Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

The yellowfin tuna is a schooling fish, and has a strong tendency to aggregate with fish of the same size, rather that just school with other yellowfin tunas (2). They can often be seen swimming near the surface with other tunas, such as skipjack tuna (Katsuwonus pelamis)and bigeye tuna (Thunnus obesus). Large yellowfin tunas have also been seen with porpoises or dolphins, particularly the spotted, spinner and common dolphins (2) (4). Schools of yellowfin tuna under floating debris are also often observed (4). This powerful swimmer is an opportunistic predator, feeding on a wide variety of fish, squid, cuttlefish, octopus, shrimp, lobster and oceanic crabs (2). Some of the fish consumed include pilchard, anchovy, mackerel, and even other tunas (2). They apparently locate their food simply by sight, as they search for food primarily in the surface waters during daylight (2). Spawning in yellowfin tuna populations can occur at any time of the year, but is most frequent during the summer months in each hemisphere (4). Each female releases several million eggs each year into the ocean (2), which are fertilized by the sperm released by the males. Yellowfin tuna juveniles grow quickly, reaching a weight of 3.4 kilograms in 18 months (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Common names: tuna (English), atún (Espanol)
 
Thunnus albacares (Bonnaterre, 1788)


Yellowfin tuna



Body elongate, fusiform, moderately compressed; no fatty eyelid; teeth slender, conical; top of tongue with 2 cartilaginous ridges; 26-34 gill rakers; 2 dorsal fins barely separated; 1st  dorsal XIII-XIV; second dorsal and anal fins becoming extremely tall in large specimens, well over 20% of fork length; 8-9 finlets after dorsal and anal fins; pectoral fins moderately long, in small fish tip is wide and rounded, in fish to 110 cm fin does not reach past middle of base of 2nd  dorsal fin; short, forked bony process between pelvic fins; two small keels separated by large keel on tail base; well developed scaly corselet on front of body; small scales cover body behind corselet.



Back metallic dark blue, becoming yellow to silver on sides and belly; in fish up to 110 cm belly and rear body with narrow vertical white bars, alternate bars are solid and spotted; dorsal and anal fins, bright yellow; dorsal and anal finlets, bright yellow, with a narrow black border; tail fin yellowish grey.


Size: reaches 220 cm; all- tackle world record 176.4 Kg.

Habitat: oceanic pelagic.

Depth: 0-464 m.

Worldwide in tropical and subtropical seas; southern California to the central Gulf of California to Peru and the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The yellowfin tuna is a fish built for speed and endurance (3). Its streamlined body is metallic dark blue on the back, blending into yellow or silver on the belly. The belly is patterned with numerous broken lines (4), and a vivid golden stripe runs along each side of the body, from the eye to the tail (2). The yellowfin tuna has two dorsal fins, the second one of which can be very long and is situated directly over the long anal fin. The pectoral fins, those found on each side of the body, are also long, often reaching beyond the space between the two dorsal fins (4) (2). The fins can be retracted so that water flows even more smoothly over its body when swimming (3). Tiny fins, (or finlets), run down the top and bottom side of the body, from the second dorsal fin and the anal fin to the tail. These finlets, along with the dorsal and anal fins, are bright yellow, giving this fish its common name (4). The finlets are bordered by a narrow black band (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

An oceanic species occurring above and below the thermoclines. Pelagic in open water , but rarely seen near reefs (Ref. 48637). They school primarily by size, either in monospecific or multi-species groups. Larger fish frequently school with porpoises, also associated with floating debris and other objects. Feed on fishes, crustaceans and squids. It is sensitive to low concentrations of oxygen and therefore is not usually caught below 250 m in the tropics (Ref. 28952, 30329). Peak spawning occurs during the summer, in batches (Ref. 9684, 51846). Eggs and larvae are pelagic (Ref. 6769). Encircling nets are employed to catch schools near the surface (Ref. 9340). Marketed mainly frozen and canned (Ref. 9684), but also fresh (Ref. 9340) and smoked (Ref. 9987). Highly valued for sashimi (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Aldabra, Azores, Azores Exclusive Economic Zone, Chagos, Comores, Djibouti, Eritrea, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Worldwide in tropical and subtropical seas, but absent from the Mediterranean Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 464 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The yellowfin tuna is found worldwide, in tropical and subtropical waters from latitudes of 40°N to 35°S, although it does not occur in the Mediterranean Sea (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in tropical and subtropical seas, but absent from the Mediterranean Sea. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 14; Dorsal soft rays (total): 12 - 16; Analspines: 0; Analsoft rays: 11 - 16; Vertebrae: 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 220.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

239 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 200.0 kg (Ref. 26550); max. reported age: 9 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Schools in near-surface waters as well as below the thermoclime, with temperatures between 18° and 31°C, primarily by size, either in monospecific or multispecies groups. Larger fish frequently school with porpoises, also associated with floating debris and other objects. Feeds on fishes, crustaceans and squids. It is sensitive to low concentrations of oxygen and therefore is often limited to depths of 100 m (Ref. 9340). Peak spawning occurs during the summer, in batches (Ref. 9684). Pole-and-line fishing is still one of the major surface fishing techniques while longlining fishing method is for deep swimming yellowfin tuna. Encirling nets are employed to catch schools near the surface (Ref. 9340). Marketed mainly frozen and canned (Ref. 9684), but also fresh (Ref. 9340) and smoked (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish with very long second dorsal fin and anal fin, which in some may reach well over 20% of the FL. The pectoral fin is moderately long, usually reaching beyond the second dorsal fin origin but not beyond the end of its base. Color is black metallic dark blue changing through yellow to silver on the belly. The belly frequently has about 20 broken, nearly vertical lines. The dorsal and anal fins and finlets are bright yellow.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is an open-water pelagic and oceanic species occurring above and below the thermocline to depths of at least 400 m. This species schools primarily by size, either in monospecific or multi-species groups. Larger fish frequently school with porpoises and are also associated with floating debris and other objects. It feeds on fishes, crustaceans and squids. It is sensitive to low concentrations of oxygen and therefore, is not usually caught below 250 m in the tropics, and is found in waters between the temperatures of 18–31°C.

The primary Atlantic spawning grounds are in the Gulf of Guinea, and to a lesser extent in the Gulf of Mexico. Spawning occurs throughout the year in the core areas of distribution at sea surface temperatures of 24°C or higher, but peaks are observed in the northern and southern summer months respectively. Spawning occurs almost entirely at night between 2200 and 0600 hrs (Kailola et al. 1993, Schaefer 1998).

In the Indian Ocean, longevity is at least seven years (Romanov and Korotkova 1988), although very few individuals live past four years. Estimated maximum age in the Eastern Pacific is 4.8 years (Wild 1986), in the Western Pacific is 6.5 years (Lehodey and Leroy 1999), and in the Atlantic is eight years (IGFA 2001). Smallest mature individuals in the Pacific off the Philippines and Central America are in the 50–60 cm size group at an age of 12–15 months. Length at 50% maturity in the eastern Pacific was 69 cm for males and 92 cm for females corresponding to an age of 2.1 years (Schaefer 1998). Batch fecundity estimates in the eastern Pacific ranged from 162,918 oocytes for a 1,180 mm female to 8,026,026 oocytes for a 1,460 mm female (Collette 2010). Based age-structure data across all stocks (Collette et al. 2011), generation length is estimated to be between 2.2 and 3.5 years.

Maximum Size is 200 cm fork length (FL). The all-tackle game fish record is of a 183.7 kg fish caught in Magdalena Bay, Baja Sur, Mexico (International Angler 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

An oceanic species occurring above and below the thermoclines. They school primarily by size, either in monospecific or multispecies groups. Larger fish frequently school with porpoises, also associated with floating debris and other objects.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 122265 specimens in 1 taxon.
Water temperature and chemistry ranges based on 117880 samples.

Environmental ranges
  Depth range (m): 0 - 4700
  Temperature range (°C): 1.478 - 29.336
  Nitrate (umol/L): 0.060 - 36.790
  Salinity (PPS): 31.060 - 37.257
  Oxygen (ml/l): 2.494 - 7.276
  Phosphate (umol/l): 0.022 - 2.511
  Silicate (umol/l): 0.481 - 152.027

Graphical representation

Depth range (m): 0 - 4700

Temperature range (°C): 1.478 - 29.336

Nitrate (umol/L): 0.060 - 36.790

Salinity (PPS): 31.060 - 37.257

Oxygen (ml/l): 2.494 - 7.276

Phosphate (umol/l): 0.022 - 2.511

Silicate (umol/l): 0.481 - 152.027
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 250m.
From 1 to 250 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column, Flotsam

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The yellowfin tuna inhabits the epipelagic zone of the ocean, at temperatures between 18 and 31 degrees Celsius (4). It generally occurs at depths less than 100 metres (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 1 - 250 m (Ref. 6390), usually 1 - 100 m (Ref. 55289)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Confined to the upper 250 m (Ref. 6390) of the water column in areas with marked oxyclines, since oxygen concentrations less than 2 ml/l encountered below the thermocline and strong thermocline gradients tend to exclude their presence in waters below the discontinuity layer. Feed during the day and at night (diurnal and nocturnal). In Hawaii, adults more common in late spring through early fall; juveniles common in fall and winter (Ref. 4887).Yellowfin tuna smaller than 15 kg often form surface schools of similar sized fish (Ref. 6390). Schools may be mono-specific (ie, consist of only 1 species) or include other tunas, such as skipjack tuna Katsuwonus pelamis) (Ref. 6390). Dolphins often associate with surface feeding schools in the eastern Pacific Ocean, but a similar association is not found in the western Pacific (Ref. 6390).Off southeastern Australia, adult yellowfin tuna tend to be more solitary (Ref. 6390). Fish larger than 15 kg inhabit the deeper waters above the thermocline and tend not to school in Australian waters (Ref. 6390).A behavioural study in Hawaiian waters using ultrasonic tags (Ref. 30307) showed that during the day yellowin tuna inhabited waters just above the thermocline (50-90 m), with occasional short descents to depths as great as 250 m (Ref. 6390). At night, the tuna tended to stay within 50 m of the surface (Ref. 6390).Large concentrations of larvae and eggs are reported from the western Pacific, including the Coral Sea, and from the Indian Ocean adjacebt to Australia's North West Shelf (Ref. 30274).Tagged yellowfin tuna have been reported to move 1000 km or more over a 12-month period, but no directed migration has been demonstrated (Ref. 6390). Recoveries from a tagging study of yellowfin tuna on the Australian east coast between 27°S and 38°S suggested that most yellowfin tuna form local groups that moved no more than a few hundred miles over several years (Ref. 6390). This northward and southward movement of yellowfin tuna along the south-eastern Australian coast is probably associated with the seasonal movement of the warm East Australian Current (Ref. 30310). Also Ref. 10406.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Zeuxapta Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yamaguticystis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wedlia Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wedlia Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uroproctinella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uroproctinella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Univietellodidymocytis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Univietellodidymocytis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Umatrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Udonella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tentacularia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tentacularia Disease of Coryphaena. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sphyriocephalus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sibitrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhynchus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhynchus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhynchus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocycnus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Platocystis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Phyllodistomum Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Philometroides Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pennella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pennella Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelichnibothrium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Orbitonematobothrium Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oncophora Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oncophora Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nybelinia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neorhadinorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neophrodidymotrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nasicola Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Monhysterides Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metanisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma thynni Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma sibi Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hepatoxylon Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gymnorhynchus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grillotia sp. Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Echeneibothrium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymosulcus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymosulcus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 9. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 27. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 22. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 20. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 19. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 13. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dermatodidymocystis vivipira Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dermatodidymocystis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Decemtestis infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dasyrhynchus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coeliotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cardicola Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsala Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsala Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsala Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Callitetrarhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 20. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 19. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 18. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 9. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brachiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bolbosoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bolbosoma Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Areotestis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease (juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Angionematoborium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Allopseudaxine Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn throughout the tropical and equatorial waters of the major oceans (Ref. 6390). At higher latitudes, spawning is seasonal, with peaks in summer; may continue throughout the year at lower latitudes (Ref. 6390).Yellowfin tuna are multiple spawners, ie they spawn every few days over the spawning period (Ref. 6390). Eggs and sperm are released into the water for fertilisation (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 37 specimens with morphological vouchers housed at British Antarctic Survey
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thunnus albacares

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGCA177-10|NC_014061|Thunnus albacares| ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTTTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGAC---GACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATG---ATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTGGCCCACGCAGGGGCATCAGTTGACCTA---ACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCT---GGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATGATCTCCCACATTGTTGCCTACTACTCAGGTAAAAAA---GAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATCGTATGAGCCCATCACATGTTCACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus albacares

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Species: 76
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Masuti, E., Nelson, R., Oxenford, H., Restrepo, V., Salas, E., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is fast-growing, widely distributed and highly productive. It is important in commercial fisheries around the world. It is being effectively managed throughout the majority of its range. All stocks are being fished below current maximum sustainable yield (MSY). However, more definitive data are needed for the Indian Ocean stock, as some model runs project that 2009 fishing mortality may have been above FMSY. Based on weighted declines of biomass or spawning stock biomass (SSB) across all stocks, there has been an estimated 33% decline globally over the past 10 years (1998–2008), or three generation lengths. This species is listed as Near Threatened, primarily as population declines would be much greater if it were not for the catch quotas that have been implemented. Although model projections are variable, concerns however remain about possible overfishing in recent years in the Indian Ocean. This species should be reassessed in the next five years, primarily because catches in the Indian Ocean region have declined substantially in 2009 (and possibly also in 2010) partly due to Somali-based piracy, which has shifted fishing effort to the Atlantic Ocean.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Least Concern (LR/lc) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
FAO reported worldwide landings show a gradual, but variable increase from 110,879 tonnes in 1950, to 1,130,605 tonnes in 2006 (FAO 2009). Landings data have exponentially increased over the last 50 years (400%). There are four stocks that are globally managed for this species. As of 2004, the stocks in the Atlantic, Indian Ocean, and Eastern Pacific are considered Fully Exploited, and the Western and Central Pacific stock is considered Fully to Over-exploited (Majkowski 2007).

Atlantic Ocean
Yearly catch levels have declined in the Atlantic Ocean since the peak catch of 194,000 tonnes in 1990. A steady decline occurred between 2001–2007, followed by an increase in 2008. These trends in part reflect changes in the number of purse seiners operating in the Atlantic Ocean (ISSF 2010). Recent trends have differed between the western and eastern Atlantic, with the overall catches in the west declining by 26% since 2006. In the eastern Atlantic, on the other hand, catches have increased by 23% since 2006, mainly due to substantial increases in purse seine effort (SCRS ICCAT 2010).

The most recent stock assessment for Yellowfin Tuna in the Atlantic was conducted in 2008 (ICCAT 2009), which showed that biomass is currently somewhat less than BMSY, but fishing mortality is also less than FMSY (ISSF 2010, ICCAT 2009). Based on linear regression of the middle values of Model 5 and Model 10 in the latest stock assessment (ICCAT 2009), spawning stock biomass (SSB) has declined approximately 22% over the past 10 years (1998–2007). These models suggest that only catches of 130,000 tonnes or less are sustainable.

Eastern Pacific Ocean
From 1976–2005 the total catch fluctuated from 100,000 to 443,000 t per year (IATTC 2008). The average annual retained catch of Yellowfin Tuna in the Eastern Pacific during 1991–2005 was 276,000 t, with a peak in 2002 of 443,000 t, the greatest on record. However catch decreased substantially in 2005 to 288,019 t, and in 2006 to 174,780 t (the lowest since 1984). Current maximum sustainable yield (MSY) is estimated to be about 273,000 t (IATTC 2009, ISSF 2010). Additionally, the average weights of the Yellowfin Tuna caught in 2006 were significantly lower than those of the previous five years (STECF 2007).

The most likely causes of the lesser catches are declines in recruitment, effort in the dolphin-associated fisheries, and catchability (IATTC 2008). The recruitment of Yellowfin Tuna to the fisheries in the Eastern Pacific varies seasonally and in response to regime shifts in productivity. The most recent stock assessment analysis and previous analyses have indicated that the Yellowfin Tuna population has experienced two, or possibly three, different recruitment productivity regimes (1975–1982, 1983–2002, and 2003–2008). The productivity regimes correspond to regimes in biomass, e.g., higher-productivity regimes producing greater biomass levels. Average annual catch of Yellowfin Tuna in the eastern Pacific Ocean was 233,000 t (100,000 to 301,000) during the period from 1975–2001. Variations in part reflect changes in fishing effort and regime shifts in productivity over up to three levels of recruitment. Changes in measures of fishing effort include changes in the proportion of purse seine catch by set type, as well as changes in the overall level of fishing effort, which occur in part in compliance with management action (M.Hinton pers comm 2011).

According to the most recent stock assessment in the Eastern Pacific conducted in 2009 (Maunder and Aires-da-Silva 2010), if the fishing mortality is proportional to the fishing effort and the current patterns of age-specific selectivity are maintained, the current (average of 2006–2008) level of fishing is below FMSY. The spawning stock biomass is also estimated to be above SSBMSY. Based on linear regression of the spawning stock biomass ratio (SBR) reported in the most recent stock assessment (Maunder and Aires-da-Silva 2010), there has been an estimated 49% decline in SBR over the past 10 years (1998–2007).

Indian Ocean
The catches of Yellowfin Tuna show a strong seasonality with high catches during the northern winter months and usually low catches from May–June to September–October. The Yellowfin Tuna stock assessment work in the Indian Ocean is an extremely difficult task because of the conflicting trends in the basic data, total yearly catches and abundance indices used based on the longline catch per unit effort (CPUE): the observed trends in Yellowfin Tuna catches and CPUEs are not consistent with production-model dynamics, or really with any known theory of fishing (IOTC 2009).

However, a stock assessment conducted in 2008 (Nishida 2008) indicated that recent levels of fishing mortality are at an historical high level and the stock has experienced a period of overfishing at least during 2003–2006 (e.g., Fcurrent > FMSY). Biomass based reference points also varied with the assumed level of steepness. For the lowest value of steepness (0.60), spawning biomass in 2007 was estimated to be below the MSY level (SB/SBMSY <1); i.e., the stock is in an overfished state. For higher values of steepness, biomass in 2007 was above the MSY level (SBcurrent > SBMSY) and the stock is not in an overfished state. The model estimated that recent recruitment has been lower than average, and on this basis total and spawning biomass could be expected to decline further over the next few years (IOTC 2008, IOTC 2009).

A size-based, age- and spatially-structured population model (Multifan-CL, MFCL) for the Yellowfin Tuna in the Indian Ocean initially carried out in 2008 was updated in 2009. Based on linear regression of estimated adult biomass (IOTC 2009), estimated SSB has declined approximately 45% over the past 10 years (1999–2008). Depending on the shape of the stock-recruitment relationship, current catches are likely to be higher than the estimated MSY, which ranges from 250,000 to 300,000 t. For example, total annual catches averaged 434,800 t over the period 2003 to 2007 (IOTC 2008), and 372,200 t over the period 2005 to 2009 (IOTC 2010). However, more recently catches in the Indian Ocean have declined substantially (in 2009 and possibly also in 2010) partly due to Somali-based piracy in the region.

Western and Central Pacific Ocean
Since 2000, the total Yellowfin Tuna catch in the Western and Central Pacific Ocean (WCPO) has varied between 370,000 and 440,000 mt. Purse seiners harvest the majority of the Yellowfin Tuna catch (53% by weight in 2007), with the longline and pole-and-line fisheries comprising 16% and 4% of the total catch, respectively (Langley et al. 2009). Longline catches in recent years (70,000–80,000 mt) are well below catches in the late 1970s to early 1980s (which peaked at about 110,000 mt), presumably related to changes in targeting practices by some of the larger fleets (Langley et al. 2009).

Estimated current biomass exceeds the biomass MSY, and current fishing mortality is below FMSY, indicating that the Yellowfin Tuna stock in the Western and Central Pacific Ocean is not in an overfished state. Depletion has increased steadily over time, reaching a level of about 60% of unexploited biomass (a fishery impact of 40%) in 2004–2007 (Langley et al. 2009). However, depletion is considerably higher in the equatorial region 3 (e.g., Philippines/Indonesia) where recent depletion levels are approximately 0.35 and 0.30 for total and adult biomass, respectively (65% and 70% reductions from the unexploited level). The stock in this region may be fully-exploited (ISSF 2010).

Overall SSB is estimated to have declined about 21% over a 10 year period (1999–2008), based on linear regression of SSB in the most recent 2009 stock assessment in the Western and Central Pacific (Langley et al. 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is primarily caught by the purse-seine fishery, but is also taken by longlines and pole-and-line fishing.

In terms of yield, Yellowfin Tuna is the most important tuna species in the Eastern Pacific, where an important proportion of the Yellowfin Tuna catch is harvested in association with dolphins, in free schools and increasingly under fish aggregating devices (FADs). In the Western and Central Pacific purse seiners harvest about 50%, while longline and pole-and-line fleets comprise 15% and 3% respectively.

In the Indian Ocean, over 40% of purse seine Yellowfin Tuna catches are taken in log-schools along with Skipjack Tuna and Bigeye Tuna. One of the driving forces behind recent changes in the purse seine fishery has been the impact of piracy in the western Indian Ocean, which has led to a decrease of the nominal effort (number of boats, total carrying capacity, number of fishing and searching days, total number of sets) as well as changes in the fishing behaviour due to the new security measures in place (boats working in pairs with military personnel on board, restriction on fishing areas, etc.) (IOTC 2010).

Fisheries exist for this species in the eastern Atlantic between Portugal and South Africa, and in the western Atlantic between the Gulf of Mexico and southern Brazil; longline fisheries occur throughout the entire tropical and temperate Atlantic. The main gears used to catch Yellowfin Tuna in the Atlantic are: purse seines (58%), longline (22%), and pole-and-line (13%) (ISSF 2010). The purse seine fishery is the major contributor to total catches of this species. Landings from baitboats and purse seiners generally declined between 2001–2007 (STECF 2009). The nominal effort in the purse seine fishery had been declining through 2006. As an indicator, the number of purse seiners from the European and associated fleet operating in the Atlantic had declined from 44 vessels in 2001 to 24 vessels in 2006 (last year’s data included during the assessment), with an average vessel age of about 25 years. Since then, however, the number of purse seiners has increased by 50% to 36, as vessels have moved from the Indian Ocean to the Atlantic. At the same time, the efficiencies of these fleets have been increasing, particularly as the vessels which had been operating in the Indian Ocean tend to be newer and with greater fishing power (ICCAT 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The yellowfin tuna is a popular and important target for commercial fisheries (2) (4). Around 35 countries have fisheries for this tuna species, with Japan and the USA bringing in the largest catches (4). While the IUCN classifies the yellowfin tuna as not currently threatened (1), a reduction in catches per unit effort in certain areas suggests that some yellowfin stocks may be decreasing (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lower Risk: least concern (LR/lc)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed as a highly migratory species in Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department 1994).

Conservation measures imposed in 2004 for the Eastern Pacific under resolution C-04-09 (IATTC 2008) are predicted to maintain the stock at about the Average Maximum Sustainable Yield level, slightly higher than would otherwise be the case. Three month closures have been proposed by the Inter-American Tropical Tuna Commission (IATTC) and Mexico, which has one of the largest fisheries for this species.

In the Western Pacific, there was a two month closure of the FAD fishery in 2009, and three months in 2010 with an objective of achieving a 30% reduction of fishing effort.

In the Indian Ocean, the Indian Ocean Tuna Commission's (IOTC) Working Party on Tropical Tunas (WPTT) recommends that catches of Yellowfin Tuna in the Indian Ocean should not increase beyond 300,000 t in order to bring the stock to biomass levels that could sustain catches at the MSY level in the long term. If recruitment continues to be lower than average, catches below MSY would be needed to maintain stock levels (IOTC 2010).

In the Atlantic, the International Commission for the Conservation of Atlantic Tunas Standing Committee on Research and Statistics (ICCAT-SCRS) recommended that increased harvest of Yellowfin Tuna could have negative consequences for Bigeye Tuna in particular, and other species caught together with Yellowfin Tuna in fishing operations taking more than one species. The same group also continues to recommend that effective measures be found to reduce fishing mortality of small Yellowfin Tuna to increase long-term sustainable yield. ICCAT-SCRS noted that catch levels in recent years have been held in check, despite increasing efficiencies of individual vessels, by a continued decline in the number of purse seine vessels in the eastern Atlantic. The Scientific, Technical and Economic Committee for Fisheries (STECF) agrees that a continuation of the recent movement of additional newer vessels from the Indian Ocean into the Atlantic, with a corresponding increase in fishing mortality should be monitored closely to avoid adverse impacts on stock status (STECF 2009).

ICCAT recommendation 04-01 implemented a small closure for the surface fishing in the area 0–5ºN, 10–20ºE during November in the Gulf of Guinea for purse-seine and pole-and-line vessels. Although this regulation is intended to reduce small Bigeye Tuna catches, the Committee recognizes that its implementation and the change from the previous moratorium to the current regulation will potentially impact Yellowfin Tuna catches. Given the relatively small time-area coverage of the closure, any reduction in juvenile mortality is expected to be minimal (ICCAT 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Like the other tuna species, yellowfin tuna fisheries are managed by international bodies: the International Commission for the Conservation of Atlantic Tunas (ICCAT) in the Atlantic (5), the Inter-American Tropical Tuna Commission (IATTC) in the eastern Pacific (6), and the Indian Ocean Tuna Commission (IOTC) in the Indian Ocean (7). The management measures in place have, for the large part, successfully maintained populations of the yellowfin tuna (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellowfin tuna

The yellowfin tuna (Thunnus albacares) is a species of tuna found in pelagic waters of tropical and subtropical oceans worldwide.

Yellowfin is often marketed as ahi, from its Hawaiian name ʻahi although the name ʻahi in Hawaiian also refers to the closely related bigeye tuna.[2] The species name, albacares ("white meat") can lead to confusion. The tuna known as albacore in English, is a different species of tuna: Thunnus alalunga. However, yellowfin tuna is officially designated albacore in French, and is referred to as albacora by Portuguese fishermen.

Contents

Description

The yellowfin tuna is one of the largest tuna species, reaching weights of over 300 pounds (140 kg), but is significantly smaller than the Atlantic and Pacific bluefin tunas that can reach over 1,000 pounds (450 kg) and slightly smaller than the bigeye tuna and the southern bluefin tuna. Reported sizes in the literature have ranged as high as 239 centimeters (94 in) in length and 200 kilograms (440 lb) in weight. The International Game Fish Association (IGFA) record for this species stands at 388 pounds (176 kg). Angler Kurt Wiesenhutter boated this fish in 1977 near San Benedicto Island in the Pacific waters of Mexico. Two larger fish weighing 395 lb and 399.6 lb were boated in 1992 and 1993 respectively. These remarkable fish stand as the largest rod and reel yellowfin tuna captures thus far. On November 30, 2010, Mike Livingston of Sunland, California[disambiguation needed ] reeled in a 405.2 lb Yellowfin off the tip of the Baja peninsula aboard the vessel the Vagabond. Livingston's 86-inch (2,200 mm) catch, which had a girth of 61 inches (1,500 mm), is still pending verification by the International Game Fish Association to replace Wiesenhutter's 388 pounder as the new all-tackle World Record holder.

The second dorsal fin and the anal fin, as well as the finlets between those fins and the tail, are bright yellow, giving this fish its common name. The second dorsal and anal fins can be very long in mature specimens, reaching almost as far back as the tail and giving the appearance of sickles or scimitars. The pectoral fins are also longer than the related bluefin tuna, but not as long as those of the albacore. The main body is very dark metallic blue, changing to silver on the belly, which has about 20 vertical lines.

Habitat

Yellowfin tuna are epipelagic fish that inhabit the mixed surface layer of the ocean above the thermocline. Sonic tracking has found that although yellowfin tuna, unlike the related bigeye tuna, mostly range in the top 100 meters (330 ft) of the water column and penetrate the thermocline relatively infrequently, they are capable of diving to considerable depths. An individual tagged in the Indian Ocean with an archival tag spent 85% of its time in depths shallower than 75 meters (246 ft) but was recorded as having made three dives to 578 m, 982 m and 1,160 meters (3,810 ft).

Life history

Deeper diving and cruising seems to happen more often in the daytime, changing to shallower swimming at night, probably in response to the vertical movement of prey items in the deep scattering layer. They are normally a schooling fish and stay in their immediate school.

Photo of a few dozen fish swimming in dark water
School of yellowfin tuna

Although mainly found in deep offshore waters, yellowfin tuna may approach shore when suitable conditions exist. Mid-ocean islands such as the Hawaiian archipelago, other island groups in the Western Pacific, Caribbean and Maldives islands Indian Ocean, as well as the volcanic islands of the Atlantic such as Ascension Island often harbor yellowfin feeding on the baitfish these spots concentrate close to the shoreline. Yellowfin may venture well inshore of the continental shelf when water temperature and clarity are suitable and food is abundant.

Yellowfin tuna often travel in schools with similarly sized companions. They sometimes school with other tuna species and mixed schools of small yellowfin and skipjack tuna, in particular, are commonplace. They are often associated with various species of dolphins or porpoises, as well as with larger marine creatures such as whales and whale sharks. They also associate with drifting flotsam such as logs and pallets, and sonic tagging indicates that some follow moving vessels. Hawaiian yellowfin associate with anchored fish aggregation devices (FADs) and with certain sections of the 50-fathom curve.

Diet and predation

Yellowfin tuna prey include other fish, pelagic crustaceans, and squid. Like all tunas their body shape is evolved for speed, enabling them to pursue and capture fast-moving baitfish such as flying fish, saury and mackerel. Schooling species such as myctophids or lanternfish and similar pelagic driftfish, anchovies and sardines are frequently taken. Large yellowfin prey on smaller members of the tuna family such as frigate mackerel and skipjack tuna.

In turn, yellowfin are preyed upon when young by other pelagic hunters, including larger tuna, seabirds and predatory fishes such as wahoo, shark and billfish. As they increase in size and speed, yellowfin become able to escape most of their predators. Adults are threatened only by the largest and fastest hunters, such as toothed whales, particularly the false killer whale, pelagic sharks such as the mako and great white, and large blue marlin[disambiguation needed ] and black marlin. The main source of mortality, however, is industrial tuna fisheries.

The commercial fishery

Yellowfin tuna loaded onto a truck for transportaton. Palabuhanratu, West Java

Modern commercial fisheries catch yellowfin tuna with encircling nets (purse seines), and by industrial longlines.

Pole and line

Formerly, much of the commercial catch was made by pole and line fishing, using live bait such as anchovy to attract schools of tuna close to the fishing vessel that were then taken with baited jigs on sturdy bamboo or fiberglass poles or on handlines. This fishery, which targeted skipjack and occasionally albacore, as well as yellowfin, for canning, reached its heyday between World War I and the 1950s before declining. The most well-known fleet of pole and line boats sailed from San Diego in California and exploited abundant stocks in Mexican waters, as well as further south to Panama, Costa Rica and the Galapagos Islands.[3] Interviews with fishery participants as well as video footage preserve the memory of this fishery and the boats and men that pursued it.[4]

Pole and line fishing is still carried out today in areas such as the Maldives, Ghana, and by a small number of boats fishing out of the Canary Islands, Madeira and the Azores. Few pole and line boats now specifically target yellowfin and the contribution that these fisheries make to the total commercial catch is incidental to the total take. In the Maldives, for instance, the catch is a mix of skipjack tuna and small yellowfin that often associate with them.

Purse seining

Purse seining largely took over commercial tuna fisheries in the 1960s and 1970s. Today, purse seines account for more of the commercial catch than any other method. The purse seine fishery primarily operates in the Pacific Ocean, in the historic tuna grounds of the San Diego tuna fleet in the eastern Pacific, and in the islands of the western Pacific, where many US tuna canneries relocated in the 1980s; but significant purse-seine catches are also made in the Indian Ocean and in the tropical Atlantic Ocean, especially in the Gulf of Guinea by French and Spanish vessels.

Purse seine vessels locate tuna via onboard lookouts, as was done in the pole and line fishery, but they also employ sophisticated onboard electronics, sea-surface temperature and other satellite data, and from helicopters overhead. Once a school is located, the net is set around it. A single set may yield 100 tonnes (98 long tons; 110 short tons). Modern tuna seiners have a capacity of up to 2,000 metric tons (2,000 long tons; 2,200 short tons) reach speeds of over 17 knots (31 km/h; 20 mph) and carry multiple spotting helicopters.[5]

Purse seining for yellowfin tuna became highly controversial in the late 1970s when it became apparent that the eastern Pacific fishery was killing many spinner dolphin, pantropical spotted dolphin and other cetaceans (often referred to as 'porpoise' by the tuna fleet) that accompany the fish. This association has been long-recognized by commercial tuna fishermen.

Since the introduction of "dolphin-friendly" labeling, an increasing number of purse seine sets are now made on "free schools" unassociated with dolphins, as well as schools that associate with floating objects—another long-understood association that has grown in importance in tuna fisheries. The latter practice in particular has a major ecological impact because of the high proportion of bycatch, including manta rays, sea turtles, pelagic sharks, billfish and other threatened marine species taken by setting nets around logs and other floating objects. Such tuna are often significantly smaller than the larger adult tuna associated with dolphins. The removal of huge numbers of juvenile yellowfin and bigeye tuna that have yet to reach breeding age has major potential consequences for tuna stocks worldwide.

Longline

Most of the commercial catch is canned, but the sashimi marketplace adds significant demand for high-quality fish. This market is primarily supplied by industrial tuna longline vessels.

Industrial longlining was primarily perfected by Japanese fishermen who expanded into new grounds in the Western Pacific, Indian and Atlantic oceans in the late 1950s and early 1960s. Longlining has since been adopted by other fishermen, most notably South Korea, Taiwan, and the United States.

Tuna longlining targets larger sashimi-grade fish of around 25 kilograms (55 lb) and up that swim deeper in the water column. In tropical and warm temperate areas, the more valuable bigeye is often the main target, but significant effort is also directed towards larger yellowfin. Longlining seeks areas of higher ocean productivity indicated by temperature and chlorophyll fronts formed by upwellings, ocean current eddies and major bathymetric features. Satellite imaging technology is the primary tool for locating these dynamic and constantly changing ocean areas.

Sea turtle and seabird bycatch is a major environmental issue in the longline fishery, as is the mortality that longline fishing inflicts on species that are incidentally captured, such as billfishes, sea turtles and pelagic sharks.

Artisanal fisheries

Besides the large-scale industrial purse seine and longline fisheries, yellowfin tuna also support smaller-scale artisanal fisheries that have often supplied local domestic markets for generations. Artisanal fisheries now also often fish for the lucrative sashimi market in many locations where international air shipment is possible.

Artisanal fishermen tend to employ assorted hook and line gear such as trolling lines, surface and deep handlines and longlines.

By far the largest fishery using artisanal methods exists in Philippine and Indonesian waters where thousands of fishermen target yellowfin tuna around fish aggregation devices or payaos, although this fishery far exceeds the artisanal scale in terms of tonnage caught and the numbers of partipants involved and should more properly be considered a commercial handline fishery. General Santos City is the most important Philippine port for the landing and transhipment of catches. Catches that qualify as sashimi-grade are mostly shipped to the Japanese sashimi market; those that do not meet the grade are sold locally or canned. Elsewhere in the Pacific, small boat fishers in Hawaii, Tahiti and other Pacific islands supply local and in some cases foreign markets with fresh yellowfin.

Handline-caught yellowfin tuna is one of the few exports of the economy of St Helena.

Sport fishing

Yellowfin tuna are a popular sport fish in many parts of their range and are prized for their speed and strength when fought on rod and reel. Many anglers believe that large yellowfin are, pound for pound, the fastest and strongest of all big game tunas: renowned American author S. Kip Farrington, who fished the classic giant bluefin tuna fisheries of Bimini and Cat Cay in the Bahamas as well as Wedgeport in Nova Scotia, Canada, in their heyday, rated the yellowfin tuna of Hawaii as equal to a bluefin 'twice his weight'. Sport fishermen also prize the yellowfin tuna for its culinary qualities.

Photo of 6 men, four of whom are holding up tuna
A sport fisherman displays his 50 lb. yellowfin tuna.

Yellowfin tuna probably first came to the attention of sports fishermen when they appeared on the tuna grounds of Catalina Island, California, only a few years after pioneering fishermen invented the sport, targeting the Pacific bluefin tuna. These tuna were of the same species caught by commercial fishermen in Japan and the western Pacific, but the reason for their appearance was not known at the time. Later it was discovered that warmer water species such as yellowfin tuna, dorado and striped marlin enter southern California waters in seasons having favorable ocean conditions, particularly during the El Niño phenomenon, which brings warmer water up North America's western coast.

Yellowfin tuna were subsequently discovered by sport fishermen in Bermuda, the Bahamas, Hawaii and many other parts of their range. Larger adult fish which had developed distinctively long sickle fins were initially thought to be a different species and were known as Allison tuna (a name first given by the then curator of the Bermuda Aquarium, Louis Mowbray, in 1920). Such destinations as Hawaii and Bermuda became famed for their catches of these beautiful fish. In Hawaii, various styles of feather lures served as bait, but in Bermuda, chumming techniques from boats anchored on productive banks were evolved to target not only Allison tuna but also wahoo and the smaller blackfin tuna. Bermudian experts developed techniques to take all these fish on light tackle and for many years the International Game Fish Association records for yellowfin tuna were dominated by entries from Bermuda in the lighter line classes, with fish in the 200 pounds (91 kg) and larger class from Hawaii taking most of the heavier line class records.

Today, yellowfin tuna are a major sport fish pursued by sports fishermen in many parts of the world. Thousands of anglers fish for yellowfin tuna along the eastern seaboard of the United States, particularly in North Carolina and New England. Yellowfin are also a popular gamefish amongst anglers fishing from US Gulf Coast ports and also from San Diego and other ports of southern California. Larger "long range" boats in the San Diego fleet also fish in Mexican waters, searching for yellowfin tuna in many of the grounds that the San Diego pole and line tuna clippers used to fish. The yellowfin tuna is also a highly prized catch in the offshore sport fisheries of South Africa, Australia and New Zealand. Sport fishing for yellowfin tuna exists on a smaller scale in many other parts of the world.

Cuisine

Photo of plate carrying 6-7 slices of seared tuna arranged vertically around a pile of other food next to a dollop of sauce arranged  on a plate
Pan-seared tuna, served rare

According to the Hawaii Seafood Buyers Guide, yellowfin tuna is widely used in raw fish dishes, especially sashimi. This fish is also excellent for grilling.[6] Yellowfin is often served seared rare.

Yellowfin buyers recognize two grades, "sashimi grade" and "other", although there are variations in the quality of "other" grades.[7]

Yellowfin is becoming a popular replacement for the severely depleted supplies of southern bluefin tuna.

In 2010, Greenpeace International added the yellowfin tuna to its seafood red list. "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[8]

References

  1. ^ Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Masuti, E., Nelson, R., Oxenford, H., Restrepo, V., Salas, E., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E. (2011). "Thunnus albacares". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21857. Retrieved 13 January 2012. 
  2. ^ [1][dead link]
  3. ^ "The High Seas Tuna Fishery of California1". Content.cdlib.org. http://content.cdlib.org/view?docId=kt467n99z2&doc.view=frames&chunk.id=d0e273&toc.depth=1&toc.id=&brand=calisphere. Retrieved 2012-03-22. 
  4. ^ "Pole Fishing for Tuna, 1937-1941 | San Diego History Center". Sandiegohistory.org. https://www.sandiegohistory.org/journal/91summer/tuna.htm. Retrieved 2012-03-22. 
  5. ^ "2200T Super Tuna Purse Seiners". Cfsb.com.tw. http://www.cfsb.com.tw/h025e.html. Retrieved 2012-03-22. 
  6. ^ [2][dead link]
  7. ^ "Buy Project 2010 Professional || DISCOUNT COUPONS FOR YOU". Spc.int. 2011-12-02. http://www.spc.int/Coastfish/Asides/papers/Audubon.htm. Retrieved 2012-03-22. 
  8. ^ Greenpeace International Seafood Red list
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!