Overview

Comprehensive Description

Biology

Occurs in continental shelf areas as well as clear waters around islands (Ref. 5217). Large adults usually among rocks and coral while juveniles occur over sandy, vegetated (usually Thalassia) bottoms (Ref. 5217). Forms small aggregations which disband during the night (Ref. 55). Feeds both day and night on fishes, shrimps, crabs, cephalopods, and gastropods (Ref. 55). Flesh considered good quality (Ref. 55). Marketed mainly fresh or frozen (Ref. 55). Traded as an aquarium fish at Clara, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lutjanus analis is a deep-bodied and compressed snapper that may reach lengths of 30 - 77 cm (1 - 2.5 feet). It is common in inland and nearshore waters to approximately 6.8 kg (15 pounds). The dorsal fin is continuous with 9 - 11 (usually 10) slender dorsal spines, the fourth of which is the longest. The angulate soft dorsal fin has 13-14 rays. The caudal fin is deeply emarginate. The anal fin is pointed and has 3 spines, the second and third equal in length, and 8 anal rays.The pectoral fins are long, reaching past the anus.Scales are small and ctenoid, with 47-51 lateral lines scales. There are 12-13 gill rakers on the lower limb of the gill arch. The head profile is steep and straight to the tip of the snout. The eyes are small. The mouth is large and terminal, with the maxilla just reaching the front of the orbit. The upper and lower jaws, as well as the vomer have bands of villiform teeth. In addition, the upper jaw has 6 canine teeth, 4 of which are enlarged. The preopercule is coarsely serrated along its entire edge, and is shallowly notched at the angle. Body color is variable depending upon the activity of the fish. Adults are olive green dorsally, becoming paler laterally and ventrally. The ventral surface is reddish, as are all of the fins.The margin of the caudal fin is black. The snout bears an irregular blue line that reaches the posterior of the eye. A second blue line runs from the maxilla to the eye. A prominent black spot lies above the lateral line below the soft portion of the dorsal fin. When not active, the mutton snapper may evhibit a series of 10-12 dark vertical bars that run the length of the body.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Massachusetts, USA and Bermuda (Anderson, pers. comm.) to southeastern Brazil, including the Caribbean Sea and the Gulf of Mexico (Ref. 9626). Most abundant around the Antilles, the Bahamas and off southern Florida.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: as far north as Massachusetts, USA, Bermuda and southward to southeastern Brazil; including the Caribbean Sea and the Gulf of Mexico.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the Western Atlantic, ranges from approximately Massachusetts south to Brazil including Bermuda, the Gulf of Mexico, and the Caribbean. It is most abundant off south Florida, the Bahamas, and the Antilles (Allen 1985). Lutjanus analis is common throughout the Indian River Lagoon in seagrass beds, mangrove creeks and canals. Larger fishes and mature adults are generally found in offshore waters.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 11; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 850 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

94.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 15.6 kg (Ref. 26340); max. reported age: 29 years (Ref. 46200)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mutton snapper grow to a maximum reported size of 94.0 cm (37 inches) total length (TL) (IGFA 2001) and may weigh as much as 15.6 kg (34.4 pounds). They live as long as 29 years (Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Preopercular notch and knob weak. Pectoral fins are long, reaching level of anus. Scale rows on back rising obliquely above lateral line. Back and upper sides olive green, whitish with a red tinge on lower sides and belly. A black spot is on the upper back just above the lateral line and below the anterior dorsal fin rays. A pair of blue stripes runs on the snout-cheek region, the upper continuing behind eye to upper opercle edge.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

MZUSP 66038 (1, 90.2), SãoSebastião ( 23°49’S , 45°25’W ), São Paulo State , Brazil .

License not applicable

Rodrigo L. Moura

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Lutjanus analis is similar to a related species, the lane snapper, L. synagris. The two are differentiated based on the shape of the anal fin: in L. analis the anal fin is pointed, while in L. synagris, it is rounded.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 25 - 95 m (Ref. 9626), usually 40 - 70 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 73 samples.

Environmental ranges
  Depth range (m): 0 - 91
  Temperature range (°C): 23.636 - 28.067
  Nitrate (umol/L): 0.161 - 3.505
  Salinity (PPS): 35.610 - 36.613
  Oxygen (ml/l): 4.179 - 4.855
  Phosphate (umol/l): 0.046 - 0.290
  Silicate (umol/l): 0.756 - 5.080

Graphical representation

Depth range (m): 0 - 91

Temperature range (°C): 23.636 - 28.067

Nitrate (umol/L): 0.161 - 3.505

Salinity (PPS): 35.610 - 36.613

Oxygen (ml/l): 4.179 - 4.855

Phosphate (umol/l): 0.046 - 0.290

Silicate (umol/l): 0.756 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 95m.
From 25 to 95 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in continental shelf areas as well as clear waters around islands (Ref. 5217). Large adults usually among rocks and coral while juveniles occur over sandy, vegetated (usually Thalassia) bottoms (Ref. 5217). Forms small aggregations which disband during the night (Ref. 55). Feeds both day and night on fishes, shrimps, crabs, cephalopods, and gastropods (Ref. 55) and other benthic organisms (Ref. 26338, 42771). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Most snappers are classified as euryphagic carnivores (Bortone and Williams 1986). In the Caribbean (Randall 1967), crabs made up 44% of the diet, fish (29%), gastropods (13%), with the remainder consisting of octopods, hermit crabs and shrimp (Randall 1967; Allen 1985). Predators:Primary predators of snappers are sharks and other large predatory fishes including other snappers (Bortone and Williams 1986). Habitats: Lutjanus analis adults are typically found at depths of 40 - 59 m (140 - 194 feet) depths (Rivas 1970) where they often form small schools during daylight hours, but disband at night (Allen 1985). Juveniles are most common in inshore waterways (Springer and McErlean 1962) where the substrate consists of sand, seagrasses, or coral rubble (Bortone and Williams 1986). Adults tend to remain in an area once they have become established (Beaumariage 1969; Bortone and Williams 1986) and are most common in the open waters of shelf areas and around islands. Larger adults inhabit coral reefs and rocky, hard bottom areas.Activity Time: Lutjanus analis is active diurnally and nocturnally (Allen 1985; Bortone and Williams 1986).
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

As with most snappers, Lutjanus analis spawns offshore in groups (Wicklund 1969; Thompson and Munro 1974). It matures at approximately 40 - 50 cm (15.7 - 19.6 inches) (Allen 1985). Spawning typically occurs in July and August.Rojas (1960) estimated fecundity in a 512 mm (20.2 inches) fork length (FL) mutton snapper as 1.4 million eggs.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Like many snapper species, eggs are pelagic (Bortone and Williams 1986) and hatch after approximately 20 hours.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus analis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCGCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGGTTCGGGAACTGACTAATCCCATTAATGATCGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCACCATCATTCCTATTGCTACTCGCCTCTTCTGGAGTAGAAGCCGGTGCTGGAACTGGGTGAACAGTTTACCCTCCCCTAGCAGGAAACCTGGCACACGCAGGAGCATCTGTAGACCTAACTATTTTCTCCCTGCATCTAGCGGGTGTCTCCTCAATTCTAGGAGCCATCAACTTCATTACAACAATTATTAATATGAAGCCCCCTGCCATCTCCCAATATCAAACACCGCTATTCGTTTGAGCCGTCCTAATTACTGCTGTCCTACTTCTTCTCTCCCTACCAGTTCTAGCGGCCGGAATTACAATACTTCTYACAGACCGAAATCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTTTACCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus analis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d, B1+2e

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Huntsman, G.

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2d, B1+2e)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; aquarium: commercial; price category: high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fisheries Importance:COMMERCIAL FISHERY: The commercial fishery for mutton snapper is not of particularly high value in east central Florida, averaging less than $11,000 per year. The statewide commercial catch of gray snapper, Lutjanus analis, between the years 1987 - 2001 was 5.5 million pounds, with a dollar value of over $9.6 million. Within this time period however, only 92,189 pounds of mutton snapper was harvested commercially in the 5 county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties), with a dollar value of just $163,205 reported. This ranks the mutton snapper sixty-fourth in commercial value within the IRL, and seventy-fifth in pounds harvested.Figure 1 below shows the dollar value of the commercial mutton snapper fishery to IRL counties by year. As shown, the commercial catch ranged from a low of $5,647 in 1989 to a high of over $22,251 the next year, 1990. Volusia County accounts for the largest percentage of the gray snapper catch with 37.3% in total (Figure 2), most of which was accounted for by the large catch in 1990. Martin County follows with 23% of the harvest, followed by St. Lucie, Brevard and Indian River Counties, which account for 19.5%, 13.7% and 6.5% of the total respectively. Of note are 2 particularly good harvests in Volusia County occurring in 1990 and 1998 which account for 65% and 61% of the annual catch respectively.RECREATIONAL FISHERY: The information below reflects angler survey information taken from the 5-county area that encompasses the Indian River Lagoon. Approximately 460,226 mutton snapper were harvested in east central Florida from 1997 - 2001. The bulk of the recreational harvest was taken in nearshore waters to 3 miles (43.9%) and in offshore waters to 200 miles (40.0%). Inland waters other than the Indian River Lagoon, and the IRL itself account for only 8.5% and 7.6% respectively.
  • Allen, G. R. 1985. Snappers of the World: An Annotated and Illustrated Catalogueof Lutjanid Species Known to Date. FAO Fisheries Synopsis, no. 125, vol. 6.Food and Agriculture Organization of the United Nations, Rome, Italy.ISBN/ISSN: 92-5-102321-2.
  • Anderson, W. D., Jr. 1967. Field guide to the snappers (Lutjanidae) of the westernAtlantic. U.S. Fish Wildl. Serv. Circ. 252.
  • Beaumariage, D.S. 1969. Returns from the 1965 Schlitz tagging program includinga cumulative analysis of previous results. Fla. Dep. Nat. Resour. Tech. Ser. No.59:1-38.
  • Bortone, S.A., and J.L. Williams. 1986. Species profiles: life histories andenvironmental requirements of coastal fishes and invertebrates (South Florida)--gray, lane, mutton, and yellowtail snappers. U.S. Fish Wildl. Serv. Biol. Rep.82(11.52). U.S. Army Corps of Engineers, TR EL-82-4.
  • Erdman, D.S. 1976. Spawning patterns of fishes from the northeastern Caribbean. Agric. Fish. Contrib. Dep. Agric. (Puerto Rico) 8(2):1-36.
  • IGFA, 2001 Database of IGFA angling records until 2001. IGFA, FortLauderdale, USA.Manooch, C.S., 1987 Age and growth of snappers and groupers. p. 329-373. In J.J. Polovina and S. Ralston (eds.) Tropical snappers and groupers: biology andfisheries management. Ocean Resour. Mar. Policy Ser. Westview Press, Inc.,Boulder and London.
  • Mason, D.L. and C.S. Manooch, III, 1985 Age and growth of mutton snapperalong the east coast of Florida. Fish. Res. 3:93-104.
  • Randall, J.E., 1968 Caribbean reef fishes. T.F.H. Publications, Inc. Ltd., HongKong. 318 p.Rivas, L.R. 1970. Snappers of the Western Atlantic. Commer. Fish. Rev. 32(1):41-44.
  • Rojas, L.E. 1960. Estudios estadisticos y biologicos sobre pargo criollo, Lutjanusanalis. Cent. Invest. Pesq. Cuba. Nota 2:1-16.
  • Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishesof the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.Alfred A. Knopf, Inc., New York. 720 p.
  • Springer, V.G., and A.J. McErlean.1962. Seasonality of fishes on a south Florida shore. Bull. Mar. Sci. 12(l): 39-60.
  • Thompson, M., and J.L. Munro. 1974. The biology, ecology, exploitation andmanagement of Caribbean reef fishes; scientific report of the O.D.S./U.W.I.fisheries. Ecology Research Project 1969-1973. Part V. The biology, ecologyand bionomics of Caribbean reef fishes: V.D. Lutjanidae (snappers). Zool. Dep.Univ. West Indies, Kingston, Jamaica. Res. Rep. 3:1-69.
  • Thompson, R. and J.L. Munro. 1983. The biology, ecology and bionomics ofCaribbean reef fishes: Lutjanidae (snappers). p. 94-109. In: J.L. Munro (ed.)Caribbean coral reef fishery resources. ICLARM Stud. Rev 7.
  • Wicklund, R. 1969. Observations on spawning of lane snapper. Underwater Nat.6(2):40.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mutton snapper

The mutton snapper (Lutjanus analis) is a fish of the Lutjanidae family. Largely a Caribbean species, they can be found from North Carolina to South America. They prefer low-relief reef structure searching for fishes, shrimps, crabs, squid, and snails. In the Florida Keys, they may be encountered in shallow water, over coralline bottom. In that habitat, they are very colorful with olive-tinted backs and red sides. In deeper water, they can easily be mistaken for red snapper (L. campechanus). Also a favorite of spear fishermen, the mutton snapper is an often difficult target, as they do not allow close approach.

Mutton snapper are a highly prized fish by saltwater anglers; they can be caught on a variety of baits, but are most commonly caught on live or frozen shrimp, whole or cut squid, minnows, and smaller bait fish (such as live or dead pinfish). Mutton snapper have been caught on artificial baits, but seem to prefer live bait. They can generally be found in deeper (50 to 200 ft or deeper) water, although catches (generally of juveniles and smaller fish) are not uncommon in more shallow water. They are also caught on the surface during night-fishing expeditions. Mutton snapper are typically known as great fighters relative to other snapper species, so are harder to land on lighter tackle. Many are often landed as a "bycatch" of anglers targeting other species of snapper or grouper.

Mutton snapper, especially adults, tend to be solitary, but can be seen in smaller schools. Their flesh is considered by most as excellent table fare. Like most of the snapper family, the meat is white, flaky and light; and is excellent prepared in a variety of ways.

Source

Notes

[1]

  1. ^ Mutton snapper, caught in 100 ft of water off Juno Beach, FL
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!