Articles on this page are available in 1 other language: Spanish (10) (learn more)
Overview
Comprehensive Description
Biology
An experimental fish.
-
Lyons, J., G. González-Hernandéz, E. Soto-Galera and M. Guzmán-Arroyo 1998 Decline of freshwater fishes and fisheries in selected drainages of west-central Mexico. Fisheries 23(4):10-18. (Ref. 27639)
http://www.fishbase.org/references/FBRefSummary.php?id=27639&speccode=11933
Trusted
Distribution
Central America: endemic to central highlands of Mexico (Jalisco, Guanajuato, Michoacán, Aguascalientes).
-
Lyons, J., G. González-Hernandéz, E. Soto-Galera and M. Guzmán-Arroyo 1998 Decline of freshwater fishes and fisheries in selected drainages of west-central Mexico. Fisheries 23(4):10-18. (Ref. 27639)
http://www.fishbase.org/references/FBRefSummary.php?id=27639&speccode=11933
Trusted
Physical Description
Size
Max. size
6.5 cm TL (male/unsexed; (Ref. 6398))
-
Axelrod, H.R., W.E. Burgess, N. Pronek and J.G. Walls 1991 Dr. Axelrod's Atlas of freshwater aquarium fishes. Sixth edition. T.F.H. Publications, Neptune City, New Jersey.
http://www.fishbase.org/references/FBRefSummary.php?id=6398
Trusted
Type Information
Syntype for Fundulus dugesii Bean
Catalog Number: USNM 37831
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): P. Duges
Locality: Mexico, North America
Catalog Number: USNM 37831
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): P. Duges
Locality: Mexico, North America
- Syntype: Bean, T. H. 1887. Proceedings of the United States National Museum. 10 (637): 373, pl.20, fig. 5.
Trusted
Ecology
Habitat
Molecular Biology and Genetics
Molecular Biology
Barcode data: Allotoca dugesii
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TATTTAGTATTTGGTGCCTGAGCCGGCATAGTTGGCACTGCCTTAAGCCTTCTTATTCGAGCTGAATTAAGTCAGCCGGGCTCTCTTCTAGGTGAT---GATCAAATTTATAACGTGATCGTGACAGCTCACGCTTTCGTCATAATCTTTTTTATAGTAATACCTATTATAATTGGTGGTTTCGGTAACTGATTAATTCCCCTTATAATTGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGCTTCTGACTCCTCCCCCCATCATTCCTACTACTTCTAGCATCCTCTGGAGTTGAAGCAGGTGCCGGAACCGGTTGAACTGTTTATCCTCCACTCGCAGGAAACCTAGCCCATGCAGGAGCCTCCGTAGACTTAACCATTTTTTCTCTACATTTAGCAGGAGTATCATCTATTCTGGGTGCTATTAATTTCATCACAACAATTATTAACATAAAACCTCCAGCAACTTCACAATACCAAACACCCCTGTTTGTATGAGCTGTTTTAATTACAGCTGTACTCCTTCTTCTCTCCCTTCCGGTTTTAGCCGCTGGTATTACTATGCTTTTAACTGATCGTAATCTAAACACTACCTTTTTTGACCCGGCAGGTGGCGGTGAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Allotoca dugesii
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


