Merluccius australis — Details

Whiting learn more about names for this taxon

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Learn more about this article

Found at depths between 415 and 1000 m in New Zealand waters, and 62 to 800 m in South American waters. The Patagonian population feeds on southern blue whiting, whiptail, nototheniids and squids. The New Zealand population feeds mainly on fishes (especially gadoids), squids, euphausiids and benthic organisms. Adults probably migrate southward during the southern summer for feeding and return to the north in winter for spawning (Ref. 1371). Spawning takes place from August to September on the western coast of South Island, from September to November in the northern part of the Campbell Plateau, and between November and January on Chatham Rise (Ref. 58452). Utilized as food fish and fishmeal.

Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371) http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Circumglobal in the southern hemisphere (Ref. 7300). Two distinct groups. New Zealand population: Chatham Rise, Campbell Plateau and South Island northward to the East Cape. Patagonian population: Chiloé Island in the Pacific, southward around the southern tip of South America to the continental shelf to 59°S, and the slope north to 38°S in the Atlantic.

Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371) http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Cook Strait, FAO fishing area 47, FAO fishing area 61, FAO fishing area 81, FAO fishing area 87, New Zealand Exclusive Economic Zone

Lloris, D.; Matallanas, J.; Oliver P. (2005). Hakes of the world (Family Merlucciidae). An annotated and illustrated catalogue of hake species known to date. FAO Species Catalogue for Fishery Purposes. No. 2. Rome, FAO. 57p. 12 colour plates. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138596
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

New Zealand, Patagonia, Chile and Argentina.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Japan, Australia, New Zealand, southern coast of Chile and Argentina.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 1; Dorsal soft rays (total): 48 - 57; Analspines: 0; Analsoft rays: 40 - 46; Vertebrae: 53 - 58

Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371) http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 1260 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

155 cm SL (male/unsexed; (Ref. 58452)); max. reported age: 30 years (Ref. 9072)

Annala, J.H. (comp.) 1994 Report from the Fishery Assessment Plenary, May 1994: stock assessments and yield estimates. Unpublished report held in MAF Fisheries Greta Point library, Wellington. 242 p. (Ref. 9072) http://www.fishbase.org/references/FBRefSummary.php?id=9072&speccode=5048
Lloris, D., J. Matallanas and P. Oliver 2005 Hakes of the world (Family Merlucciidae). An annotated and illustrated catalogue of hake species known to date. FAO Spec. Cat. Fish. Purp. 2:57p. Rome: FAO. (Ref. 58452) http://www.fishbase.org/references/FBRefSummary.php?id=58452&speccode=30

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Body more slender than other hakes. Pectoral fins long and slender, stripe reaching anal fin in young individuals but not in fish over 50 cm in SL. Gill rakers short and thick with blunt tips. Color is steel gray on back grading to silvery white ventrally.

Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371) http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Paratype for Merluccius polylepis
Catalog Number: USNM 157766
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Puerto Auchemo, Chile, Pacific

Paratype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Type for Merluccius polylepis
Catalog Number: USNM 157764
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Castro, Chile, Pacific

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Merluccius polylepis
Catalog Number: USNM 157765
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Lobell, Knake & Westman
Year Collected: 1945
Locality: Chile Castro, Chile, Pacific

Paratype:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

benthopelagic; oceanodromous (Ref. 51243); marine; depth range 28 - 1000 m (Ref. 58489)

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Stevenson, M.L. 2004 Trawl survey of the west coast of the South Island and Tasman and Golden Bays, March-april 2003 (KAH0304). New Zealand Fisheries Assessment Report 2004/4. 69 p. (Ref. 58489) http://www.fishbase.org/references/FBRefSummary.php?id=58489&speccode=13142

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 5996 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4709 samples.

Environmental ranges
  Depth range (m): 6 - 1445.5
  Temperature range (°C): 2.566 - 14.897
  Nitrate (umol/L): 1.787 - 35.638
  Salinity (PPS): 32.612 - 35.193
  Oxygen (ml/l): 3.879 - 7.135
  Phosphate (umol/l): 0.304 - 2.416
  Silicate (umol/l): 0.000 - 67.456

Graphical representation

Depth range (m): 6 - 1445.5

Temperature range (°C): 2.566 - 14.897

Nitrate (umol/L): 1.787 - 35.638

Salinity (PPS): 32.612 - 35.193

Oxygen (ml/l): 3.879 - 7.135

Phosphate (umol/l): 0.304 - 2.416

Silicate (umol/l): 0.000 - 67.456

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 62 - 1000m.
From 62 to 1000 meters.

Habitat: benthopelagic.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.

Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243) http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Found on the continental slope (Ref. 75154).

PayÃ¡, I. 1992 The diet of Patagonian hake Merluccius australis polylepis and its daily ration of Patagonian grenadier Macrouronus magellanicus. p. 753-760. In A.I.L. Payne, K.H. Brink, K.H. Mann and R. Hilborn (eds.) Benguela trophic functioning. S. Afr. J. Mar. Sci. 12. (Ref. 13487) http://www.fishbase.org/references/FBRefSummary.php?id=13487&speccode=322

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Merluccius australis

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTCGTATTTGGTGCTTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATCCGGGCAGAACTTAGTCAACCAGGCGCACTCCTGGGCGACGATCAAATTTATAACGTAATCGTCACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCGTTAATAATTGGAGGCTTTGGAAACTGACTCGTCCCCCTAATGATCGGAGCCCCCGACATAGCCTTTCCCCGAATGAATAACATAAGCTTCTGGCTTCTCCCTCCATCTTTCCTGCTCCTCCTAGCATCTTCCGGGGTAGAAGCCGGGGCCGGCACAGGTTGAACAGTTTACCCCCCTCTTGCAAGCAATCTTGCCCACGCTGGCCCCAGCGTGGACCTCACTATTTTCTCACTTCACTTAGCAGGCATTTCCTCAATTCTGGGAGCAATTAATTTCATTACTACTATTATTAATATAAAGCCCCCTGCAATCTCACAATACCAGACACCCCTCTTTGTTTGATCCGTCCTTATTACAGCCGTCCTTCTCCTACTCTCCCTGCCCGTCTTGGCCGCCGGCATCACAATACTGCTAACTGACCGAAACCTCAACACCTCCTTCTTTGACCCCGCCGGAGGGGGAGACCCCATCCTATACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Merluccius australis

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 34
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: highly commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species

Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931) http://www.fishbase.org/references/FBRefSummary.php?id=4931&speccode=228

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!