Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Juveniles are encountered under ledges, or in holes of outer lagoon patch reefs or semi-protected areas of exposed channels and outer reef flats. Subadults move to reef front holes and surge channels. Large adults inhabit ledges and caves in areas of rich coral growth on clear lagoon, channel, or seaward reefs (Ref. 6113). Benthopelagic (Ref. 58302). Feed on sponges and other encrusting organisms (Ref. 6113); also on tunicates. Form pairs. Young and adults may clean much larger fishes such as sunfish (Ref. 48636). Frequently exported through the aquarium trade. Juveniles are distinguished by a white dorsal-fin margin (Ref. 48391).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread throughout the Indian Ocean and the western and central Pacific Ocean. It ranges from coastal East Africa and the Red Sea in the west to the Tuamotu Islands (French Polynesia), Line Islands (Kiribati and USA). It is a vagrant in the Hawaiian Islands (USA). Populations have been recorded as far north as southern Japan (including the Ogasawara Islands [=Bonin Islands] and Izu Islands) to the Great Barrier Reef (Australia), New Caledonia (France) and the Austral Islands (French Polynesia) in the south (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). It has been recorded at depths between depths of 1-100 m (Pyle 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Hawaiian, Line and Tuamoto islands, north to southern Japan and the Ogasawara Islands, south to the Great Barrier Reef, New Caledonia, and the Austral Islands (Ref. 33390). Not found in Easter Island, Rapa and the Marquesan Islands (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to Western Australia, Lord Howe Island, New Caledonia, Tonga and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 17 - 21; Analspines: 3; Analsoft rays: 18 - 21
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 30573)); max. reported age: 14 years (Ref. 72479)
  • Hinton 1962 Horned shark, gar, mormyriad, characin, carp, armored catfish, arowana, upside down catfish. Not given. (Ref. 72479)
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Juveniles are bluish black with concentric white circles. Adults blue with close-set horizontal yellow stripes on the sides and the adjoining dorsal and anal fins. Snout white; eye enclosed in a black vertical bar with blue edge; pectoral fin base area also black. Transformation to the adult color pattern occurs over the size range 8 - 12 cm (Ref. 1602). Body depth 1.6-1.8 in SL. Scales longitudinal series about 90 (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Juveniles are encountered under ledges, or in holes of outer lagoon patch reefs or semi-protected areas of exposed channels and outer reef flats. Subadults move to reef front holes and surge channels. Large adults inhabit ledges and caves in areas of rich coral growth on clear lagoon, channel, or seaward reefs. Feeds on sponges and other encrusting organisms (Ref. 6113).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits a wide variety of habitats with individuals usually reported from coastal and outer reefs, deep lagoons, often in areas of rich coral growth (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). It is commonly seen near ledges and caves. The juveniles usually occur under ledges or in holes on shallow reefs. It feeds mainly on sponges and tunicates (Pyle 2001, G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 100 m (Ref. 48391)
  • Pyle, R. 2001 Pomacanthidae: Angelfishes. p. 3266-3286. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 5. Bony fishes part 3 (Menidae to Pomacentridae). Rome, FAO. (Ref. 48391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 99 specimens in 1 taxon.
Water temperature and chemistry ranges based on 84 samples.

Environmental ranges
  Depth range (m): 0.5 - 104.5
  Temperature range (°C): 23.446 - 29.171
  Nitrate (umol/L): 0.047 - 4.152
  Salinity (PPS): 32.768 - 40.307
  Oxygen (ml/l): 3.774 - 4.757
  Phosphate (umol/l): 0.094 - 0.508
  Silicate (umol/l): 0.803 - 7.946

Graphical representation

Depth range (m): 0.5 - 104.5

Temperature range (°C): 23.446 - 29.171

Nitrate (umol/L): 0.047 - 4.152

Salinity (PPS): 32.768 - 40.307

Oxygen (ml/l): 3.774 - 4.757

Phosphate (umol/l): 0.094 - 0.508

Silicate (umol/l): 0.803 - 7.946
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 70m.
From 1 to 70 meters.

Habitat: reef-associated. Emperor angelfish. (Bloch, 1787)  Attains about 40 cm. Outer reefs of live coral in 1-25 metres. Indo-West Pacific south to Natal. Phil Heemstra
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Juveniles are encountered under ledges, or in holes of outer lagoon patch reefs or semi-protected areas of exposed channels and outer reef flats. Subadults move to reef front holes and surge channels. Large adults inhabit ledges and caves in areas of rich coral growth on clear lagoon, channel, or seaward reefs. Feed on sponges and other encrusting organisms (Ref. 6113).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Cauliflower Disease. Viral diseases
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus imperator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTACTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCACTAAGCCTGCTGATTCGAGCCGAACTAAACCAACCAGGCAGTCTTCTCGGAGACGACCAGATCTATAATGTCATCGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTAATGCCAGCAATAATCGGAGGTTTTGGGAACTGGCTAGTTCCACTGATAATTGGAGCCCCAGACATGGCATTCCCCCGAATAAATAATATAAGCTTTTGACTCCTACCCCCTTCCCTCCTCCTTCTCCTTGCTTCCGCTGGAGTAGAAGCAGGAGCTGGGACCGGGTGAACAGTTTACCCACCCCTGGCCGGCAATCTAGCCCATGCAGGAGCATCCGTAGATTTGACCATTTTTTCTCTTCATCTGGCCGGGATCTCCTCAATTCTGGGGGCCATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCTATCTCACAGTACCAGACCCCCTTATTTGTATGAGCCGTCCTAATTACTGCGGTCCTACTTCTGCTCTCTCTTCCCGTCCTTGCTGCCGGCATCACAATGCTTCTCACGGACCGAAACCTAAACACCACCTTTTTTGACCCTGCAGGAGGGGGAGACCCAATCCTCTACCAACATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus imperator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
A common species with a wide range and no apparent major threats. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection for the aquarium trade is localized and does not seem to affect the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures known for this species. It is present within several marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Edwards, A.J. and A.D. Shepherd 1992 Environmental implications of aquarium-fish collection in the Maldives, with proposals for regulation. Environ. Conserv. 19:61-72. (Ref. 4907)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Emperor angelfish

The emperor angelfish, Pomacanthus imperator, is a species of marine angelfish. It is a reef-associated fish, native to the Indian and Pacific Oceans, from the Red Sea to Hawaii and the Austral Islands. It ranges from coastal East Africa and the Red Sea in the west, to the Tuamotu Islands and Line Islands. Rare sightings have been recorded in the Hawaiian Islands, Puerto Rico, and Florida. These appearances are most likely due to aquarium release. Some populations have been observed as far as southern Japan to the Great Barrier Reef in Australia, New Caledonia, and the Austral Islands. This species is generally associated with stable populations and faces no major threats of extinction. It is a favorite among photographers, artists, and aquarists because of its unique, brilliant pattern of coloration.

Habitat[edit]

Emperor angelfish dwell in reef-associated areas at depths ranging from 1-100 m. Juveniles live alone and inhabit outer lagoon patch reefs or semi-protected exposed channels and reef flats. They tend to hang out at shrimp cleaning stations, feeding off parasites and dead skin of larger fish species. Subadults move to reef front holes and surge channels, while mature adults are found in caves in areas of rich coral growth on clear lagoon, seaward, or channel reefs. Males are territorial and will defend their habitat as well as the females living with them. An angelfish territory can be as large as 10,760 square feet. Adults are also known for making a low-frequency “knocking” sound if disturbed or threatened by divers.

Coloration[edit]

Juvenile Emperor angelfish

Juveniles are dark blue with electric blue and white rings; adults have yellow and blue stripes, with black around the eyes. It takes about 24 to 30 months for an emperor angelfish to acquire its adult coloring. They grow to 40 cm (15.75 in) in length.

Juvenile to adult transition may not fully occur in an aquarium.[citation needed] Not only does their coloration change with maturity, but during mating events as well. The mask of a male will turn a dark blue, almost black, while the female will turn a bland color.

Reproduction Mechanisms[edit]

At dusk, a pair of emperor angelfish will rush to the surface, away from the reef, to mate in area where fertilized eggs can be taken away on currents, and then they then scurry back down to the reef. This mechanism not only prevents egg-eating predators from seeing their release, but the eggs are now able to disperse in areas where new populations of emperor angelfish can form. This trade-off between parental investment and fecundity allows for maximum fitness of this species.

Diet[edit]

Emperor angelfish are omnivorous, feeding on both small invertebrates and plants. Sponges and algae are their primary diet. They have bulky, strong jaws that are able to chew up the sponges, which are made up of tiny, needle-like pieces of silica (this would be the equivalent of a human chewing on small shards of glass). The digestive tract of an emperor angelfish coats its food with a layer of mucus in order to further protect itself from the sharp silica.

References[edit]

 Oregon Coast Aquarium: Emperor Angelfish. http://aquarium.org/exhibits/sea-me/animals/emperor-angelfish (accessed Feb 18, 2014) Pyle R, Rocha LA, & Craig MT. Pomacanthus imperator. http://www.iucnredlist.org/details/165862/0 (accessed Feb 18, 2014) Schofield, Pamela. Pomacanthus imperator. http://nas.er.usgs.gov/queries/FactSheet.aspx?speciesID=2294 (accessed Feb 18, 2014) Pyle R, Rocha LA, & Craig MT. Pomacanthus imperator. http://www.iucnredlist.org/details/165862/0 (accessed Feb 18, 2014) Agustin, Liza. Pomacanthus imperator. http://www.fishbase.org/summary/6504 (accessed Feb 18, 2014) National Aquarium: Emperor Angelfish. http://aqua.org/explore/animals/emperor-angelfish (accessed Feb 18, 2014) Dive Gallery. http://www.divegallery.com/angelfish_emperor.htm (accessed Feb 18, 2014) Explorer’s Guide: Emperor Angelfish. http://sea.sheddaquarium.org/sea/fact_sheets.asp?id=100 (accessed Feb 18, 2014) Explorer’s Guide: Emperor Angelfish. http://sea.sheddaquarium.org/sea/fact_sheets.asp?id=100 (accessed Feb 18, 2014)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!