Overview

Comprehensive Description

Biology

Adults inhabit coral-rich areas of sheltered lagoon and inshore coral reefs (Ref. 9710). They occur in small groups on Acropora patches (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: including Solomon Islands, northern Papua New Guinea, Philippines, and Ryukyu Islands. There is a doubtful record from the Great Barrier Reef off Cairns, Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indonesia, Sabah and Philippines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 12; Analspines: 2; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 70 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 16 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 16m.
From 1 to 16 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral-rich areas of sheltered lagoon and inshore coral reefs (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera parasema

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTCGGTGCCTGAGCTGGGATAGTAGGTACAGCCTTAAGCCTTCTCATCCGAGCAGAACTAAGCCAACCAGGCGCGCTCCTAGGAGACGACCAAATCTATAACGTCATCGTTACCGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTTTGATTGGAGGCTTTGGAAACTGATTAATTCCACTAATGCTGGGAGCTCCCGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTACTGCCCCCATCCTTCCTTCTTCTGCTTGCCTCTTCTGGGGTCGAAGCTGGGGCCGGCACAGGTTGGACTGTTTACCCCCCACTATCCGGCAACCTCGCCCATGCAGGTGCATCCGTAGACTTAACCATCTTCTCGCTTCATCTAGCAGGCATTTCATCAATTTTAGGAGCCATTAATTTTATTACAACCATCATTAACATAAAACCTCCTGCCATCTCACAATACCAAACCCCCTTATTTGTATGAGCAGTCCTAATTACTGCTGTTCTTCTTCTCCTTTCTCTGCCAGTATTGGCCGCTGGAATTACCATACTTCTAACCGACCGAAACCTTAACACCACCTTCTTCGACCCCGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera parasema

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysiptera parasema

Chrysiptera parasema, known commonly as the goldtail demoiselle and yellow-tail blue damselfish, is a species of damselfish native to the western Pacific Ocean.[1]

Description[edit]

This fish reaches 8 centimeters in length. It is bright blue with a yellow tail. Often, it is a little aggressive, but is a valued beginner's fish.

[2]

References[edit]

  1. ^ Froese, R. and D. Pauly, Eds. Chrysiptera parasema. FishBase. 2011.
  2. ^ *Chrysiptera parasema. FishLore.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!