Overview

Comprehensive Description

Biology

Common inshore, in tide pools or shallow rocky areas, from the intertidal zone to 24 m depth. May remain out of water under rocks or seaweed (Ref. 31184). Feeds mainly on crustaceans and algae. Breathes air (Ref. 31184) and can remain out of water for 15-35 hours if kept moist (Ref. 51276). Demersal spawners in nearshore habitats (Ref. 56049). Oviparous (Ref. 205). Commonly caught by 'poke-poling', a method using a long bamboo pole with a very short wire leader and baited hook. Good eating.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern North Pacific: Oregon to northern Baja California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: southern Oregon, USA to northern central Baja California, Mexico; rare south of Point Conception, California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 18 years (Ref. 43439)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Apodichthys violaceus Girard
Catalog Number: USNM 499
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Trowbridge
Locality: San Luis Obispo, Cal., California, United States, Pacific
  • Type: Girard, C. F. 1854. Proceedings of the Academy of Natural Sciences of Philadelphia. 7: 150.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory (Ref. 43439); marine; depth range 0 - 24 m (Ref. 51666), usually 0 - 1 m (Ref. 43439)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.5 - 1.22

Graphical representation

Depth range (m): 0.5 - 1.22
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common inshore, in tide pools or shallow rocky areas, from the intertidal zone to 24 m depth. May remain out of water under rocks or seaweed (Ref. 31184). Feeds mainly on crustaceans and algae. Breathes air (Ref. 31184) and can remain out of water for 15-35 hours if kept moist (Ref. 51276). At somewhere between 5 and 8 cm TL, they shift their diets and feed absolutely on algae, preferring reds and greens (Ref. 43439). Predation by early juvenile fishes on water-column planktors was greatest following initial intertidal settlement and habitat establishment (Ref. 41810). Greater dependence on substrate-oriented and/or benthic prey was exhibited as the fish grew in size (Ref. 41810).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205). Nests in crevices (Ref. 205). A parent coils about the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cebidichthys violaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGCATGAGCCGGAATAGTAGGTACAGCTCTAAGCCTCCTCATTCGGGCAGAGCTAAGCCAACCCGGCGCCCTCTTAGGCGACGATCAAATTTACAACGTAATTGTCACGGCACATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGGCTTATTCCCTTAATGATCGGGGCCCCAGATATGGCGTTCCCTCGAATGAACAACATGAGTTTTTGACTTCTCCCTCCTTCTTTCCTTCTCCTACTAGCATCTTCTGGTGTAGAAGCAGGTGCTGGAACGGGATGAACAGTTTACCCTCCCCTCTCTGGCAACCTAGCGCATGCGGGAGCCTCTGTTGATCTAACAATCTTTTCTCTCCACTTGGCAGGTATTTCTTCAATCCTTGGGGCAATTAACTTCATTACAACTATTATTAACATGAAACCCCCGGCCATTTCTCAGTACCAAACACCCCTGTTCGTATGATCAGTACTTATTACTGCCGTCTTACTACTTCTTTCCCTCCCTGTCCTTGCAGCTGGTATCACTATGCTTCTAACAGATCGAAATCTTAACACCACCTTCTTCGACCCGGCCGGAGGAGGAGACCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cebidichthys violaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; gamefish: yes; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Monkeyface prickleback

The Monkeyface Prickleback (Cebidichthys violaceus), also commonly known as the Monkeyface eel, is a species of prickleback native to the Pacific coast of North America. Despite being commonly called an eel due to its body shape, it does not fall into the fish order Anguilliformes with true eels, but the Perciformes along with most bony fishes.

Contents

Ecology

Ranging from southern Oregon down to the northern reaches of the Mexican state of Baja California, Monkeyface Pricklebacks are coastal fish that live in rocky, tidal areas close to shore. First described by Girard in 1854,[1] the fish spawn on the sea floor and show some nest guarding behavior. While young Monkeyface Pricklebacks feed on zooplanktons and crustaceans, adults are primarily herbivorous, feeding red and green algae. Adults have few predators other than humans, but young fish are vulnerable to birds and other fish, such as Grass rockfish.[2] The species reaches a general maximum size of 2.4 feet and may live up to 18 years.[3] The heaviest Monkeyface Prickleback recorded to date was just over six pounds.[4]

Fishery

Monkeyface Pricklebacks have long been sought after for their edible white flesh, with remains found in the middens of Native American peoples along the California coast.[2] In the modern era, the fish's appeal is and has always been mostly among amateur anglers. The most common method of acquiring it is "poke poling": a technique involving a long bamboo rod and a baited hook stuck into the crevices where Monkeyface Prickleback are known to hide.[3]

In 2012, a fad for Monkeyface eel in restaurants of the San Francisco Bay Area has spawned a tiny commercial fishery, mostly spurred by local foragers interested in catch that is unusual and less heavily fished.[5]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!