Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits inner reef flats and sheltered lagoons. A common inshore species, often on algal or silty reefs and among attached Sargassum on shallow rubble flats (Ref. 48637). Solitary or in groups (Ref. 90102). Feeds mainly on filamentous green algae and to a lesser extent on fleshy and coralline red algae and on benthic invertebrates. Monogamous (Ref. 52884).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Port Alfred, South Africa (Ref. 4919) and east to Tuamoto Islands, north to southern Taiwan, south to New South Wales. Reported from Tanabe Bay, Japan (Ref. 559) and Southeast Atlantic.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Tuamotu Archipelago, north to southern Taiwan, south to northern New South Wales (Australia) and New Caledonia; a waif from Galápagos Archipelago (Eastern Pacific)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9 - 11; Analspines: 0; Analsoft rays: 8 - 10
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 4919))
  • Smith, M.M. and P.C. Heemstra 1986 Tetraodontidae. p. 894-903. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4919)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Less than 30 small brown dots on side of caudal peduncle (Ref. 559).Description: Characterized further by brown color of upper half, whitish below, blue to greenish eye spokes; chin with blue lines; base of dorsal fin with pale-edged black spot; depth of body at origin of anal fin 2.6-3.2 in SL; head length 2.6-2.8 in SL; length of snout 1.4-1.6 in head length; bony interorbital width 4.0-4.8 in head length; caudal peduncle depth 2.1-2.7 in head length; slightly rounded caudal fin (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits inner reef flats and sheltered lagoons. Rarely seen to a depth of 10 m on seaward reefs. Feeds mainly on filamentous green algae and to a lesser extent on fleshy and coralline red algae and on benthic invertebrates.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Canthigaster bennetti
Catalog Number: USNM 337867
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Agassiz
Year Collected: 1899
Locality: Fakarava Atoll, Paumotu Islands; Tuamotu Archipelago, Fakarava Atoll, French Polynesia, Tuamotu Archipelago, Pacific
Vessel: Albatross
  • Paratype: Kendall, W. C. & Goldsborough, E. L. 1911. Memoirs of the Museum of Comparative Zoology at Harvard College. 26 (7): 336, 7-2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Canthigaster bennetti
Catalog Number: USNM 65767
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): A. Agassiz
Year Collected: 1899
Locality: Fakarava Atoll, Paumotu Islands; Tuamotu Archipelago, Fakarava Atoll, French Polynesia, Tuamotu Archipelago, Pacific
Vessel: Albatross
  • Holotype: Kendall, W. C. & Goldsborough, E. L. 1911. Memoirs of the Museum of Comparative Zoology at Harvard College. 26 (7): 336, 7-2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 15 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0.61 - 25
  Temperature range (°C): 24.659 - 29.058
  Nitrate (umol/L): 0.016 - 0.622
  Salinity (PPS): 33.950 - 36.148
  Oxygen (ml/l): 4.516 - 4.825
  Phosphate (umol/l): 0.055 - 0.301
  Silicate (umol/l): 0.829 - 3.439

Graphical representation

Depth range (m): 0.61 - 25

Temperature range (°C): 24.659 - 29.058

Nitrate (umol/L): 0.016 - 0.622

Salinity (PPS): 33.950 - 36.148

Oxygen (ml/l): 4.516 - 4.825

Phosphate (umol/l): 0.055 - 0.301

Silicate (umol/l): 0.829 - 3.439
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated. Exquisite toby.  (Bleeker, 1854)  Attains 10 cm. Caudal fin slightly rounded, a broad diffuse dark grey-brown stripe on upper side of body, the back above brownish yellow with numerous small orange spots and a scattering of small pale blue spots and lines, the body below white with red, orange and pale-blue dots; region around eye orange-yellow with blue lines; a blue-edged black spot at the dorsal fin base. Indo Pacific; usually seen in shallow protected waters on sand rubble bottoms near reefs or in sea grass or algal beds; stomach contents from three from New Guinea 85% algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canthigaster bennetti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGTCTCCTTATTCGAGCTGAGCTCAGCCAACCCGGCGCACTTTTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGCGGCTTTGGAAACTGGCTAGTGCCCCTTATAATTGGAGCACCTGACATGGCATTTCCTCGAATAAACAACATAAGTTTCTGACTGCTACCCCCCTCCTTCCTGCTCCTCTTAGCATCTTCTGGCGTAGAAGCCGGGGCTGGCACAGGCTGAACAGTCTACCCCCCACTAGCAGGCAACTTGGCCCACGCAGGGGCCTCTGTTGACCTAACAATCTTCTCCCTCCACCTAGCAGGTGTCTCATCAATTCTAGGTGCTATCAACTTTATCACCACAATTATTAACATGAAACCCCCAGCCATTTCTCAATACCAAACCCCCCTCTTTGTATGAGCTGTGCTAATTACTGCTGTGCTACTTCTACTATCACTTCCTGTTCTCGCAGCCGGAATTACAATGCTTCTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGAGGAGGGGATCCCATTCTTTATCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Canthigaster bennetti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Canthigaster bennetti

Canthigaster bennetti is a Pufferfish from the Indo-Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 10cm in length.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!