Overview

Comprehensive Description

Biology

Inhabit clear, gravelly flowing pools and runs of creeks and small to medium rivers (Ref. 6465); also found in streams, lakes and reservoirs (Ref. 10294). Juveniles feed on small crustaceans and midge larvae while adults eat insects, larger crustaceans, frogs, worms, grubs and small fish (Ref. 6465, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America: Mississippi River basin from southern Ohio and West Virginia to southeastern Kansas, and south to the Gulf of Mexico, USA; Gulf Slope drainages from Chattahoochee in Georgia to Guadalupe River in Texas, USA. Introduced in southern Africa and has become established in several isolated water bodies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native throughout central and lower Mississippi River basin from southern Ohio and West Virginia to southeastern Kansas and south to the Gulf; Gulf drainages from Chattahoochee River (where possibly introduced), Georgia, to Guadalupe River, Texas; introduced on Atlantic Slope in Virginia and North Carolina, in lower Pecos River, New Mexico, and Consummes and Feather rivers, California (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in the U.S.A., also introduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 610 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

63.5 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 4,650 g (Ref. 40637); max. reported age: 7 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 35 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Small clear creeks with moderate to swift current and gravel to coarse sand substrate; moderate size, clear, low gradient sections of rivers with gravel substrate; and reservoirs (especially large deep oligotrophic ones). Secretive pool dweller in streams; in reservoirs adults mostly in deeper water, young near shore. After leaving nest, juveniles usually in schools in backwater or cove areas near cover (Sublette et al. 1990). Eggs are laid in a nest made by the male on bottoms ranging from mud to gravel in low-current areas (Moyle 1976), at depths averaging 1.5-6.7 m in reservoirs, 33-73 cm in streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Each adult frequently remains in one limited area for most of year, such as single stream pool, but spawning migrations are common in spring (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Juveniles feed initially on zooplankton; larger individuals eat crayfishes, aquatic insects, and small fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Adults may stay in single stream pool for most of year (Moyle 1976). Juveniles swim in schools that disperse when fishes are about 30 mm long.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeding activity mainly crepuscular.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Assuming same reproductive mode as M. dolomieu.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns in late spring; eggs hatch in about 5 days at 14-16 C; sexually mature in 2nd or 3rd year; male guards eggs and hatchlings (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micropterus punctulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTGAGCCTGCTAATTCGTGCAGAACTAAGCCAGCCCGGCGCTCTTCTAGGGGATGACCAGATCTACAATGTAATTGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGCTTTGGCAACTGACTTATCCCCCTAATGATCGGTGCCCCCGACATAGCATTCCCTCGAATAAACAACATAAGCTTTTGGCTTCTTCCCCCATCTTTCCTTCTCCTGCTCGCCTCTTCCGGGGTCGAAGCTGGAGCTGGCACTGGGTGAACTGTCTACCCCCCTCTTGCCGGCAACCTGGCCCATGCAGGAGCATCCGTTGACCTAACCATCTTCTCTCTTCATCTTGCGGGTGTCTCCTCCATCCTAGGGGCCATCAATTTTATTACCACAATTATTAATATAAAACCCCCAGCTATTTCCCAGTATCAGACACCCTTGTTTGTTTGGTCCGTCTTAATTACTGCCGTCCTACTCCTTTTATCGCTCCCAGTCCTCGCTGCTGGCATTACAATGCTCCTTACGGATCGAAACCTCAACACCACCTTCTTTGACCCCGCAGGAGGGGGAGACCCCATTCTCTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Micropterus punctulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spotted bass

The spotted bass (Micropterus punctulatus), also called "Spotty", "Leeman", or "Spots" in various fishing communities, is a species of freshwater fish sunfish family (Centrarchidae) of order Perciformes. One of the black basses, it is native to the Mississippi River basin and across the Gulf States, from central Texas through the Florida panhandle. Its native range extends into the western Mid-Atlantic States and it has been introduced into western North Carolina and Virginia. It has also been introduced to southern Africa, where it has become established in some isolated waters. It is often mistaken with the similar and more common largemouth bass.

A convenient way to distinguish between a largemouth bass and a spotted bass is by the size of the mouth. A spotted bass will resemble a largemouth bass in coloration but will have a smaller mouth.

M. punctulatus can reach an overall length of almost 64 centimetres (25 in), reaching weights of up to 4.6 kilograms (10 lb). It can reach an age of at least seven years. It is noted for the rows of dark spots below the lateral line, which give it its common name.

Preferring cool and warm mountain streams and reservoirs with rocky bottoms, the spotted bass feeds on insects, crustaceans, frogs, annelid worms, and smaller fish.

In 2010 the scientific community officially recognized a separate sub-species of spotted bass, native to the Tallapoosa and Coosa Rivers, and their lakes. This species is commonly known as the "Alabama Spotted Bass" (M. henshalli) and known locally as the "Coosa Spotted Bass", not to be confused with the "Red Eye Coosa Bass" found in north east Georgia.[1]

The Alabama Spotted is highly prized as a gamefish and average size is much larger than the more common Kentucky Spotted Bass. The current record spotted bass was caught in Pine Flat Lake, California and weighed 10.27 lbs. [2]

Typical spotted bass From Tallapoosa River near Tallassee, Alabama (released)

References [edit]

  1. ^ http://www.biggeorgiaspots.com/the-fishes/about-spots/168-nomenclature-of-the-spotted-bass.html
  2. ^ http://www.biggeorgiaspots.com/the-fishes/about-spots/164-state-records-for-spotted-bass.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Has hybridized with smallmouth bass in Missouri (Koppleman, Copeia 1994:204-210). Nominal subspecies wichitae is an invalid taxon (= M. punctulatus, or M. punctulatus X M. dolomieu) (Cofer, Copeia 1995:487-490). See Coughlin et al. (2003, Southwestern Naturalist 48:526-533) for information on the genetic makeup of populations in the Red and Arkansas river basins (including further indication that wichitae does not warrant recognition as a distinct taxon).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!