Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Found at depths between 415 and 1000 m in New Zealand waters, and 62 to 800 m in South American waters. The Patagonian population feeds on southern blue whiting, whiptail, nototheniids and squids. The New Zealand population feeds mainly on fishes (especially gadoids), squids, euphausiids and benthic organisms. Adults probably migrate southward during the southern summer for feeding and return to the north in winter for spawning (Ref. 1371). Spawning takes place from August to September on the western coast of South Island, from September to November in the northern part of the Campbell Plateau, and between November and January on Chatham Rise (Ref. 58452). Utilized as food fish and fishmeal.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal in the southern hemisphere (Ref. 7300). Two distinct groups. New Zealand population: Chatham Rise, Campbell Plateau and South Island northward to the East Cape. Patagonian population: Chiloé Island in the Pacific, southward around the southern tip of South America to the continental shelf to 59°S, and the slope north to 38°S in the Atlantic.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cook Strait, FAO fishing area 47, FAO fishing area 61, FAO fishing area 81, FAO fishing area 87, New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand, Patagonia, Chile and Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Japan, Australia, New Zealand, southern coast of Chile and Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 48 - 57; Analspines: 0; Analsoft rays: 40 - 46; Vertebrae: 53 - 58
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1260 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

155 cm SL (male/unsexed; (Ref. 58452)); max. reported age: 30 years (Ref. 9072)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body more slender than other hakes. Pectoral fins long and slender, stripe reaching anal fin in young individuals but not in fish over 50 cm in SL. Gill rakers short and thick with blunt tips. Color is steel gray on back grading to silvery white ventrally.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Merluccius polylepis
Catalog Number: USNM 157766
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Puerto Auchemo, Chile, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Merluccius polylepis
Catalog Number: USNM 157764
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Castro, Chile, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Merluccius polylepis
Catalog Number: USNM 157765
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Castro, Chile, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); marine; depth range 28 - 1000 m (Ref. 58489)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5996 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4709 samples.

Environmental ranges
  Depth range (m): 6 - 1445.5
  Temperature range (°C): 2.566 - 14.897
  Nitrate (umol/L): 1.787 - 35.638
  Salinity (PPS): 32.612 - 35.193
  Oxygen (ml/l): 3.879 - 7.135
  Phosphate (umol/l): 0.304 - 2.416
  Silicate (umol/l): 0.000 - 67.456

Graphical representation

Depth range (m): 6 - 1445.5

Temperature range (°C): 2.566 - 14.897

Nitrate (umol/L): 1.787 - 35.638

Salinity (PPS): 32.612 - 35.193

Oxygen (ml/l): 3.879 - 7.135

Phosphate (umol/l): 0.304 - 2.416

Silicate (umol/l): 0.000 - 67.456
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 62 - 1000m.
From 62 to 1000 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental slope (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Merluccius australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCTTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATCCGGGCAGAACTTAGTCAACCAGGCGCACTCCTGGGCGACGATCAAATTTATAACGTAATCGTCACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCGTTAATAATTGGAGGCTTTGGAAACTGACTCGTCCCCCTAATGATCGGAGCCCCCGACATAGCCTTTCCCCGAATGAATAACATAAGCTTCTGGCTTCTCCCTCCATCTTTCCTGCTCCTCCTAGCATCTTCCGGGGTAGAAGCCGGGGCCGGCACAGGTTGAACAGTTTACCCCCCTCTTGCAAGCAATCTTGCCCACGCTGGCCCCAGCGTGGACCTCACTATTTTCTCACTTCACTTAGCAGGCATTTCCTCAATTCTGGGAGCAATTAATTTCATTACTACTATTATTAATATAAAGCCCCCTGCAATCTCACAATACCAGACACCCCTCTTTGTTTGATCCGTCCTTATTACAGCCGTCCTTCTCCTACTCTCCCTGCCCGTCTTGGCCGCCGGCATCACAATACTGCTAACTGACCGAAACCTCAACACCTCCTTCTTTGACCCCGCCGGAGGGGGAGACCCCATCCTATACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Merluccius australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!