Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Found in offshore waters; larvae restricted to waters with surface temperatures of 15°C to 30°C (Ref. 6390). Exhibit a strong tendency to school in surface waters with birds, drifting objects, sharks, whales and may show a characteristic behavior like jumping, feeding, foaming, etc. Feed on fishes, crustaceans, cephalopods and mollusks; cannibalism is common. Spawn throughout the year in the tropics, eggs released in several portions (Ref. 35388). Eggs and larvae are pelagic (Ref. 6769). Preyed upon by large pelagic fishes (Ref. 6885). Also taken by trolling on light tackle using plugs, spoons, feathers, or strip bait (Ref. 9684). Marketed fresh, frozen or canned (Ref. 9340); also dried-salted and smoked (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Common names: tuna (English), barrilete (Espanol)
 
Katsuwonus pelamis (Linnaeus, 1758)


Skipjack tuna


Elongate, fusiform, no fatty eyelid; jaw teeth slender, conical; top of tongue with 2 ridges; gill rakers 53-63; 2 dorsal fins barely separated; XIV-XVI spines on 1st  dorsal, front spines relatively tall; 7-9 finlets after 2nd  dorsal and anal fins; short, V shaped bony process between pelvic fins; 1 lateral line; 2 small + 1 large keels on tail base; well developed corselet of scales on front of body.



Dark purplish blue on back; lower sides and belly silvery, with 4-6 conspicuous wavy stripes or discontinuous lines of dark blotches.


Size: attains 120 cm; all-tackle world record 18.9 Kg.

Habitat: oceanic pelagic.

Depth: 0-260 m.

Circumglobal in seas warmer than about 15°C; southern California to the mouth of the Gulf of California to Chile and the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 2 people

Average rating: 3.5 of 5

Distribution

Aldabra, Azores, Azores Exclusive Economic Zone, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Chagos, Coastal Waters of Southeast Alaska and British Columbia, Comores, Djibouti, Eritrea, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, Portuguese Exclusive Economic Zone, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan in tropical and warm-temperate waters. Not found in the eastern Mediterranean Sea (Ref. 28950) and the Black Sea. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is circumglobal in seas warmer than 15°C. In the Eastern Pacific it occurs from British Columbia to northern Chile, including all of the oceanic islands. It occurs in the Mediterranean but is not found in the eastern Mediterranean Sea or the Black Sea. It is found throughout the warm Atlantic, including the Caribbean and the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Skipjack tuna, Katsuwonus pelamis, are marine fishes found in most waters all over the world but are rarely seen in the North Sea and have never been caught in the Black Sea. Skipjacks are confined to waters with temperatures above 15 degrees C.

Distribution map.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Muus, B., J. Nielsen. 1999. Sea Fish. Denmark: Scandanavian Fishing Year Book.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

cosmopolitan in tropical and warm-temperate waters, as far north as 40.87°N
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas, including Mediterranean Sea, Red Sea, Mascarenes, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 260 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14 - 16; Dorsal soft rays (total): 14 - 15; Analspines: 0; Analsoft rays: 14 - 15; Vertebrae: 41
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Katsuwonus pelamis have a typical tuna fish shape, possessing a fusiform, elongate body. They possess two dorsal fins, the first of which consists of 14-16 spines. The second dorsal fin is set directly behind the first with a small space separating the two. Following the second dorsal fin are 7-9 finlets. The anal fin is also followed by about 7-8 finlets. The pectoral fins are short and consist of 26 or 27 rays. Skipjacks are scaleless, except along the lateral line and the corselet. Dark purplish-blue dorsally, skipjacks camouflage themselves from predators below by maintaining a silvery hue both laterally and ventrally. There are also 4-6 dark bands along the side of the fish extending to the tail which, in live fish, may appear as a discontinuous lines of dark blotches. The maximum length is about 108 cm fork-length with a maximum weight of 32.5 to 34.5 kg. However, the more common maximum size is 80 cm fork-length and 8-10 kg in weight. Teeth are small and conical in shape. Skipjacks also lack a swim bladder.

Range mass: 34.5 (high) kg.

Average mass: 8-10 kg.

Other Physical Features: endothermic ; ectothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 120.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1080 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

110 cm FL (male/unsexed; (Ref. 89423)); max. published weight: 34.5 kg (Ref. 168); max. reported age: 12 years (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Interpelvic process small and bifid. Body without scales except for the corselet and the lateral line. Swim bladder absent. The back is dark purplish blue, lower sides and belly silvery, with 4 to six very conspicuous longitudinal dark bands which in live specimens may appear as continuous lines of dark blotches.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found in offshore waters with temperatures ranging from 14.7 to 30°C while larvae are mostly restricted to waters with surface temperatures of at least 25°C. Exhibit a strong tendency to school in surface waters with birds, drifting objects, sharks, whales and may show a characteristic behaviour like jumping, feeding, foaming, etc. Feeds on fishes, crustaceans, cephalopods and molluscs. Spawns in batches all year long in tropical waters and from spring to early fall in subtropical waters. It is thought to live for at least 8-12 yrs. Also taken by trolling on light tackle using plugs, spoons, feathers, or strip bait (Ref. 9684). Marketed fresh, frozen or canned (Ref. 9340); also utilized dried-salted and smoked (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

T. niger, capite thoraceque flavo variegatus, abdominis segmentis maculis duabus flavis; alis sub-hyalinis.

 

Male. Length 6 1 / 2 lines. Black, the head and thorax subopake, the abdomen shining; the mandibles, clypeus and a V-shaped mark above yellow; the base of the clypeus and an anchor-shaped mark in the middle black. Thorax, the collar, posterior margin of the prothorax, a spot on the tegulae, two beneath the wings, a minute one on the mesothorax, three on the scutellum, and one on each side of the metathorax yellow; the anterior tibiae and the intermediate pair in front ferruginous; the wings subhyaline, the nervures black. The abdomen has an oblong yellow spot at the sides of all the segments except the two apical ones.

 

Female. Length 4 lines. Apterous; black, the head small, transverse in front, much narrowed behind, with a deep longitudinal sulcation on each side close to the margin of the eyes. The thorax narrow and oblong. Abdomen oblong-ovate, very large, with four deep transverse grooves on the second segment. (Pl. I. fig. 1 [[ male ]], 2 [[ queen ]].)

 

Hab. Gilolo.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous; marine; depth range 0 - 260 m (Ref. 9340), usually 0 - ? m (Ref. 55287)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This pelagic and oceanodromous species is found in offshore waters to depths of 260 m. The larvae are restricted to waters with surface temperatures of 15–30°C in Australia (Kailola et al. 1993). This species exhibits a strong tendency to school in surface waters with birds, drifting objects, sharks, and whales. This species feeds on fish, crustaceans, cephalopods, and molluscs. It is preyed upon by large pelagic fishes (Kailola et al. 1993). In the western Atlantic it is commonly found in mixed schools with Blackfin Tuna, Thunnus atlanticus.

This species is very fast-growing, short-lived, and very fecund. Maximum size recorded is 111 cm fork length (FL) (Bayliff 1988) and 34.5 kg. Longevity is estimated to be between 6–8 years (Garcia-Coll et al. 1986, Collette 2010), and age of first maturity is estimated to be 1.5 years (Maunder and Harley 2005). Size at first maturity is 40–55 cm FL, depending on the area (Collette and Nauen 1983, Matsumoto et al. 1984, Wild and Hampton 1994, Schaefer 2001). Estimated length at 50% maturity for females is 42 cm (Cayre and Farrugio 1986, Stequert and Ramcharrun 1996).

This species sex ratio is about 1:1 but fisheries that rely on young, immature fish are dominated by females, while those that capture older fish are mostly male. This species spawns several times per season in batches: at sea surface temperatures of 24–29°C throughout the year in the Caribbean and other equatorial waters, and from spring to early fall in subtropical waters, with the spawning season becoming shorter as distances from the equator increases (Erdman 1977, Collette 2010). In tropical waters, reproductively active female Skipjack Tuna spawn almost daily. Models of migration have been proposed, especially from the central Pacific into the eastern Pacific. Fecundity increases with size but is highly variable, the number of eggs per season in females 41–87 cm FL ranges from 80,000 to 2,000,000 (Collette 2010).

Maximum Size is 108 cm FL, 32.5–34.5 kg. The all-tackle angling record is of a 20.54 kg fish caught off Baja California, Mexico in 1996 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

An epipelagic fish, skipjacks are distributed in water with temperatures ranging from 14.7 and 30 C. Larvae are mostly restricted to areas with temperatures of at least 25 C. Skipjacks tend to be associated with regions of upwelling, or areas where cold, nutrient-rich waters are brought up from the bottom of the ocean to the surface, as well as regions where cold and warm water mix. These are areas with high productivity. Rarely are they found at depths greater than 260 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Collette, B., C. Nauen. 1983. FAO Species Catalogue. Rome: United Nations Development Programme.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in offshore waters; larvae restricted to waters with surface temperatures of 15°C to 30°C.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3411 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3305 samples.

Environmental ranges
  Depth range (m): 0 - 4600
  Temperature range (°C): 1.605 - 27.910
  Nitrate (umol/L): 0.068 - 32.106
  Salinity (PPS): 32.419 - 37.164
  Oxygen (ml/l): 2.345 - 6.864
  Phosphate (umol/l): 0.034 - 2.219
  Silicate (umol/l): 0.747 - 75.947

Graphical representation

Depth range (m): 0 - 4600

Temperature range (°C): 1.605 - 27.910

Nitrate (umol/L): 0.068 - 32.106

Salinity (PPS): 32.419 - 37.164

Oxygen (ml/l): 2.345 - 6.864

Phosphate (umol/l): 0.034 - 2.219

Silicate (umol/l): 0.747 - 75.947
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 260m.
Recorded at 260 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Aggregations of this species tend to be associated with convergence, boundaries between cold and warm water masses (i.e., the polar front), upwelling and other hydrographic discontinuities. Normally inhabit waters with surface temperatures of 20°C to 30°C (Ref. 28951). However, adults are sometimes present in waters as cold as 15°C (Ref. 168, 28950). Stay near the surface at night. School near the surface with birds, drifting objects, whales, sharks, and other tuna species and shows characteristic behaviors like jumping, feeding and foaming. Opportunistic feeders preying on any forage available. The feeding activity peaks in the early morning and in the late afternoon.Skipjack tuna also need a dissolved oxygen level of 2.5 ml per liter of sea water to maintain a minimum swimming speed, and require higher levels when active (Ref. 28952). This requirement generally restricts skipjack tuna to water above the thermocline and in some areas, such as the eastern Pacific, may exclude them from surface waters (Ref. 28952).The warm East Australian Current distributes skipjack tuna larvae into subtropical waters off eastern Australia (Ref. 28956). The larvae are generally limited to the upper 50 m of water and are most common in the sub-surface layers (Ref. 6390). Juvenile skipjack tuna less than 15 cm TL inhabit the same areas as larvae but generally move to cooler waters as they grow to maturity (Ref. 28956).There is little information on migration patterns for skipjack tuna in Australian waters. Skipjack tuna tagged in the Coral Sea, off Norfolk Island and off New South Wales have been recovered in waters off the Solomon Islands, New Caledonia, French Polynesia and New Zealand (Ref. 28959). The recapture in Australian waters of a few fish tagged in New Zealand and Papua New Guinea indicates that there could also be significant movement of skipjack tuna into the Australian Fishing Zone from the greater South Pacific (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Katsuwonus pelamis feed predominantly on fishes, crustaceans and mollusks. The wide variety of food items consumed suggests that the skipjack is a highly opportunistic feeder. Feeding activities peak in the early morning and again in the late afternoon (Collette and Nauen 1983). Blackburn and Serventy (1981) found that the major food items in stomachs of skipjacks in Australian waters were euphausids, with various fishes and squid making up a smaller percentage of the stomach contents. Ankenbrandt (1985) also studied the food habits of skipjack tuna. She found that Euphausia similis had the highest % IRI (index of relative importance) while the gonostomid Maurolicus muelleri made up the highest MVRM (mean volumetric ratio measurement) during all time periods. Other fish like mackerel (Scomber) and Thyrsitops lepidoides were also common. Crustaceans other than E. similis occurred frequently but were not a major part of the total volume of the stomach. Cephalopods occurred infrequently. Skipjacks were also found to consume pteropods, siphonophores, and beetles. There is still some debate as to whether or not this species is cannibalistic. Ankenbrandt (1985) did not find evidence for cannibalism, but Collette and Nauen (1983) list skipjacks as cannibalistic. This discrepancy could be due to the fact that, as opportunistic feeders, skipjacks will consume their young only when they are prevalent.

Animal Foods: fish; insects; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

  • Ankenbrandt, L. 1985. Food Habits of bait-Caught Skipjack Tuna, Katsuwonus pelamis, From the Southwestern Atlantic Ocean. Fishery Bulletin, 83: 379-386.
  • Blackburn, M., D. Serventy. 1981. Observations on distribution and life history of skipjack tuna, Katsuwonus pelamis, in Australian waters. Fishery Bulletin, 79: 85-94.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Oesophagocystis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lobatozoum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lagenocystis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kollikeria Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymoproblema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation (stomach). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystoides Infestation (intestine). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocylindrus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocylindrus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coeliodidymocystis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

In tropical waters, reproductively active female skipjack tuna spawn almost daily.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum age of skipjack tunas is not known but is estimated to be around 8-12 years.

Average lifespan

Status: wild:
8-12 years.

Average lifespan

Status: captivity:
12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Skipjack tuna spawn throughout the year, although they limit spawning from early fall to spring in regions near the equator (Collette and Nauen 1983). Fecundity is related to size. In one study (Stequert and Ramcharrun 1995) it was found that a 44 cm female carrried 80000 eggs while a larger female (75cm long) possessed 1.25 million eggs. Based on these two estimates, it was determined that the relative batch fecundity varies from 40 to 130 eggs/g body weight. These authors estimate four successive spawning periods per year for the skipjack. Stequert and Ramcharrun (1996) also looked at other aspects of reproduction in the skipjack tuna. They found that females mature at 41-42 cm fork-length while males mature at a slightly larger size, 42-43 cm fork-length. Both of these are equivalent to approximately 1.5 years of age. In their study, 70% of the females during any given month had ovaries in the terminal stages of maturation, providing more evidence that reproduction is not allocated to a particular time of year. Exactly how skipjacks reproduce is not known, but the breeding area of this species is thought to be limited to tropical regions of the world's oceans.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 1.5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

  • Collette, B., C. Nauen. 1983. FAO Species Catalogue. Rome: United Nations Development Programme.
  • Stequert, B., B. Ramcharrun. 1996. Reproduction of skipjack tuna (Katsuwonus pelamis) from the Western Indian Ocean. Aquatic Living Resources, 9: 235-247.
  • Stequert, B., B. Ramcharrun. 1995. The fecundity of skipjack tuna (Katsuwonus-pelamis) from the western Indian Ocean. Aquatic Living Resources, 8: 79-89.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bodies stay warm in cold water: skipjack tuna
 

Bodies of skipjack tuna stay warmer because of counter-current heat exchange system.

   
  "Tunas are extraordinary fishes. This paper concerns one of the features that makes them extraordinary: the counter-current heat exchanger. The evolution of this device permits tuna to achieve body temperatures much greater than ambient water temperature. For example, the muscle temperature of large bluefin tuna can be as much  as 20 °C above ambient water temperature (Carey et al. 1971) and the muscle temperature of small skipjack tuna (2 kg) can be as much as 9 °C above ambient (Stevens & Fry, 1971). The body temperature of other fishes is at most 2 °C above ambient (Stevens & Fry, 1970) because metabolic heat is efficiently transferred from the venous blood to surrounding water at the gills (Fig. 1). To maintain a large temperature excess, tuna have had to make a tremendous anatomical investment and construct a thermal barrier between venous blood and the gills. The present paper describes this thermal barrier, the counter-current heat exchanger of skipjack tuna." (Stevens 1973:145)

  Learn more about this functional adaptation.
  • Stevens, E. D.; Kanwisher, J. W.; Carey, F. G. 2000. Muscle temperature in free-swimming giant Atlantic bluefin tuna (Thunnus thynnus L.). Journal of Thermal Biology. 25(6): 419-423.
  • Stevens, E. Don; Lam, How Man; Kendall, J. 1974. Vascular Anatomy of the Counter-Current Heat Exchanger of Skipjack Tuna. J Exp Biol. 61(1): 145-153.
  • Stevens ED; Lam HM; Kendall J. 1974. Vascular anatomy of the counter-current heat exchanger of skipjack tuna. Journal of Experimental Biology. 61(1): 145-153.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Katsuwonus pelamis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTTTATCTAGTATTCGGTGCATGAGCTGGTATAGTTGGCACGGCCTTAAGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTCATCCCTCTAATGATCGGGGCTCCAGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCTCCATCTTTCCTTCTACTACTAGCTTCTTCAGGAGTTGAAGCTGGTGCCGGAACAGGTTGAACAGTTTACCCTCCCCTTGCCGGTAACCTGGCTCACGCCGGAGCATCTGTTGACCTAACTATTTTCTCCCTACATCTTGCAGGTGTTTCTTCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAACATGAAACCTGCCGCTATCTCCCAGTACCAAACTCCTCTGTTCGTATGAGCCGTCCTAATTACAGCTGTCCTTCTTCTTCTGTCACTTCCAGTTCTTGCCGCTGGCATTACAATGCTTCTGACAGACCGAAACCTGAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCAATTCTTTACCAACACCTATTCTGATTCTTCGGCCATCCGGAAGTCTACATTCTAATTCTACCAGGATTCGGAATGATCTCCCACATCGTTGCCTACTACGCCGGTAAAAAAGAACCTTTCGGCTATATGGGTATGGTATGAGCCATGATGGCTATCGGCCTACTAGGGTTCATCGTATGAGCCCACCACATGTTCACAGTAGGAATGGACGTAGACACACGAGCCTACTTTACATCCGCAACTATGATTATCGCGATTCCAACTGGTGTAAAAGTATTTAGCTGACTTGCAACTCTTCACGGAGGAGCAGTTAAATGAGAAACCCCTCTTCTATGAGCCATCGGTTTCATTTTCCTCTTTACAGTAGGAGGCCTAACAGGAATTGTCCTAGCCAATTCATCCCTAGACATCGTACTCCACGACACCTACTACGTCGTAGCCCATTTCCACTACGTCCTATCTATGGGAGCTGTCTTCGCCATCGTTGCTGCTTTCGTACACTGATTCCCACTATTTACAGGCTACACCCTACACAGCACATGAACTAAAATCCACTTTGGAGTAATATTCGTAGGTGTCAACCTAACATTCTTCCCCCAACACTTCCTAGGACTAGCAGGAATGCCTCGACGGTACTCAGACTACCCAGACGCCTACACTCTTTGAAACACAATCTCCTCTATTGGATCTCTAATCTCCCTTGTGGCAGTAATTATGTTCCTATTCATTATCTGAGAAGCGTTCGCTGCCAAACGTGAAGTAATATCAGTTGAGCTAACTGCAACCAATGTAGAATGACTGCACGGCTGCCCTCCCCCTTACCACACATTCGAAGAACCGGCATTCGTACTAGTCCAATCAGACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Katsuwonus pelamis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 120
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 17 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Amorim, A.F., Boustany, A., Canales Ramirez, C., Cardenas, G., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Fox, W., Fredou, F.L., Graves, J., Guzman-Mora, A., Viera Hazin, F.H., Juan Jorda, M., Kada, O., Minte Vera, C., Miyabe, N., Montano Cruz, R., Nelson, R., Oxenford, H., Salas, E., Schaefer, K., Serra, R., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is widespread and is important in commercial fisheries throughout its range. Although it is heavily fished, it is considered relatively abundant and is fast-growing, short-lived, and very fecund. It is listed as Least Concern. However, in some regions there may be signs of overfishing and uncertainty in estimating population size and trends. More research and monitoring is needed for this species to develop better population models and to ensure that current fishing mortality does not exceed estimated maximum sustainable yield (MSY).

Indian and Western Pacific Ocean
This species is widespread in the Indo-Pacific. It is considered moderately to fully exploited, with no clear indication of decline in catches or estimated biomass, although data in some areas are uncertain. It is listed as Least Concern. However, it is recommended that current fishing mortality does not increase.

Eastern Pacific Ocean
This species is wide-ranging in the Eastern Pacific, and there is no evidence to suggest that fishing pressure is negatively impacting the population at present. It is listed as Least Concern.

Mediterranean
In the Mediterranean this species is common but not abundant. Catch statistics indicate a stable fluctuation at low quantities. It is listed as Least Concern.

Atlantic
This species is wide-ranging and a small species, and reproduces at a young age and small size. There is no evidence to suggest that fishing pressure is negatively impacting the population at present. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skipjacks are currently not threatened, although catches fluctuate widely from year to year, providing scientists with little information as to how long the populations can withstand increased fishing pressure (World Wide Fund For Nature 1996). Scientists have been studying both natural and fishing mortality within these populations, as well as other tuna populations, to obtain a better understanding of their biology. In one such study, conducted in the western Pacific tuna fishery, natural mortality (M) and fishing mortality (F) were studied over a range of sizes for skipjack and other tunas. Skipjacks displayed a u-shaped natural mortality rate, where smaller size classes had higher mortality rates than those in the middle. At size classes above 70cm, the mortality rate increased yet again, indicating the natural age at which these fish die. Fishing mortality was high for the smallest subclasses studied (21-30 cm, 31-40 cm) and decreased steadily for the larger size categories. If these numbers are correct, the high M values under natural conditions for young skipjack tuna would dampen the effect of the high F for this age group. In other words, the high mortality rate sustained by skipjacks at a young age due to fishing would not necessarily alter the population numbers as these fish tend to have low survival rates anyway (Hampton 2000).

There are several groups dedicated to the study and protection of tuna. One such group, the Inter-American Tropical Tuna Commission (IATTC), works with fisheries and governments of member nations to protect these species. The IATTC was established in the 1950s and consists of two main programs, the Tuna-Billfish and the Tuna-Dolphin programs. Both of these programs are designed to investigate yellowfin and skipjack tuna in the eastern Pacific, examine the effects of natural and human activities on the populations of these fishes, and recommend action to member governments to maintain populations at maximum sustained catches (Joseph 1994). This commission (and others like it) is operating to understand more fully the biology of skipjack tunas, and, as a result, make better management decisions. Due to its global distribution, this is a difficult species to manage effectively.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Reported worldwide landings fluctuate greatly, but show a gradual increase from 158,600 tonnes in 1950 to 2,480,812 tonnes in 2006 (FAO 2009).

Catch summary statistics for 2000–2004 and the status of the stock (Majikowsk 2007) include the following: 93,000–133,000 tonnes/year in the Eastern Atlantic where the status of the stock is unknown; 22,000–31,000 tonnes/year in the Western Atlantic where the status of the stock is unknown; 422,000–489,000 tonnes/year in the Indian Ocean where the status of the stock is Moderately to Fully exploited; 282,000–439,000 tonnes/year in the Eastern Pacific where the status of the stock is Moderately exploited; 1,136,000–1,295,000 tonnes/year in the Western and Central Pacific where the status of the stock is Moderately exploited.

Eastern Pacific Ocean (EPO)
FAO landings data from 1976–2005 vary from approximately 25,000–140,000 tonnes caught annually in the eastern tropical Pacific (FAO 2009). Landings data have been relatively constant over the last 20 years, and between 35,000 and 100,000 tonnes. In general, the Skipjack Tuna global population in the EPO has been high for the last 30 years perhaps related to increased frequency of El-Niño events. Therefore, the general eastward expansion of the Skipjack habitat predicted in this simulation is very plausible (Loukos et al. 2003, Worm and Tittensor 2011).

The last full assessment for Skipjack Tuna in the EPO was in 2005 (Maunder and Harley 2005), although an evaluation of a set of fishery indicators was given in 2008 (Maunder 2010). Reported landings from 1976–2005 (IATTC 2008) varied from 52,000–311,000 metric tonnes per year in the Eastern Pacific including California. The recruitment of tuna to the tropical eastern Pacific region is highly variable and is thought to be the reason for the large variations in stock size. The average weight of this species has been declining since 2000, and the 2007 average weight is approaching the lower reference level. The biomass, recruitment, and exploitation rate has also been increasing over the past 20 years. The main concern with this species' stock is the constantly increasing exploitation rate. However, the data- and model-based indicators have yet to detect any adverse consequence of this increase. There have been observed declines in average weight, and average weight is near its lower reference level, which can be a consequence of overexploitation, but it can also be caused by recent recruitments being stronger than past recruitments (IATTC 2008, Maunder 2010). For example, a group of relatively strong cohorts entered the fishery in 2000–2003.

Western and Central Pacific Ocean (WCPO)
Within the equatorial region, fishing mortality increased throughout the modelled period (1952–2007) and is estimated to be highest in the western region in the most recent years. The impact of fishing is predicted to have reduced recent biomass by about 40% in the western equatorial region and 20% in the eastern region (Langley and Hampton 2008). However, this most recent assessment for Skipjack Tuna in the WCPO (Langeley and Hampton 2008) concluded that the stock was not in an overfished state nor was overfishing occurring. Nothing has been observed in the fishery that indicates that this conclusion should be changed, although some mild concern over possible shifts in distribution of Skipjack Tuna in the northern regions of the WCPO has been expressed (Joseph 2009, ISSF 2010).

Indian Ocean
An attempt was made in 2003 to assess the stock status but due to the large uncertainties in the information needed to conduct a complete assessment, the Indian Ocean Tuna Commission (IOTC) only analysed different fishery indicators that could provide a general understanding of the state of the stock (i.e., trends in catches and nominal catch per unit effort (CPUE), average weight in the catches, length-based cohort analysis (IOTC 2008, IOTC 2009, STECF 2007). In spite of not having a full stock assessment for this species, the analysis did not show reasons for concern, as catches have continued to increase as effort increased and the majority of the catch comes from fish that are already sexually mature (greater than 40 cm), as the fishing pattern by size indicates. However, length-based cohort analyses indicated a growing catch of smaller size fish due to the fishery with fish aggregating devices (FADs) (STECF 2007).

Preliminary data indicate that catches in 2007 may be the lowest since 2002 (IOTC 2009), possibly due to the lack of fishing in areas patrolled by pirates. However, the range of stock indicators available does not currently signal any problems in the fishery, and catches have continued to increase as effort increased (IOTC 2009, STECF 2009). Furthermore, the majority of the catch comes from fish that are sexually mature (greater than 40 cm) and therefore likely to have already reproduced (STECF 2009). The IOTC has recommended that this species should be carefully monitored given current fishing pressure as it is clear that current catches cannot be increased indefinitely (IOTC 2009).

Atlantic Ocean
The Atlantic population is divided into eastern and western stocks; with the eastern stock contributing the majority of catches (~ 80%). Stock assessments for eastern and western Atlantic Skipjack Tuna were conducted in 2008 using available catches to 2006 (STECF 2009). In summary, it appears that both stocks in the Atlantic are currently being fished at levels below maximum sustainable yield (MSY), and the stocks are not being overfished, and are not considered to be in an overfished state (ISSF 2010). The total catches obtained in 2008 in the entire Atlantic Ocean were close to 149,000 t which represents the catch average of the last five years (STECF 2009). This species is not abundant in the Mediterranean with FAO reported landings fluctuating around 100 t from 1996–2005. Although catch is slowly increasing in the Mediterranean in recent years, statistics in the Mediterranean are incomplete (Di Natale pers. comm. 2008).

In the Eastern Atlantic, the preliminary estimates of catches made in 2008 amounted to 127,000 t, representing an increase of 3% as compared to the average of 2003–2007. A Bayesian method, using only catch information estimated the MSY (under a Schaefer-type model parametrisation) at 143,000–156,000 t, a result which agrees with the estimate obtained by the modified Grainger and Garcia approach: 149,000 t. In addition, two non-equilibrium surplus biomass production models were applied for eight time series of CPUEs, and for a combined CPUE index weighted by fishing areas. In general, the range of plausible MSY values estimated from these models (155,000–170,000 t) were larger than in the Bayesian model based on catches. It is therefore difficult to estimate MSY under the continuous increasing conditions of the exploitation plot of this fishery (one-way of the trajectory to substantially weaker effort values) and which as a result, the potential range distribution of some priors needs to be constrained (e.g., for growth rate, or for the shape parameter of the generalized model) (ICCAT 2009, STECF 2009). Although there are discrepancies among various models that create difficulty in estimating MSY, it is unlikely that Skipjack Tuna is over exploited in the eastern Atlantic (ICCAT 2009, STECF 2009).

In the Western Atlantic, the major fishery is the Brazilian baitboat fishery, followed by the Venezuelan purse seine fleet (ICCAT 2009, STECF 2009). Catches in 2008 in the West Atlantic amounted to 22,000 t representing a decrease of 17% as compared to the trend observed for recent years. Catch only model estimated MSY at around 30,000 t (similar to the estimate provided by the Grainger and Garcia approach) and the Bayesian surplus model (Schaefer formulation) at 34,000 t. Other analyses using Multifan-CL indicated MSY convergens to about 31,000–36,000 t. For the western Atlantic stock, in light of the information provided by the trajectories of B/BMSY and F/FMSY, it is unlikely that the current catch is larger than the current replacement yield (ICCAT 2009, STECF 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Skipjack Tuna make up 60% of the commercial tuna catch worldwide and is mostly used for canning. They are taken at the surface mostly with purse seines and pole-and-line gear, but is also caught by trolling on light tackle using plugs, spoons, feathers, or strip bait (Collette 2001).

Eastern Pacific Ocean (EPO)
In the EPO, this species is primarily caught with purse seines, and with pole and line and long-line to a lesser degree. It is an important game fish in Panama (D'Croz et al. 1994). More recently this species is being fished with drifting floating objects. The large increase in catch observed in the past 10 years is primarily due to fishing with fish aggregating devices (FADs) in the equatorial eastern Pacific. There is a continuously increasing exploitation rate in the EPO, but models do not predict widespread population decline (IATTC 2008). Given the reduction in larger predators, it is expected that this species is relatively abundant. However, there is a decreasing average weight and increasing catch effort with no comprehensive stock assessment in this region (STEFC 2009).

Western and Central Pacific Ocean (WCPO)
Although Skipjack Tuna are the most intensively fished species in the central Pacific Ocean, biomass appears to have remained relatively stable between 1952–1998 (Cox et al. 2002). A Japanese pole-and-line fleet previously dominated the fishery, but it is now dominated by purse seiners, and catches by this gear have shown an increasing trend for three decades (ISSF 2010). Over the past five years, the catch has been at record high levels exceeding 1.2 million tonnes annually and accounting for more than 65% of the annual catch of principal tuna species in the region (STECF 2007). In the WCPO, the level of catch is very high, and some boats are not recording catches, and there are difficulties in monitoring the various fleets concerned (STECF 2009).

Indian Ocean
In the Indian Ocean this species is mainly caught by purse seine, gillnet and bait boat (IOTC 2008). The high productivity life history characteristics of Skipjack Tuna suggest this species is resilient and not prone to overfishing, and the stock status indicators suggest there is no need for immediate concern about the status of Skipjack Tuna. However, it is clear that catches cannot grow at the current rate indefinitely (STECF 2007). The effect of FAD fishery on juveniles of other tuna species should be strictly monitored and evaluated.

Atlantic Ocean
The numerous changes that have occurred in the Skipjack Tuna fishery since the early 1990s (such as the use of FADs and the expansion of the fishing area towards the west) that have brought about an increase in Skipjack Tuna catchability and in the proportion of the stock that is exploited. At present, the major fisheries are the purse seine fisheries, particularly those of Spain, France, Cape Verde, Guatemala and Ghana, followed by baitboat fisheries of Ghana, Spain and France. Increasing harvests and fishing effort could lead to involuntary consequences for other species that are harvested in combination with Skipjack Tuna. In the West Atlantic, the major fishery is the Brazilian baitboat fishery, followed by the Venezuelan purse seine fleet (STECF 2009). The Brazilian bait boat fleet of Santa Catarina State yields almost half of the Skipjack Tuna catches in the West Atlantic (Andrade and Kinas 2004).With respect to the West Atlantic, the fishing effort of the Brazilian baitboats seems to be stable over the last 20 years. There has been a recent increase in Skipjack Tuna catchability from 1–13% per year since the early 1980s. The change in the selectivity pattern observed for the purse seine fishery suggests that this fleet is mainly targeting juvenile tunas (ICCAT 2008). In the insular Caribbean, this species is important to the artisanal fishery (Mahon 1996). In the Mediterranean, this species may be caught with drift nets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This is listed as a highly migratory species in Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department 1994).

In the Eastern Pacific Ocean (EPO) previous to 2008, the Inter-America Tropical Tuna Commission (IATTC) had small area-wide closures for 6-weeks on purse-seining for tuna in the eastern Pacific.All purse-seine vessels of more than 182 metric tonnes of carrying capacity that fish in the EPO for Yellowfin, Bigeye, and Skipjack tunas were required to stop fishing in the EPO for a period of 59, 62, and 73 days during 2009, 2010, and 2011, respectively. The closures can be for either of two periods, August–September or November–January (ISSF 2010). Skipjack Tuna is a notoriously difficult species to assess. Due to Skipjack’s high and variable productivity (i.e., annual recruitment is a large proportion of total biomass), it is difficult to detect the effect of fishing on the population with standard fisheries data and stock assessment methods. This is particularly true for the stock of the EPO, due to the lack of age-frequency data and the limited tagging data. One of the major problems mentioned above is the uncertainty as to whether the catch per unit effort (CPUE) of the purse seine fisheries is an appropriate index of abundance for Skipjack Tuna, particularly when the fish are associated with fish-aggregating devices (FADs). Purse seine CPUE data are particularly problematic, because it is difficult to identify the appropriate unit of effort (Maunder 2010). Since the stock assessments and reference points for Skipjack Tuna in the EPO are so uncertain, developing alternative methods to assess and manage the species that are robust to these uncertainties would be beneficial.

In the Atlantic, there is currently no specific regulation in effect for Skipjack Tuna. However, with the aim of protecting juvenile Bigeye Tuna, the French and the Spanish boat owners voluntarily decided to apply a moratorium for fishing under floating objects between November and the end of January for the 1997–1998 and 1998–1999 periods. ICCAT implemented a similar moratorium from 1999 to January 2005. This moratorium has had an effect on Skipjack Tuna catches made with FADs. On the basis of a comparison of average catches between 1993–1996, prior to the moratoria, and those between the 1998–2002 period, the average Skipjack Tuna catches between November and January for the purse seine fleets that applied the moratoria, were reduced by 64%. During that period (1998–2002), the average annual Skipjack Tuna catches by purse seine fleets that applied the moratoria decreased by 41% (42,000 t per year). However, this decrease is possibly a combined result of the decrease in effort and the impact of the moratoria (the average annual catch per boat decreased only 18% between these two periods). This moratorium area was reduced significantly in spatial and temporal coverage in 2001. The ICCAT-SCRS recommends that catches not be allowed to exceed MSY (ISSF 2010, STECF 2009).

In the Western and Central Pacific, there is a limit on the use of FADs and purse seiners, and to reduce the catch of long liners to reduce bycatch for Bigeye Tuna, all of which may have positive conservation effects for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Katsuwonus pelamis has become more important in the tuna fishing industry in recent years. In 1950, less than 300,000 metric tons were taken. In 1991, 1,674,970 metric tons were caught. This level has not been reached since (Collette and Nauen 2000). Currently, Katsuwonus pelamis comprise 40 percent by weight of the world tuna catch despite being the smallest of the tunas subject to the large-scale commercial fishing operations. Americans alone consume more than 400000 metric tons of tuna (all species) each year, and it is doubtful that this number will decrease any time soon (World Wide Fund For Nature 1996).

The tendency of skipjacks to group underneath objects floating on the surface of the water is taken advantage of by fisheries, which use Fish Aggregating Devices to attract them (World Wide Fund For Nature 1996). However, they are usually captured at the surface using purse seines or pole-and-line gear.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Skipjack tuna

The skipjack tuna, Katsuwonus pelamis, is a medium-sized perciform fish in the tuna family, Scombridae. It is otherwise known as the aku, arctic bonito, mushmouth, oceanic bonito, striped tuna, or victor fish. It grows up to 1 m (3 ft) in length. It is a cosmopolitan pelagic fish found in tropical and warm-temperate waters. It is a very important species for fisheries.[2]

Contents

Description

Shoaling skipjack tuna

It is a streamlined, fast-swimming pelagic fish, common in tropical waters throughout the world, where it inhabits surface waters in large shoals (up to 50,000 fish), feeding on fish, crustaceans, cephalopods and molluscs. It is an important prey species for large pelagic fishes and sharks. It has no scales, except on the lateral line and the corselet (a band of large, thick scales forming a circle around the body behind the head). It commonly reaches fork lengths up to 80 centimetres (31 in) and a weight of 8–10 kilograms (18–22 lb). Its maximum fork length is 108 centimetres (43 in) and maximum weight is 34.5 kilograms (76 lb). Ageing skipjack tuna is difficult, and the estimates of its potential lifespan range between 8 and 12 years.[2]

Skipjack tuna is a batch spawner. Spawning occurs year-round in equatorial waters, but it gets more and more seasonal further away from the equator. Fork length at first spawning is about 45 centimetres (18 in).[2]

Fisheries

It is an important commercial and game fish, usually caught using purse seine nets, and is sold fresh, frozen, canned, dried, salted, and smoked. With reported landings of almost 2.6 mill. tonnes, it was world's 2nd most important capture fish species in 2009.[3] Countries recording large amounts of skipjack catches include the Maldives, France, Spain, Malaysia, Sri Lanka, and Indonesia.[4]

Skipjack is the most fecund of the main commercial tunas, and its population is considered sustainable against its current consumption.[5][6] Its fishing is still controversial due to the methodology; with rod and reel or fishery options being promoted as ecologically preferable.[7][8][9]

Skipjack is considered to have "moderate" mercury contamination. As a result, pregnant women are advised against eating large quantities.[10][11][12]

As food

Skipjack tuna is used extensively in Japanese cuisine, where it is known as katsuo ( or かつお). Besides being eaten seared (katsuo tataki, 鰹のタタキ) and raw in sushi (寿司 or すし) and sashimi (刺身 or さしみ), it is also smoked and dried to make katsuobushi鰹節 or かつおぶし), the central ingredient in dashi (出汁 or だし) (a common Japanese fish stock). It is also a key ingredient in katsuo no shiokara (塩辛 or しおから).

In Indonesian cuisine, skipjack tuna is known as cakalang. Most popular dish from skipjack tuna is cakalang fufu from Minahasa. It is a cured and smoked skipjack tuna clipped on a bamboo frame.[13] Skipjack is also integral to Maldivian cuisine.[14]

Notes

  1. ^ http://www.iucnredlist.org/apps/redlist/details/170310/0
  2. ^ a b c Collette, Bruce B.; Cornelia E. Nauen (1983). FAO species catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and other related species known to date. FAO Fisheries Synopsis. Rome: Food and Agriculture Organization of the United Nations. pp. 137. ftp://ftp.fao.org/docrep/fao/009/ac478e/ac478e00.pdf. 
  3. ^ FAO (Food and Agriculture Organization of the United Nations) (2011). Yearbook of fishery and aquaculture statistics 2009. Capture production. Rome: Food and Agriculture Organization of the United Nations. p. 27. ftp://ftp.fao.org/FI/CDrom/CD_yearbook_2009/root/capture/yearbook_capture.pdf. 
  4. ^ Makoto Miyake, Naozumi Miyabe, Hideki Nakano (2004). Historical trends of tuna catches in the world. FAO Fisheries Technical Paper No. 467. Rome: Food and Agriculture Organization of the United Nations. http://www.fao.org/docrep/007/y5428e/y5428e00.htm. 
  5. ^ "FishWatch: Atlantic Skipjack Tuna (Katsuwonus pelamis)". NOAA - National Oceanic and Atmospheric Adminsitration. November 3, 2009. http://www.nmfs.noaa.gov/fishwatch/species/atl_skipjack.htm. Retrieved 2009-11-12. 
  6. ^ "Skipjack tuna, purse seine caught". Blue Ocean Institute. Nov 11, 2009. http://www.blueocean.org/programs/seafood-view?spc_id=54. Retrieved 2009-11-12. 
  7. ^ courtesy of the Secretariat of the Pacific Community (November 2009). "BUSINESS: PACIFIC TOLD TO TAKE THE LEAD If region wants to conserve critical resource". Islands Business International. http://www.islandsbusiness.com/islands_business/index_dynamic/containerNameToReplace=MiddleMiddle/focusModuleID=18926/overideSkinName=issueArticle-full.tpl. Retrieved 2009-11-12. 
  8. ^ "Pacific tries to show way in sustainable tuna fishing". ABC International - Radio Australia. Fri Oct 23, 2009. http://www.radioaustralia.net.au/pacbeat/stories/200910/s2722094.htm. Retrieved 2009-11-12. 
  9. ^ "Retailers' Guide to Sustainable and Equitable Pole and Line Skipjack". Greenpeace International. 27 April 2009. http://www.greenpeace.org/international/press/reports/retailers-guide-skipjack. Retrieved 2009-11-12. 
  10. ^ [1]
  11. ^ [2]
  12. ^ [3]
  13. ^ "Cakalang Fufu Jadi Pilihan di Sulut" (in Indonesian). MediaIndonesia.com. Friday, 15 July 2011. http://www.mediaindonesia.com/read/2011/07/07/242079/290/101/Cakalang-Fufu-Jadi-Pilihan-di-Sulut. Retrieved 1 June 2012. 
  14. ^ Prince, Rose (11 March 2010). "Tuna fishing in the Maldives: the fairest catch". The Telegraph. http://www.telegraph.co.uk/foodanddrink/7413598/Tuna-fishing-in-the-Maldives-the-fairest-catch.html. Retrieved 13 April 2011. 

Other references

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!