Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Comprehensive Description

Biology

An experimental fish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Central America: endemic to central highlands of Mexico (Jalisco, Guanajuato, Michoacán, Aguascalientes).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pacific Slope of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 65 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

6.5 cm TL (male/unsexed; (Ref. 6398))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Fundulus dugesii Bean
Catalog Number: USNM 37831
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): P. Duges
Locality: Mexico, North America
  • Syntype: Bean, T. H. 1887. Proceedings of the United States National Museum. 10 (637): 373, pl.20, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Allotoca dugesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATTTAGTATTTGGTGCCTGAGCCGGCATAGTTGGCACTGCCTTAAGCCTTCTTATTCGAGCTGAATTAAGTCAGCCGGGCTCTCTTCTAGGTGAT---GATCAAATTTATAACGTGATCGTGACAGCTCACGCTTTCGTCATAATCTTTTTTATAGTAATACCTATTATAATTGGTGGTTTCGGTAACTGATTAATTCCCCTTATAATTGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGCTTCTGACTCCTCCCCCCATCATTCCTACTACTTCTAGCATCCTCTGGAGTTGAAGCAGGTGCCGGAACCGGTTGAACTGTTTATCCTCCACTCGCAGGAAACCTAGCCCATGCAGGAGCCTCCGTAGACTTAACCATTTTTTCTCTACATTTAGCAGGAGTATCATCTATTCTGGGTGCTATTAATTTCATCACAACAATTATTAACATAAAACCTCCAGCAACTTCACAATACCAAACACCCCTGTTTGTATGAGCTGTTTTAATTACAGCTGTACTCCTTCTTCTCTCCCTTCCGGTTTTAGCCGCTGGTATTACTATGCTTTTAACTGATCGTAATCTAAACACTACCTTTTTTGACCCGGCAGGTGGCGGTGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Allotoca dugesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!