Overview

Comprehensive Description

Lutjanus analis :

MZUSP 66038 (1, 90.2), SãoSebastião ( 23°49’S , 45°25’W ), São Paulo State , Brazil .

  • Rodrigo L. Moura, Kenyon C. Lindeman (2007): A new species of snapper (Perciformes: Lutjanidae) from Brazil, with comments on the distribution of Lutjanus griseus and L. apodus. Zootaxa 1422, 31-43: 32-32, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:EDE9214C-AABF-4706-AA56-C303C37A6B3C
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Body wide and relatively thick with a sloping forehead and a large round eye and large terminal mouth. Dorsal-fin base long and anal-fin base short. Prominent stout dorsal, anal, and pelvic-fin spines and a large non-serrated preopercular spine.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs in continental shelf areas as well as clear waters around islands (Ref. 5217). Large adults usually among rocks and coral while juveniles occur over sandy, vegetated (usually Thalassia) bottoms (Ref. 5217). Forms small aggregations which disband during the night (Ref. 55). Feeds both day and night on fishes, shrimps, crabs, cephalopods, and gastropods (Ref. 55). Flesh considered good quality (Ref. 55). Marketed mainly fresh or frozen (Ref. 55). Traded as an aquarium fish at Clara, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lutjanus analis is a deep-bodied and compressed snapper that may reach lengths of 30 - 77 cm (1 - 2.5 feet). It is common in inland and nearshore waters to approximately 6.8 kg (15 pounds). The dorsal fin is continuous with 9 - 11 (usually 10) slender dorsal spines, the fourth of which is the longest. The angulate soft dorsal fin has 13-14 rays. The caudal fin is deeply emarginate. The anal fin is pointed and has 3 spines, the second and third equal in length, and 8 anal rays.The pectoral fins are long, reaching past the anus.Scales are small and ctenoid, with 47-51 lateral lines scales. There are 12-13 gill rakers on the lower limb of the gill arch. The head profile is steep and straight to the tip of the snout. The eyes are small. The mouth is large and terminal, with the maxilla just reaching the front of the orbit. The upper and lower jaws, as well as the vomer have bands of villiform teeth. In addition, the upper jaw has 6 canine teeth, 4 of which are enlarged. The preopercule is coarsely serrated along its entire edge, and is shallowly notched at the angle. Body color is variable depending upon the activity of the fish. Adults are olive green dorsally, becoming paler laterally and ventrally. The ventral surface is reddish, as are all of the fins.The margin of the caudal fin is black. The snout bears an irregular blue line that reaches the posterior of the eye. A second blue line runs from the maxilla to the eye. A prominent black spot lies above the lateral line below the soft portion of the dorsal fin. When not active, the mutton snapper may evhibit a series of 10-12 dark vertical bars that run the length of the body.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: as far north as Massachusetts, USA, Bermuda and southward to southeastern Brazil; including the Caribbean Sea and the Gulf of Mexico.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and Bermuda (Anderson, pers. comm.) to southeastern Brazil, including the Caribbean Sea and the Gulf of Mexico (Ref. 9626). Most abundant around the Antilles, the Bahamas and off southern Florida.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In the Western Atlantic, ranges from approximately Massachusetts south to Brazil including Bermuda, the Gulf of Mexico, and the Caribbean. It is most abundant off south Florida, the Bahamas, and the Antilles (Allen 1985). Lutjanus analis is common throughout the Indian River Lagoon in seagrass beds, mangrove creeks and canals. Larger fishes and mature adults are generally found in offshore waters.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 850 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

94.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 15.6 kg (Ref. 26340); max. reported age: 29 years (Ref. 46200)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mutton snapper grow to a maximum reported size of 94.0 cm (37 inches) total length (TL) (IGFA 2001) and may weigh as much as 15.6 kg (34.4 pounds). They live as long as 29 years (Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: Modal fin-ray counts of D-X,14 A-III,8 are shared among most of the regional Lutjanus species, including L. analis, L. apodus, L. cyanopterus, L. griseus, L. jocu and the deep-water snappers L. buccanella, L. campechanus, and L. vivanus. L. analis is the only shallow-water snapper with 14 dorsal-fin rays that has a lateral spot as juveniles and adults. (DNA)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preopercular notch and knob weak. Pectoral fins are long, reaching level of anus. Scale rows on back rising obliquely above lateral line. Back and upper sides olive green, whitish with a red tinge on lower sides and belly. A black spot is on the upper back just above the lateral line and below the anterior dorsal fin rays. A pair of blue stripes runs on the snout-cheek region, the upper continuing behind eye to upper opercle edge.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

MZUSP 66038 (1, 90.2), SãoSebastião ( 23°49’S , 45°25’W ), São Paulo State , Brazil .

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Pretransitional mostly-unmarked stage, usually from 13-18 mm SL: Body: A thin line of melanophores develops on each side just below the base of the spinous dorsal fin, from the third to fifth and the sixth to eighth spines (leaving an unpigmented dorsal midline along the base of the fin). The rows continue along the base of the soft dorsal fin on the outer pterygiophore segments and then merge into a single band of melanophores lining the dorsal midline of the caudal peduncle. There are a few deep melanophores at the end of the lateral midline on the caudal peduncle. Along the ventral midline of the caudal peduncle there is a single melanophore just forward of the first procurrent caudal-fin ray, often followed by several more toward the last anal-fin ray. Head: Melanophores on the head consist of a dense patch overlying the brain and on the surface braincase. There are small melanophores at the tip of the upper jaw and a small patch extends upward along the snout. The lower jaw is mostly unmarked, with only a few small melanophores near the tip. The opercular area is covered in iridescence extending down to the pelvic-fin insertion. The inner cleithral surface of the gill cavity is speckled with large melanophores and there are internal melanophores lining the dorsal aspect of the peritoneum extending down to the vent and overlain by a silvery camouflage layer. Fin Spines: The median-fin spines are relatively slender, without prominent internal reticulations and lacking anterior serrations. The second dorsal-fin spine is longer than the third and the subsequent spines are progressively shorter. The second anal-fin spine is only slightly longer than the third and the tip usually does not reach farther back than the tip of the third. Fins: Melanophores are present along most of the length of the membrane just behind the second dorsal-fin spine and then near the outer edges of most of the subsequent membranes of the spinous portion of the dorsal fin. There are melanophores between the bases of the lower central caudal-fin segmented rays and often a few smaller ones between the bases of the lowest upper caudal-fin segmented rays. The anal fins often have no markings but a row of melanophores usually develops during transition (on the membranes near the base of each soft ray). The pelvic fins develop melanophores along the full-length of the first two soft rays and membranes. Pretransitional analogues: Pretransitional larvae (mostly-unmarked, usually from 13-18 mm SL) have relatively slender and smooth dorsal and anal-fin spines, without the prominent internal reticulations and anterior serrations found in L. griseus, L. apodus, and L. jocu. In addition, amongst the regional Lutjanus, only L. analis and L. cyanopterus often have no melanophores along the base of the anal-fin rays before transition. Pretransitional L. analis also share the relatively slender and smooth spines (and snout melanophores) with L. cyanopterus, but can be distinguished by having a distinctly-narrower caudal peduncle, melanophores along the full-length of the pelvic-fin membranes or absent (vs. on the outer third of the longest pelvic-fin membranes), and the tip of the second anal-fin spine is near the tip of the third (vs. the tip of the second usually extending well past the tip of the third in L. cyanopterus).

Transitional stage: Transitional L. analis larvae develop distinct bars of small melanophores slanted down and to the rear. The space between the seven bars is typically iridescent and usually not speckled during transitional stages. A lateral spot then develops in the fourth bar at the level of the lateral line, intensifying within the confines of the bar of melanophores (without expanding the outline of the bar). Transitional analogues: In contrast to transitional L. analis, the bars are vertical in L. apodus, L. jocu, and L. cyanopterus; the bar originating at the mid-soft-dorsal fin slants down to meet the last anal-fin ray in L. analis vs. to the mid-anal fin in the vertically-barred species. Transitional L. analis often do not develop the characteristic lateral spot until past the transitional stage (vs. early and isolated spot appearance in the 12-rayed snappers). When the spot develops, it can be difficult to separate L. analis from L. synagris and L. mahogoni. A reliable difference is in the relative length of the second dorsal-fin spine: well shorter than the third in L. synagris vs. longer or equal in transitional L. analis and L. mahogoni. The marking patterns do diverge as the spot develops: on L. analis recruits the spot notably forms within the bar, without expanding the outline of the bar as it does on the 12-rayed snappers. In addition, on L. synagris the bar forward of the lateral spot is not straight; it clearly curves away and brackets the spot. Transitional L. analis also have three typically distinct bars on the body behind the one with the lateral spot while these bars are usually indistinct on transitional larvae of the others.

Juveniles: Juvenile L. analis have a distinct round lateral spot contained within the confines of a dark bar, with the lateral line usually running through the lower third and more than eight yellow stripes on the body below the lateral line in the bar anterior to the spot. Juvenile analogues: Juvenile L. analis can be separated from the other shallow-water species with bars and a lateral spot by the 14 soft dorsal-fin rays (vs. 12 in L. synagris and L. mahogoni). Larger juveniles of L. analis converge in appearance with the other spotted snappers, often sharing the lateral spot location (spot size and location can be variable), the striping on the side of the body, and even the relative dorsal-fin spine lengths (after 25 mm SL). One of the more reliable methods to distinguish the species as larger juveniles is the number of yellow stripes below the lateral line in the bar anterior to the spot: in L. analis the stripes tend to bifurcate into numerous thin stripes, from 9-12, while in L. synagris the stripes remain thick and number 6-8. L. mahogoni juveniles have inconsistent yellow stripes, but their lateral spot is typically larger and elongated in width compared to that of L. analis. As they get larger L. analis develop a pointed outline to the anal fin while the other species retain a rounded outline.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lutjanus analis is similar to a related species, the lane snapper, L. synagris. The two are differentiated based on the shape of the anal fin: in L. analis the anal fin is pointed, while in L. synagris, it is rounded.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 25 - 95 m (Ref. 9626), usually 40 - 70 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 73 samples.

Environmental ranges
  Depth range (m): 0 - 91
  Temperature range (°C): 23.636 - 28.067
  Nitrate (umol/L): 0.161 - 3.505
  Salinity (PPS): 35.610 - 36.613
  Oxygen (ml/l): 4.179 - 4.855
  Phosphate (umol/l): 0.046 - 0.290
  Silicate (umol/l): 0.756 - 5.080

Graphical representation

Depth range (m): 0 - 91

Temperature range (°C): 23.636 - 28.067

Nitrate (umol/L): 0.161 - 3.505

Salinity (PPS): 35.610 - 36.613

Oxygen (ml/l): 4.179 - 4.855

Phosphate (umol/l): 0.046 - 0.290

Silicate (umol/l): 0.756 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 25 - 95m.
From 25 to 95 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in continental shelf areas as well as clear waters around islands (Ref. 5217). Large adults usually among rocks and coral while juveniles occur over sandy, vegetated (usually Thalassia) bottoms (Ref. 5217). Forms small aggregations which disband during the night (Ref. 55). Feeds both day and night on fishes, shrimps, crabs, cephalopods, and gastropods (Ref. 55) and other benthic organisms (Ref. 26338, 42771). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Most snappers are classified as euryphagic carnivores (Bortone and Williams 1986). In the Caribbean (Randall 1967), crabs made up 44% of the diet, fish (29%), gastropods (13%), with the remainder consisting of octopods, hermit crabs and shrimp (Randall 1967; Allen 1985). Predators:Primary predators of snappers are sharks and other large predatory fishes including other snappers (Bortone and Williams 1986). Habitats: Lutjanus analis adults are typically found at depths of 40 - 59 m (140 - 194 feet) depths (Rivas 1970) where they often form small schools during daylight hours, but disband at night (Allen 1985). Juveniles are most common in inshore waterways (Springer and McErlean 1962) where the substrate consists of sand, seagrasses, or coral rubble (Bortone and Williams 1986). Adults tend to remain in an area once they have become established (Beaumariage 1969; Bortone and Williams 1986) and are most common in the open waters of shelf areas and around islands. Larger adults inhabit coral reefs and rocky, hard bottom areas.Activity Time: Lutjanus analis is active diurnally and nocturnally (Allen 1985; Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

As with most snappers, Lutjanus analis spawns offshore in groups (Wicklund 1969; Thompson and Munro 1974). It matures at approximately 40 - 50 cm (15.7 - 19.6 inches) (Allen 1985). Spawning typically occurs in July and August.Rojas (1960) estimated fecundity in a 512 mm (20.2 inches) fork length (FL) mutton snapper as 1.4 million eggs.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Like many snapper species, eggs are pelagic (Bortone and Williams 1986) and hatch after approximately 20 hours.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus analis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCGCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGGTTCGGGAACTGACTAATCCCATTAATGATCGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCACCATCATTCCTATTGCTACTCGCCTCTTCTGGAGTAGAAGCCGGTGCTGGAACTGGGTGAACAGTTTACCCTCCCCTAGCAGGAAACCTGGCACACGCAGGAGCATCTGTAGACCTAACTATTTTCTCCCTGCATCTAGCGGGTGTCTCCTCAATTCTAGGAGCCATCAACTTCATTACAACAATTATTAATATGAAGCCCCCTGCCATCTCCCAATATCAAACACCGCTATTCGTTTGAGCCGTCCTAATTACTGCTGTCCTACTTCTTCTCTCCCTACCAGTTCTAGCGGCCGGAATTACAATACTTCTYACAGACCGAAATCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTTTACCAACACCTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus analis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d, B1+2e

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Huntsman, G.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Vulnerable (VU) (A2d, B1+2e)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; aquarium: commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fisheries Importance:COMMERCIAL FISHERY: The commercial fishery for mutton snapper is not of particularly high value in east central Florida, averaging less than $11,000 per year. The statewide commercial catch of gray snapper, Lutjanus analis, between the years 1987 - 2001 was 5.5 million pounds, with a dollar value of over $9.6 million. Within this time period however, only 92,189 pounds of mutton snapper was harvested commercially in the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties), with a dollar value of just $163,205 reported. This ranks the mutton snapper sixty-fourth in commercial value within the IRL, and seventy-fifth in pounds harvested.Figure 1 below shows the dollar value of the commercial mutton snapper fishery to IRL counties by year. As shown, the commercial catch ranged from a low of $5,647 in 1989 to a high of over $22,251 the next year, 1990. Volusia County accounts for the largest percentage of the gray snapper catch with 37.3% in total (Figure 2), most of which was accounted for by the large catch in 1990. Martin County follows with 23% of the harvest, followed by St. Lucie, Brevard and Indian River Counties, which account for 19.5%, 13.7% and 6.5% of the total respectively. Of note are 2 particularly good harvests in Volusia County occurring in 1990 and 1998 which account for 65% and 61% of the annual catch respectively.RECREATIONAL FISHERY: The information below reflects angler survey information taken from the 5-county area that encompasses the Indian River Lagoon. Approximately 460,226 mutton snapper were harvested in east central Florida from 1997 - 2001. The bulk of the recreational harvest was taken in nearshore waters to 3 miles (43.9%) and in offshore waters to 200 miles (40.0%). Inland waters other than the Indian River Lagoon, and the IRL itself account for only 8.5% and 7.6% respectively.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mutton snapper

The mutton snapper, Lutjanus analis, is a species of snapper native to the Atlantic coastal waters of the Americas from Massachusetts to southern Brazil, including the Caribbean Sea and the Gulf of Mexico. They are particularly common in the Caribbean. They inhabit reef environments, with adults found in areas with rock or coral, while juveniles occur in sandy habitats with plentiful weed growth. They can be found at depths of from 25 to 90 m (82 to 295 ft), though most often between 40 and 70 m (130 and 230 ft). They have olive-tinted backs and red sides with a black spot between the lateral line and the dorsal fin and blue stripes on the head. This species can reach a length of 94 cm (37 in), though most do not exceed 50 cm (20 in). The greatest known weight recorded for this species is 15.6 kg (34 lb). This is a commercially important species and is also sought-after as a game fish. It can also be found in the aquarium trade.[2]

Mutton snapper are a highly prized fish by saltwater anglers; they can be caught on a variety of baits, but are most commonly caught on live or frozen shrimp, whole or cut squid, minnows, and smaller bait fish (such as live or dead pinfish). Mutton snapper have been caught on artificial baits, but seem to prefer live bait. They can generally be found in deeper water, although catches (generally of juveniles and smaller fish) are not uncommon in more shallow water. They are also caught on the surface during night-fishing expeditions. Mutton snapper are typically known as great fighters relative to other snapper species, so are harder to land on lighter tackle. Many are often landed as a bycatch of anglers targeting other species of snapper or grouper.

Mutton snapper, especially adults, tend to be solitary, but can be seen in smaller schools. Their flesh is considered by most as excellent table fare. Like most of the snapper family, the meat is white, flaky, and light, and is excellent prepared in a variety of ways.

References[edit]

  1. ^ Huntsman, G. 1996. Lutjanus analis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.2. <www.iucnredlist.org>. Downloaded on 12 January 2014.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Lutjanus analis" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!