Overview

Comprehensive Description

Biology

Adults inhabit lagoon and offshore coral reefs (Ref. 7247). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Coral Sea (including the northern Great Barrier Reef) to Samoa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Chrysiptera taupou
Catalog Number: USNM 51741
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 0 - 10 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 56 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 1 - 35
  Temperature range (°C): 24.633 - 29.115
  Nitrate (umol/L): 0.045 - 0.201
  Salinity (PPS): 34.540 - 35.547
  Oxygen (ml/l): 4.485 - 4.851
  Phosphate (umol/l): 0.114 - 0.222
  Silicate (umol/l): 0.721 - 1.542

Graphical representation

Depth range (m): 1 - 35

Temperature range (°C): 24.633 - 29.115

Nitrate (umol/L): 0.045 - 0.201

Salinity (PPS): 34.540 - 35.547

Oxygen (ml/l): 4.485 - 4.851

Phosphate (umol/l): 0.114 - 0.222

Silicate (umol/l): 0.721 - 1.542
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and offshore coral reefs (Ref. 7247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera taupou

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATGGTCGGCACAGCCCTGAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCACTCCTAGGAGACGACCAGATCTATAACGTCATCGTTACCGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGCTTTGGGAACTGGTTAGTTCCCTTAATGTTAGGAGCCCCCGATATAGCATTCCCTCGAATGAACAACATAAGCTTCTGGCTGCTGCCTCCATCATTCCTCCTCCTCCTCGCCTCTTCGGGGGTTGAGGCCGGAGCTGGCACAGGCTGAACTGTTTACCCCCCTCTATCCGGCAACCTTGCCCATGCAGGCGCATCAGTTGACCTCACTATTTTCTCCCTACACTTAGCAGGTGTCTCATCTATTCTGGGGGCTATTAATTTTATTACTACCATTATCAACATAAAACCCCCAGCCATCACACAATATCAGACCCCCTTATTTGTCTGAGCAGTCTTAATTACTGCTGTTCTCCTCCTTCTCTCCCTACCAGTTTTAGCCGCTGGCATCACCATGCTTTTAACGGACCGAAACCTTAACACAACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera taupou

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chrysiptera taupou

Chrysiptera taupou, known commonly as the southseas devil, southseas demoiselle, and Fiji damsel, is a species of damselfish. It is native to the western Pacific Ocean from the Coral Sea to Samoa.[1]

Contents

Description[edit]

This fish reaches about 8 centimeters in length.[1]

Biology[edit]

Habitat types include reefs and lagoons. The fish pairs up to breed and the male guards and tends the eggs.[1]

Uses[edit]

The fish has value as a specimen in public aquaria.[1]

References[edit]

  1. ^ a b c d Froese, R. and D. Pauly, Eds. Chrysiptera taupou. FishBase. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!