Overview

Comprehensive Description

Biology

Adults inhabit passes and outer reef slopes (Ref. 7247). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Pacific: Southeastern Oceania including Cook and Austral Islands, Rapa, and the Gambier, and Pitcairn groups.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern Oceania.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 15; Analspines: 2; Analsoft rays: 14 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 70 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

7.0 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Chrysiptera galba
Catalog Number: USNM 211293
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1970
Locality: Oeno, Pitcairn Group, North Side of Atoll, Oeno Island, Pitcairn Islands, Pacific
Depth (m): 12 to 18
  • Paratype: Allen, G. R. & Randall, J. E. 1974. Tropical Fish Hobbyist. 22 (9): 40.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 3 - 8.5
  Temperature range (°C): 22.368 - 22.496
  Nitrate (umol/L): 0.121 - 0.139
  Salinity (PPS): 35.516 - 35.552
  Oxygen (ml/l): 5.032 - 5.079
  Phosphate (umol/l): 0.145 - 0.165
  Silicate (umol/l): 1.623 - 2.486

Graphical representation

Depth range (m): 3 - 8.5

Temperature range (°C): 22.368 - 22.496

Nitrate (umol/L): 0.121 - 0.139

Salinity (PPS): 35.516 - 35.552

Oxygen (ml/l): 5.032 - 5.079

Phosphate (umol/l): 0.145 - 0.165

Silicate (umol/l): 1.623 - 2.486
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera galba

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCCTGAGCTGGGATGGTGGGCACAGCCCTGAGCCTTCTTATTCGAGCTGAACTAAGCCAACCCGGCGCGCTCCTAGGAGACGACCAAATTTATAACGTTATCGTTACCGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTCTGATTGGAGGGTTCGGAAACTGATTAGTCCCACTAATGCTTGGAGCCCCTGATATAGCATTCCCTCGAATGAACAATATGAGCTTCTGACTACTCCCCCCATCATTCCTTCTTCTGCTTGCCTCTTCAGGAGTAGAAGCAGGGGCTGGCACAGGCTGAACTGTATATCCCCCCTTGTCTGGTAACCTAGCTCATGCAGGCGCATCAGTTGACCTCACCATCTTCTCCCTCCACCTTGCAGGTGTCTCATCGATCCTTGGGGCTATTAACTTTATTACCACCATTATTAACATGAAACCCCCAGCTATCACACAATATCAAACTCCACTATTTGTTTGAGCAGTTTTAATCACTGCCGTCCTCCTTCTTCTCTCTCTGCCCGTCCTGGCTGCTGGTATCACAATGCTTCTAACGGACCGAAACCTCAACACCACATTCTTTGACCCAGCAGGAGGCGGGGACCCAATCCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera galba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chrysiptera galba

Chrysiptera galba, the canary demoiselle, is a species of damselfish. It is native to the western Pacific Ocean. It reaches 7 centimeters in length. The male guards and tends the eggs.[1]

References[edit]

  1. ^ Froese, R. and D. Pauly, Eds. Chrysiptera galba. FishBase. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!