Overview

Comprehensive Description

Biology

Found in sandy areas of shallow lagoon reefs. Inhabits coastal bays and inner reefs, usually on deep silty slopes from about 15 meters down (Ref. 48637). Occurs in pairs (Ref. 90102).
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: extremely rare, known from widely scattered localities in the Indian Ocean and western tropical Pacific.
  • Hoese, D.F. and H.K. Larson 1994 Revision of the Indo-Pacific gobiid fish genus Valenciennea, with descriptions of seven new species. Indo-Pac. Fish. (23):71 p. (Ref. 8527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 7; Dorsal soft rays (total): 112; Analspines: 1; Analsoft rays: 11 - 12
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 48637))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 3. Jawfishes - Sunfishes, Opistognathidae - Molidae. Zoonetics, Australia. p. 623-893. (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale grey to whitish body color with three brown bars on side; blue-white band below eye; first dorsal fin with ocellated black spot; presence of narrow dark brown saddles below anterior part of second dorsal fin and dorsally on caudal peduncle; brown with narrow blue margin, outer half of caudal fin; without filamentous dorsal spines; rounded caudal fin, equal or slightly shorter than head; longitudinal scale series 70-88; ctenoid body scales, becoming cycloid anteriorly in front of first dorsal fin; head or midline of nape without scales; side of nape with scales extending forward slightly anterior to opening of gill; pectoral fin base and prepelvic area usually scaled; depth of body 5.0-5.5 in SL (Ref. 90102).
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Observed in burrows on silty sand bottoms of the Red Sea.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 35 m (Ref. 90102), usually 5 - 20 m (Ref. 27115)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 20m.
From 5 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 22 - 88
  Temperature range (°C): 22.767 - 24.915
  Nitrate (umol/L): 0.241 - 12.974
  Salinity (PPS): 33.939 - 35.559
  Oxygen (ml/l): 2.391 - 4.855
  Phosphate (umol/l): 0.133 - 1.171
  Silicate (umol/l): 1.055 - 16.407

Graphical representation

Depth range (m): 22 - 88

Temperature range (°C): 22.767 - 24.915

Nitrate (umol/L): 0.241 - 12.974

Salinity (PPS): 33.939 - 35.559

Oxygen (ml/l): 2.391 - 4.855

Phosphate (umol/l): 0.133 - 1.171

Silicate (umol/l): 1.055 - 16.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Valenciennea wardii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCCGGTATAATTGGCACCGCCTTAAGCCTGCTAATTCGAGCCGAGCTTAGCCAGCCCGGAGCACTGCTCGGAGACGATCAAATTTATAACGTAATCGTTACTGCCCACGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGGAACTGACTAATCCCACTAATGATTGGTGCCCCAGATATAGCCTTCCCACGAATAAACAACATGAGCTTCTGACTACTACCCCCATCTTTCCTACTCTTACTAGCCTCTTCCGGGGTTGAGGCGGGGGCGGGAACAGGGTGGACTGTTTACCCACCCCTAGCCGGCAACCTGGCCCACGCTGGAGCGTCTGTAGACTTAACAATTTTCTCCCTTCACTTAGCTGGAATCTCCTCAATTCTAGGGGCAATTAACTTTATCACCACCATTTTAAATATGAAACCCCCAGCTATCTCTCAGTATCAGACACCACTGTTTGTCTGAGCTGTCCTGATTACTGCTGTTCTGCTACTTCTGTCCCTCCCTGTTCTTGCTGCAGGAATTACAATGCTTCTTACGGACCGAAACCTAAACACCACATTCTTCGACCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Valenciennea wardii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Valenciennea wardii

Valenciennea wardii, Ward's sleeper, is a species of goby native to the Indian Ocean and the western Pacific Ocean in bays, reefs and lagoons at depths of from 12 to 35 metres (39 to 115 ft). It can be found on sandy or silty substrates. This species can reach a length of 15 centimetres (5.9 in) SL. It can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Valenciennea wardii" in FishBase. June 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!