Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

The albacore tuna forms schools, which can be up to an astonishing 30 kilometres wide (3). These enormous schools are sometimes associated with floating objects, such as sargassum weeds, and they may also form mixed schools with other tuna species, such as skipjack, yellowfin and bluefin tuna (2). In these schools, the albacore tuna undertakes great migrations in search of the best feeding and spawning grounds, strongly influenced by large oceanic phenomena such as El Niño (5) (6). Albacore tuna are able to reach impressive speeds, of up to 80 kilometres per hour, due to their highly evolved circulatory system that reduces the loss of heat generated by increased muscular activity. This allows them to maintain their body temperature at a higher level than the surrounding water, keeping their muscles warm and working efficiently (3). Unlike many fish, albacore tuna are not able to pump water over their gills to obtain oxygen from the surrounding water, and therefore need to swim constantly with their mouth open, to force water over their gills. A high volume and pressure of blood, and great haemoglobin concentration, all increases the ability of the fish to absorb the essential oxygen (3). Albacore tuna are believed to be pelagic spawners, meaning that the female releases her eggs, and the male his sperm, into open water, often near the water's surface (3). A female albacore tuna is capable of producing two to three million eggs per spawning season, which are released in at least two batches (2); however, the majority of these eggs will not survive to be adults (3). The tiny eggs are just one millimetre in diameter and are enclosed in an oil droplet to enable them to remain buoyant in the ocean. The eggs are fertilized by the male, and the resulting fertilized eggs develop rapidly, with hatching occurring in less than 48 hours (3). The large albacore tuna is one of the top carnivores within the ocean regions it inhabits, and it preys voraciously upon smaller schooling fish such as sardines and anchovy, and squid, consuming around 25 percent of its weight every day. The albacore tuna itself becomes prey for larger species of tuna, billfish and sharks (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Biology

An epipelagic and mesopelagic, oceanic species, abundant in surface waters of 15.6° to 19.4°C; deeper swimming, large albacore are found in waters of 13.5° to 25.2°C; temperatures as low as 9.5°C may be tolerated for short periods (Ref. 168). Known to concentrate along thermal discontinuities (Ref. 168). Form mixed schools with skipjack tuna (Katsuwonus pelamis), yellowfin tuna (Thunnus albacares) and bluefin tuna (T. maccoyii), schools may be associated with floating objects, including sargassum weeds (Ref. 168). Feed on fishes, crustaceans and squids. Eggs and larvae are pelagic (Ref. 6769). Sexual maturity reached at 90 cm (Ref. 36731). Highly appreciated and marketed fresh, smoked, deep frozen or canned. Eaten steamed, broiled, fried and microwaved (Ref. 9987). Also Ref. 1762, 1798, 1804. The American Albacore Fishing Association Pacific (North and South Pacific) fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_1366.htm). Angling: Largely caught offshore, where the waters are mild and blue. Albacore favor those areas where cooler water interfaces with warmer water. They are caught with live of dead baitfish such as mullet, sauries, squid, herring, anchovies, sardines, and other small fish. Albacore strike hard and make powerful runs (Ref. 84357).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This large, oceanic fish is built for speed, with a torpedo-shaped body, smooth skin and streamlined fins (3). The albacore tuna is characterized by a dark yellow first dorsal fin and a pale yellow second dorsal fin (4). The pectoral fins, found on each side of the body, are exceptionally long, and the crescent-shaped, deeply-forked tail fin helps generate the power required to maintain the albacore tuna's impressive speeds. The albacore tuna is metallic dark blue on the back, with silvery-white sides and belly (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: tuna (English), albacora (Espanol), atún (Espanol)
 
Thunnus alalunga (Bonaterre, 1788)


Albacore tuna


Body elongate, fusiform, moderately compressed; deep body, with greatest depth at origin of 2nd  dorsal fin; no fatty eyelid; teeth slender, conical; top of tongue with 2 cartilaginous ridges; 25-31 gill rakers; 2 dorsal fins barely separated; 1st  dorsal XII-XVI; 8-9 finlets after dorsal and anal fins; pectoral very long (reaches well past 2nd  dorsal base) and with straight point; short, forked bony process between pelvic fins; two small keels separated by large keel on tail base; well developed scaly corselet on front of body; small scales cover body behind corselet

Faint iridescent blue stripe along flank; first dorsal deep yellow; second dorsal and anal light yellow; anal finlets dark grey; tail grey, with white rear border.


Size: 152 cm.

Habitat: oceanic.

Depth: 0-600 m.

Circumglobal, temperate; California to the tip of Baja California and the Revillagigedos, the Galapagos and to southern Peru.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Aldabra, Azores, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Chagos, Coastal Waters of Southeast Alaska and British Columbia, Comores, Eritrea, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Albacore reside in the subtropical regions of the North Pacific Ocean, Indian Ocean, North Atlantic Ocean, and Mediterranean Sea. In the North Pacific, albacore are distributed throughout a region from 10 to 50 degrees north latitude, with migration towards the tropical waters during spring and summer spawning months. Albacore occupy similar latitudes in the Atlantic Ocean, but young albacore have been caught by fishermen between 40 to 50 degrees north latitude. In the Indian Ocean, albacore are distributed throughout a region from 50 degrees north latitude to 40 degrees south latitude. In the north, immature albacore occupy 25 to 35 degrees north latitude, mature albacore occupy the north equatorial current region, and spawning albacore occupy the area near 20 degrees north latitude. To the south, mature albacore occupy an area north of 10 degrees south latitude, immature albacore occupy the area south of 30 degrees south latitude, and spawning albacore occupy the area in between (10 to 30 degrees south latitude). Note that for these migratory tuna, April to September are the non-spawning months and October to March are the spawning months in the Indian Ocean, while in the Atlantic, April to September are the spawning months.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

cosmopolitan in tropical and temperate waters of all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in tropical and temperate waters of all oceans, including the Mediterranean Sea, from 50°N to 40°S. The Atlantic and Pacific Oceans both hold at least two albacore tuna stocks (northern and southern), each with distinct spawning areas and rarely crossing the warm equatorial waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 600 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan in tropical and temperate waters of all oceans including the Mediterranean Sea but not at the surface between 10°N and 10°S. Western Pacific: range extend in a broad band between 40°N and 40°S (Ref. 9684). Often confused with juvenile Thunnus obesus which also have very long pectorals but with rounded tips. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Albacore typically reach sexual maturity at a length of 90 cm. The maximum recorded size is 140 cm and 60.3 kg. Weight varies considerably within the species, with immature albacore weighing less than 14 kg and mature albacore weighing more than 14 kg. One of the most distinguishable traits of albacore are the extremely long pectoral fins. In individuals longer than 50 cm, the pectoral fin can be 30% of the fork length. Because the closely related bigeye tuna (Thunnus obesus) also have extremely long pectoral fins, albacore are often confused with juvenile bigeye tuna. Pectoral fins of bigeye tuna have rounded tips while pectoral fins of albacore have more pointed tips. Because bigeye tuna grow much larger than albacore, only juvenile bigeye tuna are misidentified as albacore. In addition to long pectoral fins, albacore have very small scales covering their body, 11 to 14 dorsal spines, 12 to 16 dorsal soft rays, 11 to 16 anal soft rays, and no anal spines. Because the anterior spines are longer than the posterior spines in the dorsal fin, the dorsal fin appears to have a concave outline pointing back toward the tail. Albacore have a faint blue iridescent band along the side of the body as well as yellow shades in the dorsal and anal fins. Males are similar to females in appearance and color, but begin to grow larger in size after sexual maturity due to different growth rates.

Range mass: 60.3 (high) kg.

Range length: 140 (high) cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 11 - 14; Dorsal soft rays (total): 12 - 16; Analspines: 0; Analsoft rays: 11 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 152.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1300 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

140 cm FL (male/unsexed; (Ref. 3669)); max. published weight: 60.3 kg (Ref. 40637); max. reported age: 9 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found in offshore waters (Ref. 9340). Abundant in surface and deeper waters of 9.5° to 25.2°C forming mixed schools with skipjack tuna, yellowfin tuna and bluefin tuna. May tolerate lowered temperatures up to 9.5°C for short periods (Ref. 9340). Known to concentrate along thermal discontinuities. Schools may be associated with floating objects, including sargassum weeds. Feeds on fishes, crustaceans and squids. Also caught by trolling (Ref. 9684). Highly appreciated and marketed fresh, smoked, deep frozen or canned. Eaten steamed, broiled, fried and microwaved (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anterior spines much higher than posterior spines giving the fin a strongly concave outline. Interpelvic process small and bifid. Body with very small scales. Pectoral fins remarkably long, about 30% of fork length or longer in 50 cm or longer fish. Ventral surface of liver striated and the central lobe is largest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is an epipelagic and mesopelagic, oceanic species, that is abundant in surface waters of 15.6–19.4°C. Deeper swimming, large albacore are found in waters of 13.5–25.2°C. Temperatures as low as 9.5°C may be tolerated for short periods. It is known to concentrate along thermal discontinuities (Collette and Nauen 1983).

This species forms mixed schools with Skipjack Tuna (Katsuwonus pelamis), Yellowfin Tuna (Thunnus albacares) and Bluefin Tuna (Thunnus maccoyii). These schools may be associated with floating objects, including sargassum weeds (Collette and Nauen 1983). It feeds on fish, crustaceans and squid. In the Mediterranean Sea, this species feeds on paralepidids, Paralepis speciosa and P. coregonoides; crustaceans - hyperidean amphipods Phrosina semilunata; and cephalopods - Brachyscelus cruslculum (Consoli et al. 2008).

Use of combined Japanese and US tagging data confirm the frequent westward movement of young albacore and infrequent eastward movements in the North Pacific. This corresponds to albacore life history where immature fish recruit into fisheries in the western and eastern Pacific and then gradually move near their spawning grounds in the central and western Pacific before maturing (Ichinokawa et al. 2008).

Immature Albacore Tuna (<80 cm) generally have a sex ratio of 1:1 but males predominate in catches of mature fish. Maturity is attained at about 90–94 cm (FL) for females and 94–97 cm (FL) for males. Spawning occurs at sea surface temperatures of 24°C or higher. Fecundity increases with size but there is no clear correlation between fork length and ovary weight and number of eggs. A 20 kg female may produce between two and three million eggs per season, released in at least two batches (Collette 2010).

Longevity for this species may be as long as 13 years in the South Atlantic (Lee and Yeh 2007) and in the South Pacific (Labelle et al. 1993, Lee and Yeh 1993). Age of first maturity is estimated to be between five and seven years (Wu and Kuo 1993, Ramon and Bailey 1996). Based on age-structured data from the Atlantic and Pacific (Collette et al. 2011), generation length is conservatively estimated to be between 6–7 years.

The all-tackle game fish record is of a 39.97 kg fish taken off of Gran Canaria, Canary Islands in 1977 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Albacore have been found inhabiting depths of 0 to 600 m. Large albacore (~21 kg) typically occupy depths from 0 to 450 m, with a maximum abundance between 250 and 300 m. This 250 to 300 m depth has a water temperature of 25 to 15 degrees Celsius. While larger-bodied albacore tend to be active around cooler areas (some venture into deeper water ranging from 10 to 25 degrees Celsius), smaller-bodied albacore tend to occupy warmer layers. Being pelagic, they have no dependence on the sea floor.

Range depth: 0 to 600 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

An epi- and mesopelagic, oceanic species, abundant in surface waters of 15.6° to 19.4°C; deeper swimming, large albacore are found in waters of 13.5° to 25.2°C; temperatures as low as 9.5°C may be tolerated for short periods.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 28084 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27121 samples.

Environmental ranges
  Depth range (m): 0 - 4550
  Temperature range (°C): 1.323 - 27.841
  Nitrate (umol/L): 0.060 - 33.676
  Salinity (PPS): 31.060 - 37.360
  Oxygen (ml/l): 2.521 - 7.276
  Phosphate (umol/l): 0.022 - 2.359
  Silicate (umol/l): 0.481 - 123.229

Graphical representation

Depth range (m): 0 - 4550

Temperature range (°C): 1.323 - 27.841

Nitrate (umol/L): 0.060 - 33.676

Salinity (PPS): 31.060 - 37.360

Oxygen (ml/l): 2.521 - 7.276

Phosphate (umol/l): 0.022 - 2.359

Silicate (umol/l): 0.481 - 123.229
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

An epipelagic and mesopelagic, oceanic species, found in waters of 13.5° to 25.2°C. The albacore tuna may tolerate temperatures as low as 9.5°C for short periods (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 600 m (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The primary diet of albacore includes pacific saury, northern anchovy, crustacean zooplankton, gonatid squid, and Japanese anchovy. Albacore are opportunistic piscivores and their diet varies seasonally depending on location. Anchovy typically constitutes up to 96% of the stomach contents of albacore at any given time. Some studied fish fed on other schools of fish when encountered due to the patchy distribution of anchovy, demonstrating the opportunistic feeding habits of albacore. Albacore also exhibit a diel vertical migration pattern, following their prey throughout the water column.

Animal Foods: fish; mollusks; aquatic crustaceans; zooplankton

Plant Foods: phytoplankton

Primary Diet: carnivore (Piscivore )

  • Bernard, H., J. Hedgepeth, S. Reilly. 1985. Stomach Contents of Albacore, Skipjack, and Bonito Caught Off Southern California During Summer 1983. CaCOFL Rep, 26: 175-183.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Larger individuals are associated with cooler water bodies, while smaller individuals occur in warmer strata in the Atlantic. Albacore tend to concentrate along thermal discontinuities such as the Transition Zone in the north Pacific and the Kuroshio Front east of Japan because of richer forage organisms but poorer in oxygen content. Albacore migrate within water masses rather than across temperature and oxygen boundaries. Minimum oxygen requirements are probably about 2 ml/l. At least two stocks (northern and southern) are believed to exist in both the Atlantic and the Pacific. Feed during the day and at night (diurnal and nocturnal).The migration pattern of albacore in the south Pacific Ocean has recently been described (Ref. 30272). Juveniles move from the tropics into temperate waters and then eastwards along the subtropical convergence zone. At maturity, albacore return to the tropics but go back to temperate waters after spawning (Ref. 6390).In Australian waters, larvae are present on the North West shelf all summer, but are present off north-eastern Australia mainly between October and December (Ref. 30274). Juveniles are found off New South Wales from September to November, and during summer they follow the warmer waters of the East Australian Current southwards (Ref. 6390). Albacore may reach eastern Tasmanian waters by December, where they remain until about April (Ref. 6390). As autumn approaches and warm waters recede, the juveniles move northwards and are present again off New South Wales until May (Ref. 30278). Adult albacore travel in independent, small groups (Ref. 30273), and are common throughout much of the species' range (Ref. 6390). Also Ref. 26132.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Albacore fall into the fourth trophic level in the oceanic ecosystem. Albacore are top predators that prey upon many aquatic species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many sharks, rays, larger tunas, and billfishes are predators that prey upon albacore. Because albacore are valuable commercial fish, humans are also important predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Wedlia Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wedlia Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wedlia Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uroproctinella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Univietellodidymocytis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tentacularia Disease of Coryphaena. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syncoelium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sphyriocephalus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rocinella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhadinorhynchus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocycnus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudobothrium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Platocystis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Platocystis Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pennella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Opisthorchinematobothrium Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oncophora Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nematobothrium Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Monorygma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metazoan Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metanematobothrium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kudoa Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma sibi Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hepatoxylon Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gorgorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymosulcus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymosulcus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymonaja Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infection 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infection 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 9. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 11. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coeliotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Capsala Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 18. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 17. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brachiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bolbosoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ascaridatosis (adult and juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Areotestis Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease (juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little specific information is available on how albacore perceive their environment or communicate with others. However, they most likely perceive their environment through visual, auditory, tactile, and chemical means, as do most fish.

Perception Channels: visual ; acoustic

  • von der Emde, G., J. Mogdans, B. Kapoor. 2004. The senses of fish : adaptations for the reception of natural stimuli. Boston: Kluwer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Although albacore are closely related and quite similar to skipjack tuna and yellowfin tuna, they have different life history strategies. Skipjack tuna and yellowfin tuna are characterized by rapid growth and development, early maturation, and high energy input into gonad production. Albacore on the other hand, grow slow, mature late, and put relatively little energy into gonad production. The life stages of albacore include immature juveniles, non-spawning mature adults, and spawning mature adults. The eggs and larvae are planktonic, floating around the water column freely. The typical age of sexual maturity is five years. Up until the age of four, differences between males and females are negligible, but after that, males become increasingly larger than females. When captured, sex is determined by gonad analysis.

  • Santiago, J., H. Arrizabalaga. 2005. An integrated growth study for North Atlantic albacore (Thunnus alalunga Bonn. 1788). Journal of Marine Science, 62: 740-749.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The sex ratio in catches is about 1:1 for immature individuals, but males predominate among mature fishes, which is possibly due to both differential mortality of sexes and differential growth rate after maturity.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Males grow larger and to a later age in the Atlantic and Mediterranean. Maximum lifespan of albacore in the Atlantic is 13 years, while it is only 9 years in the Mediterranean. Before sexual maturity, the population sex ratio is 1:1. After maturity, males predominate due to differences in mortality and growth rate.

Range lifespan

Status: wild:
13 (high) years.

  • Megalofonou, P. 2000. Age and growth of Mediterranean albacore. Journal of Fish Biology, 57: 700-715.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Albacore are polygynandrous. They spawn as a group by simply releasing their eggs and sperm into the water.

Mating System: polygynandrous (promiscuous)

Albacore are an iteroparous species that breed seasonally. Adults make a spawning migration toward more tropical waters during the summer months (April to September in the Northern Hemisphere, October to March in the Southern Hemisphere). Females lay eggs that are fertilized externally (oviparous). Albacore tend to scatter their eggs throughout the ocean. A 20 kg female can produce 2 to 3 million eggs in two batches. However, this varies by size. Albacore reach sexual maturity at about five years of age.

Breeding interval: Albacore breed once yearly

Breeding season: Albacore breed July to September in the Northern Hemisphere, October to March in the Southern Hemisphere

Average number of offspring: 2 million.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Besides the contribution of their gametes and the energy expended migrating to spawning grounds, there is no parental investment by albacore.

Parental Investment: no parental involvement

  • Santiago, J., H. Arrizabalaga. 2005. An integrated growth study for North Atlantic albacore (Thunnus alalunga Bonn. 1788). Journal of Marine Science, 62: 740-749.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus alalunga

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1668-06|NC_005317|Thunnus alalunga| ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGAC---GACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATG---ATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCTCCCTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGGGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTAGCCCACGCAGGGGCATCAGTTGACCTA---ACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATCTCTCAATATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTTCTACTTTCCCTTCCAGTCCTTGCCGCT---GGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAGCATCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCCGGATTCGGAATAATTTCCCACATTGTTGCCTACTACTCAGGTAAAAAA---GAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATTGTATGAGCCCACCACATGTTCACGGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus alalunga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Species: 38
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Masuti, E., Nelson, R., Oxenford, H., Restrepo, V., Salas, E., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is important in many commercial fisheries around the world. It is managed throughout most of its range, although new or updated assessments are needed for the Mediterranean and the Indian Ocean. The Indian Ocean, South Atlantic, and South Pacific stocks are being fished below current maximum sustainable yield (MSY). Although the North Atlantic stock has been subject to overfishing in recent years, in 2009 catch quotas were adopted in line with scientific advice to end overfishing. In the North Pacific stock there has been very little population decline, yet models suggest that current fishing mortality is projected to be above FMSY. However, new information on the fishery still needs to be appropriately standardized to accurately reflect abundance and to determine if overfishing will indeed occur. Based on summed spawning stock biomass (SSB) estimated across all stocks, there has been an estimated 37% decline globally in SSB (from approximately 800,000 tonnes to 500,000 tonnes) over the past 20 years (1987–2007), or three generation lengths. In all parts of this species' range, large-scale fisheries are present and although effective management measures are now in place in many regions, declines are projected in at least one portion of its range. This species is listed as Near Threatened, primarily as population declines would be much greater if it were not for the catch quotas that have been implemented.

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As a whole, albacore are not cited as endangered by any major organizations, but not enough information is available for a definitive classification. This is due to lack of fishing for albacore past certain depths. However, the north Atlantic stock of albacore is listed as vulnerable by the IUCN, and the south Atlantic stock is listed as critically endangered.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: critically endangered

  • Uozumi, Y. 2004. "Thunnus alalunga" (On-line). 2004 IUCN Red List of Threatened Species. Accessed December 16, 2005 at www.redlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007. The South Atlantic stock is classified as Critically Endangered (CR) and the North Atlantic stock is classified as Vulnerable (VU) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation status

IUCN Red List: Listed, Data deficient

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
FAO worldwide reported landings show a steady increase from 103,676 t in 1950 to 284,542 t in 2006 (FAO 2009). There are six stocks that are globally managed for this species. As of 2004, the stock in the North Atlantic is considered Overexploited; the Indian Ocean and North Pacific are Fully Exploited; the South Atlantic and South Pacific are Moderately Exploited; and the Mediterranean is Unknown (Majkowski 2007). Populations in the Eastern Pacific consist of the South Pacific stock and the North Pacific stock. Details of the migration remain unclear, but juvenile fish (2–5 years) are believed to move into the eastern Pacific Ocean in the spring and early summer, and return to the western and central Pacific, perhaps annually, in the late fall and winter, where they tend to remain as they mature (IATTC 2008). Recent estimates of total catch data from IATTC (2008) for the Eastern Pacific are 24,604 mt (2005), 30,393 mt (2006), and 8,587 mt (2007).

North Pacific Ocean
An assessment for the North Pacific stock conducted in 2006 (Stocker 2006, ISC 2008) found that spawning stock biomass (SSB) has experienced slight fluctuations since 1960s, but has remained relatively stable at ~90,000 mt over the last two decades. Linear regression of SSB over the past 20 years (1987–2005), shows only a very small decline of approximately 6%. The total catch increased substantially in 2007, to a level typical of the catches occurring during the 1996–2004 period, while preliminary catch for 2008 decreased to a level more consistent with catches after 2004. Even though current fishing mortality is projected to be above FMSY, recent changes in the distribution of the fishery need to be appropriately standardized before relative abundance can be accurately reflected (Holmes 2009). A new stock assessment planned for 2011.

South Pacific Ocean
Based on Multifan-CL stock assessment conducted in 2008 (Hoyle et al. 2008), SSB has decreased approximately 36–40% over the past 20 years (1987–2007). However, the conclusion is that this species is not in an overfished state, with current catch levels being sustainable (Hoyle and Davies 2009). Although estimates are highly variable between model configurations, 2004–2006 mortality is estimated to be below FMSY, and 2004–2006 biomass is estimated to be above BMSY, and spawning stock biomass between 2004–2006 is estimated to be above SSBMSY (Hoyle and Davies 2009).

Indian Ocean
The only stock assessment available for this species in the Indian Ocean, conducted in 2008, may be unreliable (Hilary 2008). In terms of predicted stock-status, the model predicted that the stock biomass in the Indian Ocean was very close to MSY but that the current harvest rate was above the MSY level indicating that over-fishing may be occurring. The 2007 catch level (31,226 tonnes) was predicted to be above the MSY level (27,022 tonnes) with high probability. This assessment is very preliminary and it should be recommended that a more realistic fully age/length structured model be developed for the future to assess this stock (Hilary 2008).

Based on this exploratory stock assessment, estimated SSB in the Indian Ocean has declined approximately 55% over the past 20 years (1987–2007), even though in the past four years (2002–2006) estimated SSB has increased from 20,000 to 40,000 tonnes. Standardized CPUE has also declined over the past 25 years, but has been relatively stable since 1990 (IOTC 2008). Current mortality is below FMSY. Although results of these analyses are considered preliminary and indicative only, it was concluded that this stock is not presently overfished (IOTC 2008).

North Atlantic Ocean
Catches of this species in the north Atlantic peaked at 65,000 tonnes in the mid-1960s, then declined to a low of 20,000 tonnes in 2008. This decline is partly due to reduced fishing effort by some surface and longline fisheries. The most recent stock assessment in 2009 indicated that recruitment in the fishery is highly variable, and that biomass since 1993 has been less than biomass at MSY. Currently, the stock is about 40% below the MSY level and spawning stock biomass is currently only 25% of the original biomass (ICCAT 2009). The MSY from the last stock assessment was estimated at 29,000 tonnes, and catches in four of the last ten years have exceeded this value. This species stock in the North Atlantic was recently considered to be in an overfished state (ISSF 2010, Joseph 2009). However, in 2009 catch quotas were adopted in line with scientific advice to end overfishing.

In the 2009 stock assessment for the north Atlantic (ICCAT 2009), several models were used to evaluated the status of the stock. Based on linear regression of the Multifan base case, estimated spawning stock biomass has decreased approximately 33% over the past 20 years (1987–2007).

South Atlantic Ocean
In the South Atlantic, catches have varied from a high of 41,000 tonnes in 1987 to a low of 15,000 tonnes in 1984. Catches were stable from 1988 to 2001 at ca. 30,000 tonnes, and the average in the last five years has been 21,000 tonnes (ISSF 2010). The current estimate of MSY is 33,000 tonnes, ranging between 29,000 and 36,700 tonnes. In the last ten years only one year had a catch exceeding the MSY estimate. It is likely that the stock is below the maximum sustainable yield (MSY) level as it was estimated to about 90% of BMSY in 2005, while the 2005 fishing mortality rate was about 60% of FMSY (SCRS ICCAT 2010). The stock is considered to be in a slightly overfished state, but is not currently being fished above MSY (ISSF 2010).

In the 2007 stock assessment for the South Atlantic (ICCAT 2007), several models were used to evaluated the status of the stock. Based on linear regression of the ASPM age structured production model base case, estimated SSB has decreased approximately 32% over the past 20 years (1987–2007).

Mediterranean
A stock assessment for the Mediterranean is planned for 2011. The Mediterranean albacore fisheries are characterized by high spatio-temporal variability in landings and fishing patterns. Albacore fishing is a traditional activity for a number of fleets including those of Cyprus, Greece, Italy, Spain, and Malta. ICCAT statistics, however, are considered quite incomplete due to unreported catches from several countries and the lack of data in some years from other countries. Fishing effort is not possible to estimate due to short time series and inadequate coverage of artisanal gears. Even though catches of Mediterranean albacore have been increasing for the past few years, there is a lack of general information on this stock and biological information is also limited (ICCAT 2010). Although many countries are not yet reporting any catch for this species, the Mediterranean stock does not show any general trend, and the mixing rate with the Atlantic stock appears to be insignificant (STECF 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is caught by long-lining, live-bait fishing, purse seining, and trolling. In the Eastern Pacific it is also a bycatch of swordfish fisheries. Albacore Tuna are caught by long-line gear in most of the North and South Pacific (but not often between about 10°N and 5°S), by trolling gear in the eastern and central North and South Pacific, and by pole-and-line gear in the western North Pacific. In the North Pacific about 60% of the fish are taken in pole-and-line and troll fisheries that catch smaller, younger Albacore Tuna, whereas about 90% of the albacore caught in the South Pacific are taken by long-line (IATTC 2008).

Catches of northern Atlantic Albacore Tuna are primarily made by pole-and-line (35%), trolling (28%), trawlers (17%) and longline (17%). The main fisheries are Spain, France, and Chinese Taipei. Surface fisheries concentrate mainly in the Bay of Biscay and the Azores and Canary Islands during summer and fall, taking young fish while longline vessels operate throughout the Atlantic year-round and target larger fish (ISSF 2010). For the south Atlantic stock, the main fisheries are longliners from Chinese Taipei (56%), pole-and-line from South Africa (18%) and from Namibia (13%). Surface fisheries operate mainly between October and May capturing juvenile and subadult fish (ISSF 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

For many years, important fisheries have existed for the albacore tuna in the Atlantic and Pacific Oceans. As efforts to catch fish have increased, the world catch of albacore tuna has been gradually declining and many stocks are now over-fished, or fully exploited and nearing a situation of over-fishing (2) (5). The North Atlantic stock has declined to about one quarter of the peak levels estimated for the 1940s, and likewise, the South Atlantic stock has been reduced by fisheries to about 25 percent of its un-fished level (7). While there are regulations regarding the amount of albacore tuna that can be caught in many areas, enforcing such fishing laws can be challenging as the boats operate on the high seas far from observation (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed as a highly migratory species in Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department, 1994).

In the north Atlantic, a total allowable catch (TAC) of 28,000 tonnes was established for 2010 and 2011 for the northern stock. TACs are also in place for the southern Atlantic albacore fishery. For the south Atlantic, the TAC for 2009–2011 is 29,900 and adjustments are made to reduce the TACs in the following year if the actual catch exceeds the TAC in a given year (ICCAT 2009). The driftnet fishery for albacore has been banned since January 1st 2002 in the European Union countries and from 2004 in all the ICCAT Mediterranean countries, but it is known that illegal fishing activity still occurs in some areas (STEFC 2007).

In the North Pacific, the International Scientific Committee-Albacore Working Group strongly recommends that all countries support precautionary-based fishing practices (e.g., limits on current levels of fishing effort) given the current level of fishing mortality (ISC 2008). In the Indian Ocean, there are no conservation measures in place, but a new assessment for this species is recommended by 2010.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In the Atlantic Ocean, the International Commission for the Conservation of Atlantic Tunas (ICCAT) is responsible for the conservation of the albacore tuna. Based on scientific evidence, the Commission can adopt recommendations and resolutions aimed at maintaining populations of tuna species at levels which will permit maximum sustainable catch (7). An assessment of albacore tuna stocks undertaken in 2007 led to the recommendation that the total allowable catch should be reduced for the North Atlantic stock if it is to recover from its over-fished condition. Even though the South Atlantic stock was also found to be over-fished, the Commission considered that the current management regulations for the South Atlantic stock are sufficient for its recovery (7). Similarly, the Inter-American Tropical Tuna Commission (IATTC) is responsible for the conservation and management of fisheries for tunas in the eastern Pacific Ocean (9). While in these areas, stocks of the albacore tuna are studied, monitored and fisheries regulated, elsewhere the status of this species is not so clear, hence the World Conservation Union (IUCN) has assessed it as Data Deficient (1). Hopefully further knowledge will soon come to light, to ensure that throughout its range, this important tuna species will be exploited sustainably without threat to its continued survival.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Current research is beginning to show that some tuna consumed by humans may exceed the Food and Drug Administration's original action level of 0.5 ppm mercury. Tuna marketed in stores as white tuna, such as albacore, contains twice as much mercury as skipjack tuna, which is typically marketed as light or chunk light tuna. This is not a major health issue right now, but it may be wise to perform further research on this inorganic metal contaminant in tuna.

  • Burger, J., M. Gochfeld. 2004. Mercury in canned tuna: white versus light and temporal variation. Environmental Research, 96: 239-259.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Albacore are important commercially and are highly targeted by fisheries around the world, especially by Taiwan, Japan, and Korea. They are caught and sold fresh, frozen, or canned.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; gamefish: yes; price category: Bycatch of swordfish fishery.; price reliability: high
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Albacore

The albacore, Thunnus alalunga, is a type of tuna in the family Scombridae. This species is also called albacore fish, albacore tuna, albicore, longfin, albies, pigfish, tombo ahi, binnaga, Pacific albacore, German bonito (but see bonito), longfin tuna, longfin tunny, or even just tuna. It is the only tuna species which may be marketed as "white meat tuna" in the United States. It is found in the open waters of all tropical and temperate oceans, and the Mediterranean Sea. Lengths range up to 140 cm (4.5 feet) and weights up to 45 kg (99 lb).

Albacore is a prized food, and the albacore fishery is economically significant. Methods of fishing include pole and line, long-line fishing, trolling, and some purse seining. It is also sought after by sport fishers.

The pectoral fins of the albacore are very long, as much as 50% of the total length. The dorsal spines are 8 to 10 in number, and well forward of the rays of the dorsal fin. The anterior spines are much longer, giving a concave outline to the spiny part of the dorsal fin.

Contents

Consumers, albacore, and sustainable fisheries

semi-cooked Albacore

A number of programs have been developed to help consumers identify and support responsible and sustainable fisheries. Perhaps the most widely accepted of these programs is that of the Marine Stewardship Council (MSC). Several albacore fisheries have been certified as sustainable according to MSC standards, including the U.S. North and South Pacific albacore pole and line and troll fisheries ("pole and troll"), Canadian north Pacific fishery, and the New Zealand troll fishery.[2]

The United States government's "Fishwatch" program seeks to provide consumers with accurate and timely information on U.S. seafood fisheries.[3]

In 2010, Greenpeace International added the Albacore to its "seafood red list". "The Greenpeace International seafood red list is a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries."[4]

Mercury levels

Like other fish, albacore accumulates methylmercury in body tissue over time. Methylmercury is removed from the body naturally, but it may take over a year for the levels to drop significantly. Thus, it may remain in a woman from before she becomes pregnant. The average canned albacore "white" or "solid" tuna is 0.35 ppm of methylmercury.[5][6] Some groups[who?] have urged testing and recall of older canned albacore that may have high mercury levels.[citation needed]

Recent studies from the U.S. and Canada show that the albacore caught by the American albacore fishing fleet off the coasts of Washington, Oregon, and California have far lower mercury levels than in previous years.[7] The U.S. Food and Drug Administration (FDA) advises women of childbearing age and children to limit their consumption of albacore tuna ("chunk white" or "solid white" ) and tuna steaks to six ounces per week or less. However, the FDA advisory does not distinguish the albacore caught off the West Coast from albacore caught in other parts of the world.[citation needed]

Supply

Management and stock assessment are applied to separate stocks of albacore believed to occur in the North Pacific, South Pacific, Indian Ocean, North Atlantic and South Atlantic.

SeaChoice ranks albacore as a "best choice" for consumers, although notes some "moderate concerns" regarding the management effectiveness (in particular, no definitive assessment of the albacore stock of the Indian Ocean fishery has taken place), and "moderate concern" over the fishing stock, especially regarding the North Atlantic albacore population, which the National Marine Fisheries Service (NMFS) considers overfished with overfishing still occurring. The southern Atlantic stock is also considered (in 2007) overfished but not currently experiencing overfishing. The North Pacific and South Pacific albacore stocks are not overfished and not experiencing overfishing.[8]

Other species called albacore

In some parts of the world, other species may be called "albacore":

References

  1. ^ Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., Chang, S.-K., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Minte Vera, C., Miyabe, N., Montano Cruz, R., Masuti, E., Nelson, R., Oxenford, H., Restrepo, V., Salas, E., Schaefer, K., Schratwieser, J., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E. (2011). "Thunnus alalunga". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21856. Retrieved 13 January 2012. 
  2. ^ Marine Stewardship Council. "List of all certified fisheries". MSC.org. http://www.msc.org/track-a-fishery/certified/all-certified-fisheries. Retrieved 15 February 2012. 
  3. ^ NOAA Fishwatch - Pacific albacore
  4. ^ Greenpeace International Seafood Red list
  5. ^ "What You Need to Know about Mercury in Fish and Shellfish". US EPA. http://www.epa.gov/waterscience/fish/advice/. Retrieved 2009-10-15. 
  6. ^ "Draft Risk and Benefit Report: Section II, Exposure to Methylmercury in the United States". FDA. http://www.fda.gov/Food/FoodSafety/Product-SpecificInformation/Seafood/FoodbornePathogensContaminants/Methylmercury/ucm173271.htm. Retrieved 2009-10-15. 
  7. ^ http://www.nmfs.noaa.gov/fishwatch/docs/OSU_Mercury_Study.pdf
  8. ^ "Tuna: Albacore". SeaChoice. http://www.seachoice.org/profile/70/view. Retrieved 2007-02-21. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!