae and Draconettidae (Teleostei: Callionymoidei), with Comments on Callionymid Fish Classification". Stuttgarter Beiträge zur Naturkunde Serie A (Biologie) 645: 1–103. Retrieved 2009-09-08. 
  8. ^ Goda, M.; R. Fujii (2009). "Blue Chromatophores in Two Species of Callionymid Fish". Zoological Science 12 (6): 811–813. doi:10.2108/zsj.12.811. 
  9. ^ Sadovy, Yvonne; George Mitcheson and Maria B. Rasotto (December 2001). "Early Development of the Mandarinfish, Synchiropus splendidus (Callionymidae), with notes on its Fishery and Potential for Culture". Aquarium Sciences and Conservation (Springer Netherlands) 3 (4): 253–263. doi:10.1023/A:1013168029479. 
  10. ^ "Mandarinfish". Stamp Collectors Catalogue. Stamp Collectors Catalogue. s.d. Retrieved 8 September 2009. 
  11. ^ "Micronesia: 40c Fish – Mandarinfish". Stamp Supply Selections. Seaside Book & Stamp. 2 November 2006. Retrieved 8 September 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!