Overview

Comprehensive Description

Biology

Found over sand (Ref. 58302). Generally found at depths deeper than 60 meters (Ref. 54393).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Hawaii and Johnston islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Pacific: Johnston Atoll and Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 9; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

19.6 cm SL (male/unsexed; (Ref. 54393))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: Pectoral rays nearly always 16 (4 of 36 specimens with 15 on one side and 17 on the other). Gill rakers 7-8 + 25-28 (total 32-35). Body depth 3.3-4.05 in SL; head length (HL) 2.7-3.05 in SL; eye relatively large, the orbit diameter 4.4 - 5.3 in HL (118-196 mm SL); snout length 1.65-2.1 in HL (snout progressively longer with growth); barbel long 1.1-1.3 in HL; dorsal spine longest in HL; last dorsal rays about equal in length; pectoral-fin length 1.35-1.5 in HL; pelvic fins 1.2-1.4 in HL. White, scale edges narrowly dark, with a red or brown band from front of snout along back adjacent to base of dorsal fins, the scales within band with dark brown edges, and many with a dark brown spot; a red or dark brown stripe from front of snout through eye and broadening as it follows the lateral line; stripe partially interrupted below rear base of second dorsal fin, then ending in a broad slightly oblique bar on caudal peduncle; a vertically elongate dark red or dark brown spot within stripe behind eye in line with posterior margin of preopercle; barbels varying from bright red to yellow or mixed red and yellow; membranes of first dorsal fin red; second dorsal fin red basally, the outer half with narrow irregular pale yellow and pale blue bands separated by dark reddish lines; anal fin with similar bands on all of fin; caudal fin mainly yellow, usually with small white spots basally; pelvic fins largely red. Specimens from the deep water are entirely red without upper band and lateral stripe; a dark red spot behind eye; fins colored as in shallower-water fish except caudal fin more red (Ref. 54393).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Parupeneus chrysonemus
Catalog Number: USNM 164657
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Parupeneus chrysonemus
Catalog Number: USNM 164656
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1898
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Parupeneus chrysonemus
Catalog Number: USNM 50666
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Parupeneus chrysonemus
Catalog Number: USNM 50676
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): United States Fish Commission (USFC)
Year Collected: 1901
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Parupeneus chrysonemus
Catalog Number: USNM 126549
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cotype for Parupeneus chrysonemus
Catalog Number: USNM 126548
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Cotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 20 - 183 m (Ref. 54393), usually 60 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 63 - 124
  Temperature range (°C): 21.733 - 23.880
  Nitrate (umol/L): 0.006 - 0.434
  Salinity (PPS): 35.066 - 35.173
  Oxygen (ml/l): 4.731 - 4.951
  Phosphate (umol/l): 0.110 - 0.135
  Silicate (umol/l): 1.266 - 1.866

Graphical representation

Depth range (m): 63 - 124

Temperature range (°C): 21.733 - 23.880

Nitrate (umol/L): 0.006 - 0.434

Salinity (PPS): 35.066 - 35.173

Oxygen (ml/l): 4.731 - 4.951

Phosphate (umol/l): 0.110 - 0.135

Silicate (umol/l): 1.266 - 1.866
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Parupeneus chrysonemus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTTACCTAGTCTTCGGTGCTTGGGCCGGAATGGTGGGAACTGCTTTAAGCCTCTTAATTCGTGCCGTACTCTGCCAGCCAGGCGCTCTCCTAGGAGAT---GACGAGATCTACAACGTAATTGTCACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATACCGATCATGATTGGAGGGTTTGGCAACTGACTCATTCCGCTCATGATTGGTGCACCAGACATGGCTTTCCCCCGAATGAACAACATGAGCTTCTGGCTGCTCCCTCCCTCTTTCCTTCTCCTACTTGCCTCCTCAGGCGTTGAAGCCGGAGCAGGGACCGGTTGAACAGTCTACCCCCCACTAGCAGGCAATCTAGCGCATGCTGGAGCATCTGTTGACCTAACTATCTTCTCTCTCCACCTAGCCGGCATTTCTTCTATTCTTGGGGCTATTAATTTTATTACTACCATTATTAACATGAAACCTCCTGCAATCTCACAGTACCAAACGCCTCTGTTCGTCTGAGCTGTCCTAATTACCGCCGTCCTTCTTCTTCTGTCACTCCCAGTACTTGCTGCTGGCATTACAATGCTACTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGGGGCGGGGACCCGATCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parupeneus chrysonemus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!