Overview

Comprehensive Description

Biology

Found in muddy bays and banks and on coral reefs from close inshore to 110 m depth (Ref. 9862). Ovoviviparous (Ref. 50449). Caught in bottom trawls, gillnets, seines, and fish traps (Ref. 9862, Ref.58048). Utilized for its meat and cartilage (possibly used as "filler" in shark fin soups as with other large eagle rays) (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: scattered localities, from southern Mozambique to the western Pacific.
  • Compagno, L.J.V. 1997 Myliobatidae. Eagle rays. p. 1511-1519. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes. Part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9862)   http://www.fishbase.org/references/FBRefSummary.php?id=9862&speccode=8687 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Sporadic distribution in the Western and Eastern Indian, Western Central and Northwest Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1600 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

240 cm WD (male/unsexed; (Ref. 58048))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found in muddy bays and banks and on coral reefs from close inshore to 110 m depth (Ref. 9862). Probably caught in bottom trawls, gillnets, seines, and fish traps (Ref. 9862). Presumably utilized as food in the Western central Pacific (Ref. 9862).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 110m.
Recorded at 110 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; marine; depth range ? - 110 m (Ref. 9862)
  • Compagno, L.J.V. 1997 Myliobatidae. Eagle rays. p. 1511-1519. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes. Part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9862)   http://www.fishbase.org/references/FBRefSummary.php?id=9862&speccode=8687 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Little known species. Occurs on the inner continental shelf to depths of 110 m over soft sandy substrate (Compagno and Last 1999). Reproductive biology, age and growth and dietary compositions are unknown for this species. Suspected low fecundity as with other myliobatids, for example Aetobatus narinari and Aetomylaeus nichofii, which bear litters of up to four offspring (Last and Stevens 1994, Compagno and Last 1999).

Life history parameters
Age at maturity (years): Unknown.
Size at maturity (total length cm): Unknown.
Longevity (years): Unknown.
Maximum size (total length/disc width): 240 cm DW (W. White, unpubl. data) 160 cm DW, 385 cm TL (Compagno and Last 1999).
Size at birth (cm): Unknown.
Average reproductive age (years): Unknown.
Gestation time (months): Unknown.
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: Up to 4 (based on similar species).
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aetomylaeus vespertilio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAATTTTTGGTGCATGAGCAGGGATAGTGGGTACTGGTCTCAGTTTACTTATCCGAACAGAATTAAGTCAGCCCGGGGCCCTATTAGGTGATGACCAAATTTATAACGTGATTGTTACTGCCCACGCCTTTGTAATAATTTTTTTTATGGTTATGCCAATTATAATCGGAGGGTTTGGTAATTGACTGGTTCCTCTAATAATTGGCGCTCCAGATATGGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCTTTTCTCCTGTTATTAGCTTCGGCTGGGGTAGAGGCTGGGGCTGGAACTGGGTGAACGGTTTACCCTCCTCTAGCCGGCAACCTAGCACACGCCGGAGCTTCTGTGGACTTAGCAATTTTCTCTTTACATCTAGCAGGAGTTTCCTCTATCTTAGCGTCAATTAACTTCATCACTACAATTGTTAACATAAAACCGCCTGCAATCTCCCAATACCAAACCCCTCTCTTTGTCTGATCTATTCTTATCACAGCTGTTCTCCTCCTATTATCTTTGCCTGTCCTAGCAGCCGGTATCACTATGCTCCTCACAGATCGTAATCTTAACACAACTTTCTTTGACCCCGCGGGGGGTGGGGACCCAATTCTCTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aetomylaeus vespertilio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+3d+4d

Version
3.1

Year Assessed
2006

Assessor/s
White, W.T.

Reviewer/s
Kyne, P.M., Fowler, S.L. & Compagno, L.J.V. (Shark Red List Authority)

Contributor/s

Justification
Aetomylaeus vespertilio is a large (to 240 cm disc width), uncommon eagle ray which has not been sighted in any great numbers since its description more than 160 years ago. This species would be highly susceptible to a variety of fishing methods in regions where the level of exploitation of marine resources is very high and is increasing (e.g., India, Thailand, Taiwan and Indonesia). It is occasionally caught by the rhynchobatid gillnet fishery that operates in SE Asia. In Australian waters the fishing pressure would not be very high but it is rarely observed there. It is suspected to have limiting life history parameters similar to other myliobatid rays (including low fecundity). This species is assessed as Endangered under the criteria of A2bd+3d+4d due to the very high (and increasing) level of fishing pressure in inshore regions where it occurs, which is of great concern for this large, uncommon inshore species with limiting life history characteristics and high susceptibility to capture.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Appears to be naturally uncommon, rarely observed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Endangered (EN) (A2bd+3d+4d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Highly susceptible to a variety of inshore demersal fisheries, including trawls, gillnets and trammel nets which operate intensively throughout its range (e.g., India, Thailand, Taiwan and Indonesia). All individuals caught are retained in most areas. Local eagle ray species are marketed in considerable numbers in Thailand and Malaysia (Compagno and Last 1999). A. maculates is occasionally landed in low numbers in the fish markets of Jakarta (Indonesia) by trawlers and is occasionally caught by the rhynchobatid gillnet fishery that operates in SE Asia (W. White, unpublished data). Even though once common, eagle rays are now rare in the Gulf of Thailand (Compagno and Last 1999). Intensive demersal fisheries occur in India, in the species? known distribution (Hanfee 1999). There is very high level of exploitation on the habitat that this species occurs in throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place. Market surveys are currently being conducted for elasmobranchs in Indonesia.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the region. See Anon. (2004) for an update of progress made by nations in the range of A. vespertilio.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ornate eagle ray

The ornate eagle ray or reticulate eagle ray (Aetomylaeus vespertilio) is a species of fish in the Myliobatidae family. It is found in Australia, China, India, Indonesia, Malaysia, Maldives, Mozambique, Taiwan, and Thailand. Its natural habitats are open seas, shallow seas, subtidal aquatic beds, and estuarine waters. It is usually found at depths of 5-50m.

The ornate eagle ray has a clearly distinct pattern of reticulate dark lines and rings on its back. If the extremely long tail is unbroken, it can considerably add to the maximum body length of 4m.

Lacking spine on the tail, it is deemed harmless to humans.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!