Overview
Comprehensive Description
Biology
Found over sand (Ref. 58302). Generally found at depths deeper than 60 meters (Ref. 54393).
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Distribution
Eastern Central Pacific: Hawaii and Johnston islands.
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Physical Description
Morphology
Dorsal spines (total): 8; Dorsal soft rays (total): 9; Analsoft rays: 7
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Size
Max. size
19.6 cm SL (male/unsexed; (Ref. 54393))
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Diagnostic Description
Diagnosis: Pectoral rays nearly always 16 (4 of 36 specimens with 15 on one side and 17 on the other). Gill rakers 7-8 + 25-28 (total 32-35). Body depth 3.3-4.05 in SL; head length (HL) 2.7-3.05 in SL; eye relatively large, the orbit diameter 4.4 - 5.3 in HL (118-196 mm SL); snout length 1.65-2.1 in HL (snout progressively longer with growth); barbel long 1.1-1.3 in HL; dorsal spine longest in HL; last dorsal rays about equal in length; pectoral-fin length 1.35-1.5 in HL; pelvic fins 1.2-1.4 in HL. White, scale edges narrowly dark, with a red or brown band from front of snout along back adjacent to base of dorsal fins, the scales within band with dark brown edges, and many with a dark brown spot; a red or dark brown stripe from front of snout through eye and broadening as it follows the lateral line; stripe partially interrupted below rear base of second dorsal fin, then ending in a broad slightly oblique bar on caudal peduncle; a vertically elongate dark red or dark brown spot within stripe behind eye in line with posterior margin of preopercle; barbels varying from bright red to yellow or mixed red and yellow; membranes of first dorsal fin red; second dorsal fin red basally, the outer half with narrow irregular pale yellow and pale blue bands separated by dark reddish lines; anal fin with similar bands on all of fin; caudal fin mainly yellow, usually with small white spots basally; pelvic fins largely red. Specimens from the deep water are entirely red without upper band and lateral stripe; a dark red spot behind eye; fins colored as in shallower-water fish except caudal fin more red (Ref. 54393).
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Type Information
Paratype for Parupeneus chrysonemus
Catalog Number: USNM 164657
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 164657
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
- Paratype:
Trusted
Paratype for Parupeneus chrysonemus
Catalog Number: USNM 164656
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1898
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 164656
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1898
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
- Paratype:
Trusted
Type for Parupeneus chrysonemus
Catalog Number: USNM 50666
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 50666
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
- Type:
Trusted
Cotype for Parupeneus chrysonemus
Catalog Number: USNM 50676
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): United States Fish Commission (USFC)
Year Collected: 1901
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 50676
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): United States Fish Commission (USFC)
Year Collected: 1901
Locality: Hilo, Hawaii, Hawaii, United States, Hawaiian Islands, Pacific
- Cotype:
Trusted
Cotype for Parupeneus chrysonemus
Catalog Number: USNM 126549
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 126549
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Hawaii: Hilo, Hawaii, United States, Hawaiian Islands, Pacific
- Cotype:
Trusted
Cotype for Parupeneus chrysonemus
Catalog Number: USNM 126548
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 126548
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & B. Evermann
Year Collected: 1901
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
- Cotype:
Trusted
Ecology
Habitat
Environment
demersal; marine; depth range 20 - 183 m (Ref. 54393), usually 60 - ? m
-
Randall, J.E. 2004 Revision of the goatfish genus Parupeneus (Perciformes: Mullidae), with descriptions of two new species. Indo-Pac. Fish. (36):64 p. (Ref. 54393)
http://www.fishbase.org/references/FBRefSummary.php?id=54393&speccode=10470
Trusted
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 63 - 124
Temperature range (°C): 21.733 - 23.880
Nitrate (umol/L): 0.006 - 0.434
Salinity (PPS): 35.066 - 35.173
Oxygen (ml/l): 4.731 - 4.951
Phosphate (umol/l): 0.110 - 0.135
Silicate (umol/l): 1.266 - 1.866
Graphical representation
Depth range (m): 63 - 124
Temperature range (°C): 21.733 - 23.880
Nitrate (umol/L): 0.006 - 0.434
Salinity (PPS): 35.066 - 35.173
Oxygen (ml/l): 4.731 - 4.951
Phosphate (umol/l): 0.110 - 0.135
Silicate (umol/l): 1.266 - 1.866
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 63 - 124
Temperature range (°C): 21.733 - 23.880
Nitrate (umol/L): 0.006 - 0.434
Salinity (PPS): 35.066 - 35.173
Oxygen (ml/l): 4.731 - 4.951
Phosphate (umol/l): 0.110 - 0.135
Silicate (umol/l): 1.266 - 1.866
Graphical representation
Depth range (m): 63 - 124
Temperature range (°C): 21.733 - 23.880
Nitrate (umol/L): 0.006 - 0.434
Salinity (PPS): 35.066 - 35.173
Oxygen (ml/l): 4.731 - 4.951
Phosphate (umol/l): 0.110 - 0.135
Silicate (umol/l): 1.266 - 1.866
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Parupeneus chrysonemus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CTTTACCTAGTCTTCGGTGCTTGGGCCGGAATGGTGGGAACTGCTTTAAGCCTCTTAATTCGTGCCGTACTCTGCCAGCCAGGCGCTCTCCTAGGAGAT---GACGAGATCTACAACGTAATTGTCACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATACCGATCATGATTGGAGGGTTTGGCAACTGACTCATTCCGCTCATGATTGGTGCACCAGACATGGCTTTCCCCCGAATGAACAACATGAGCTTCTGGCTGCTCCCTCCCTCTTTCCTTCTCCTACTTGCCTCCTCAGGCGTTGAAGCCGGAGCAGGGACCGGTTGAACAGTCTACCCCCCACTAGCAGGCAATCTAGCGCATGCTGGAGCATCTGTTGACCTAACTATCTTCTCTCTCCACCTAGCCGGCATTTCTTCTATTCTTGGGGCTATTAATTTTATTACTACCATTATTAACATGAAACCTCCTGCAATCTCACAGTACCAAACGCCTCTGTTCGTCTGAGCTGTCCTAATTACCGCCGTCCTTCTTCTTCTGTCACTCCCAGTACTTGCTGCTGGCATTACAATGCTACTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGGGGCGGGGACCCGATCCTCTACCAACACCTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Parupeneus chrysonemus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


