Overview

Comprehensive Description

Biology

Adults are found in rivers, lakes and reservoirs, preferring fast-flowing waters of rapids and races and usually forming aggregations near the surface. Usually found below rapids and weirs (Ref. 44894). Feed on aquatic insects, mollusks, earthworms and plants. Temp.: 2-37°C. Maturity: F, 3 y and 34 cm SL; M, 23.3 cm SL. Spawning: summer (Nov.-Jan., 23-30°C water temp.), effect upstream migration. Fecundity: 500000 eggs per 1.8kg. Eggs: pelagic, 2.7-2.8 mm diameter. Hatching: 30 hrs at 26-27°C. Larvae: 3.6 mm at hatching. Eggs are guarded and fanned by the male parent (Ref. 205). A good angling and food fish which has been increasingly utilized as an aquaculture species in farm dams throughout Australia (Ref. 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Oceania: known only from the Murray-Darling River system, Australia. Range boundaries: Chinchilla (on the Condamine River), South Queensland, Bonshaw (on the Dumaresq River), northeastern New South Wales, Albury (on the Murray River), southeastern New South Wales, Seven Creek and Goulburn River, South Victoria.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 2906)); max. published weight: 1,500 g (Ref. 5259)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; depth range 10 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Upstream spawning migration in summer to areas behind the peak of the flood. Spawning commences late in the afternoon from the surface to a depth of about 4 m, where there is a flow over a gravel, rock rubble substrate. Considerable spawning activity happens at the water surface. A single female circles slowly to the surface with her head deep and several males participate in courtship and finally in fertilization (Ref. 2906). Eggs are guarded and fanned by the male parent (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bidyanus bidyanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAGTATTCGGTGCATGAGCTGGAATGGTGGGCACAGCCCTGAGCCTACTAATTCGAGCAGAACTAAGCCAGCCTGGCGCTCTCCTAGGAGACGACCAAATTTATAATGTAATTGTTACGGCGCATGCCTTTGTAATAATTTTCTTTATAGTCATGCCAATCATGATTGGAGGCTTTGGAAACTGGCTTGTCCCGCTAATAATCGGGGCCCCTGACATGGCCTTCCCTCGAATAAATAATATGAGTTTCTGACTCCTCCCCCCTTCTTTCCTACTTCTTCTTGCTTCTTCCGGGGTAGAGGCTGGAGCCGGAACTGGTTGGACCGTTTACCCCCCTCTCGCCGGCAATCTAGCCCACGCTGGGGCATCAGTGGACCTGACCATCTTCTCCCTCCATCTGGCCGGGATCTCTTCAATCCTTGGAGCCATTAATTTTATTACAACCATTATTAACATAAAACCTCCCGCTATCTCCCAATATCAGACCCCTCTGTTCGTCTGGGCTGTCCTTGTCACTGCTGTGCTTCTTCTCCTCTCCCTTCCAGTTCTTGCTGCCGGCATCACAATGCTCCTTACAGATCGCAATCTAAATACCTCCTTCTTTGACCCTGCAGGAGGCGGCGACCCAATCCTTTACCAACACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bidyanus bidyanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1cd

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Wager, R.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Vulnerable (VU) (A1cd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Silver Perch

Silver perch (Bidyanus bidyanus)[1] are a medium-sized freshwater fish endemic to the Murray-Darling river system in south-eastern Australia. Their scientific name comes from an aboriginal name for the species — Bidyan — recorded by Major Mitchell on the Barwon River on his 1832 expedition. (Mitchell's original scientific name for the species was Cernua Bidyana.) Silver perch are not a "true" perch of the Perca genus, but are instead a member of Terapontidae or 'grunter' family. They are the largest member of the Terapontidae family, capable of growing in excess of 60 cm and close to 8 kg, but today wild river specimens are typically 30–40 cm and 1.0–1.5 kg.

The silver perch is the only major representative of the Terapontidae family in the southern Murray-Darling system, compared to northern tropical systems where terapontid species are common. Another small terapontid, the spangled perch (Leiopotherapon unicolor), does occur sporadically in the northern Murray-Darling Basin.

Description[edit]

Silver perch are streamlined laterally compressed fish with a spiny dorsal fin of medium height, angular soft dorsal and anal fins and a forked tail. Large specimens become very deep bodied with a large hump behind the head.

Diet[edit]

The importance of vegetative matter in the diet of silver perch is still debated. Silver perch appear primarily to be a low-order predator of small aquatic invertebrate prey, with occasional intakes of small fish and vegetative matter. In aquaria, silver perch are reported to take blood worms readily.

Distribution[edit]

Silver perch are schooling mid-water fish with a preference for flowing water. Though found in the lowland reaches of the Murray-Darling system, they actually had a significant presence in the upland reaches as well. Long summer migrations into the upland reaches of rivers like the Murrumbidgee were once an annual event.

Fishing[edit]

Fishermen caught silver perch on unweighted baits such as worms and on small spinning-blade lures in rapids during these migrations, as well as flowing and moving waters more generally. They were renowned for being very fast and strong fighting fish for their size.

Spawning and biology[edit]

Silver perch spawn in late spring and early summer. Originally temperatures of close to 24 degrees Celsius were considered necessary but as with all Murray-Darling fish species it has become apparent that the "required" spawning temperature is flexible and that they can and do spawn at lower temperatures. Silver perch are moderately fecund, with egg counts commonly around 200,000 to 300,000. Spawning occurs at the surface at dusk or the first few hours of night. The female sheds the eggs and the male fertilizes them in a few seconds of vigorous thrashing. The eggs are semi-buoyant and will sink without significant current, and take 24 to 36 hours to hatch.

Silver perch continue the trend of native fish of southeast Australia being very long-lived. Longevity is a survival strategy in the often challenging Australian environment to ensure that most adults participate in at least one exceptional spawning and recruitment event, which are often linked to unusually wet La Niña years and may occur only every one or two decades. The maximum recorded age is 26 years.

Conservation[edit]

Silver perch have declined close to the point of extinction in the wild. Only one sizeable, viable population remains in the wild in the central reaches of the Murray River. Silver perch are bred extensively in aquaculture but these domesticated strains are of little use in ensuring the species survival in the wild.

Reasons for their catastrophic decline are not clear. Dams, weirs and river regulation and the virtual removal of spring floods does appear to have removed the conditions silver perch need to breed and recruit successfully on a large scale. Weirs are also believed to impact on migrations of spawning adults and juveniles, and it is suspected many drifting silver perch larvae are killed in the fall as they pass over/through weirs. A recent study that has proven more than 90% of silver perch passing through undershot weirs are killed. Without doubt, weirs trap drifting silver perch eggs as well, almost certainly to their detriment.

It is not widely appreciated that silver perch eggs sink without significant water current; silver perch eggs are often inaccurately described as simply being pelagic, or "floating". The eggs may actually settle onto the substrate in the wild and should perhaps be considered benthic in most circumstances rather than pelagic. This may be a factor in their recent serious declines; silver perch may rely on their eggs settling onto clean, well oxygenated substrates of coarse sediments. In this era of flow regulation and flood curtailment by dams, which control the flood events that remove fine sediment, and chronic siltation from poor agricultural practices, the eggs may now frequently land in anoxic fine sediment and organic matter — such as in weir pools — and fail to survive.

Suspicions are also mounting that there is competition for food between introduced carp and silver perch at larval, juvenile and adult stages. Competition at the larval stage is considered the most serious. Indeed, suspicions are mounting that introduced carp are having very large impacts on a number of native Murray-Darling fish species due to competition at the larval stage, and that these impacts have so far been underestimated.

Exotic pathogens are now strongly suspected of playing a role in the species' decline.

Notes[edit]

  1. ^ Allen, Midgley & Allen. Field Guide to the Freshwater Fishes Of Australia. Museum of Western Australia & CSIRO Publishing. 2002. ISBN 0-7307-5486-3

References[edit]

  • Boys CA, Baumgartner L, Robinson W, Giddings G and Lay C (2010). Protecting migrating fish at in-stream structures: downstream mortality at weirs and screening water diversions. 2010 Native Fish Forum — Abstracts. Murray-Darling Basin Authority, Canberra. Online at: http://www.mdba.gov.au/system/files/NFS-2010-fish-forum-abstracts_Final.pdf.
  • Mallen-Cooper, M. and I. G. Stuart. (2003). Age, growth and non-flood recruitment of two potamodromous fishes in a large semi-arid/temperate river system. River Research and Applications 19, 7: 697 – 719.
  • Wager, R. 1996. Bidyanus bidyanus. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 26 June 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!