Overview

Comprehensive Description

Biology

Inhabits rivers, lakes, irrigation canals and fringing vegetation; feeds on zooplankton, Caridina, insects, snails and vegetation (Ref. 28714). Dwarf populations are described in lake basins: Lake Turkana, B. n. nana Pellegrin, 1935 and Lake Chad, B. n. dageti Blache and Miton, 1960 (see Ref. 2880).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is wide spread across much of Africa, from Senegal to Ethiopia, from Egypt to Democratic Republic of Congo.

Central Africa: In Lower Guinea, it is known from the Cross and Meme basins.

Eastern Africa: This species is found in Lake Albert, the Albert and Murchison Niles, and the Aswa River system (This species is known from upper Nile system). It is also present in Lake Turkana

Northern Africa: It is present in the upper Egyptian Nile and Lake Nasser (also known as Lake Nubia)

Northeast Africa: This species is found in the Ghazal and Jebel systems, White and Blue Niles, and Nile to Lake Nasser.

Western Africa: It is widely distributed in the Nile, Chad, Niger (including the Benue river), Ogun, Ouémé, Mono, Sio, Volta, Bia, Comoé, Agnébi, Bandama, Sassandra, Konkouré, Gambia, Tominé (Corubal) and Senegal basins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: widely distributed in West Africa (Ref. 2880, 80290, 81279). In Lower Guinea present in Cross and Mémé rivers (Ref. 80279).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 0; Analsoft rays: 13 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 3799)); max. published weight: 200 g (Ref. 3799)
  • Ita, E.O. 1984 Kainji (Nigeria). p. 43-103. In J.M. Kapetsky and T. Petr (eds.) Status of African reservoir fisheries. CIFA Tech. Pap. 10:326 p. (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: fronto-parietal fontanel absent in adults, sometimes pore-like in juveniles, disappearing with growth; dorsal fin origin at about same level as pelvic fin insertion; sexual dimorphism affecting anal fin shape; 24-34 lateral line scales; 5.5 scales between lateral line and dorsal fin; 10-15 anal fin branched rays; 14-20 gill rakers on lower limb of first gill arch; 8 teeth in outer premaxillary row (Ref. 2880, 80290, 81279). Snout short, more than 3x head length; head length/snout length 3.6-4.3; 10-11.5 predorsal scales; flanks without lateral band; adults medium-sized (Ref. 80290).Description: anal fin with 3 branched and 10-15 unbranched rays; jaws equal; premaxilla with two tooth rows, each comprimising 8 teeth; in larger individuals, two teeth of anterior row become dislodged, thus forming ‘third’ row (Ref. 2880, 80290, 81279).Coloration: humeral spot; precaudal black spot, extending unto median rays of caudal fin to margin of caudal fork; back greenish, sides silvery and belly white; unpaired fins vermillion-red; pectorals and ventral colorless or, at most, light orange; part above eye red (Ref. 2880, 80290, 81279).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Brycinus nurse is a pelagic, potamodromous species. It inhabits rivers, lakes, irrigation canals and fringing vegetation. It feeds on zooplankton, Caridina, insects, snails and vegetation (Bailey 1994), and less frequently small fishes mainly Haplochromis spp. Dwarf populations are described in lake basins. It spawns at the beginning of the rainy season.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic; potamodromous (Ref. 51243); freshwater; pH range: 6.0 - 7.8; dH range: 30
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on invertebrates and plants (Ref. 6160)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycinus nurse

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTTGTATTTGGTGCCTGAGCCGGGATGGTCGGAACTGCCCTGAGTCTTTTAATCCGGGCAGAGCTGAGCCAACCCGGATCCCTTCTAGGGGACGATCAGATTTATAATGTTATCGTCACAGCACATGCATTTGTAATAATTTTCTTCATGGTAATACCAATTATAATTGGCGGCTTCGGAAATTGACTTGTCCCCCTAATAATTGGGGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGGCTTCTCCCCCCATCCTTCCTTCTCCTTTTAGCCTCTTCCGGGGTTGAAGCGGGGGCTGGAACAGGCTGAACTGTTTATCCTCCCCTTGCCGGAAACCTTGCCCACGCAGGGGCCTCTGTAGATCTGACTATTTTTTCACTTCATCTCGCAGGTGTCTCCTCCATCCTGGGTGCAATTAACTTTATTACAACCATCGTAAACATAAAACCTCCTGCCATCTCACAGTACCAAACCCCTCTATTTGTTTGAGCTGTCTTAGTGACCGCTGTCCTTTTACTTCTTTCCCTACCCGTTCTGGCTGCAGGAATTACTATACTTCTAACAGACCGAAATCTAAACACCACCTTCTTTGACCCCGCAGGCGGAGGGGATCCAATTCTTTACCAGCACTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brycinus nurse

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A. & Moelants, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for eastern Africa. Due to uncertainty of this species distribution, it has been assessed as Data Deficient for northern and north eastern Africa. In the central Africa regional assessment it has been categorised as Not Applicable as it is thought that less than 5% of this species range falls within this region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Little information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Populations of this species are threatened by heavy commercial fishing pressure for the aquarium trade. In northern Africa, dams, water pollution (agriculture, domestic and commercial/industrial), groundwater extraction and drought all pose possible threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available. More research is needed into this species population numbers and range, biology and ecology, habitat status and threats, as well as monitoring and potential conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!