Overview

Comprehensive Description

Biology

Inhabit rivers, lakes, irrigation canals and fringing vegetation. Feed on zooplankton, Caridina, insects, snails and vegetation (Ref. 28714). Dwarf populations are described in lake basins: Lake Turkana, B. n. nana Pellegrin, 1935 and Lake Chad, B. n. dageti Blache and Miton, 1960 (see Ref. 2880).
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Nile, Chad, Niger and Bénoué, Cross, Ogun, Ouémé, Mono, Sio, Volta, Bia, Comoé, Agnébi, Bandama, Sassandra, Konkouré, Gambia, Tominé (Corubal), Senegal.
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is wide spread across much of Africa, from Senegal to Ethiopia, from Egypt to Democratic Republic of Congo.

Central Africa: In Lower Guinea, it is known from the Cross and Meme basins.

Eastern Africa: This species is found in Lake Albert, the Albert and Murchison Niles, and the Aswa River system (This species is known from upper Nile system). It is also present in Lake Turkana

Northern Africa: It is present in the upper Egyptian Nile and Lake Nasser (also known as Lake Nubia)

Northeast Africa: This species is found in the Ghazal and Jebel systems, White and Blue Niles, and Nile to Lake Nasser.

Western Africa: It is widely distributed in the Nile, Chad, Niger (including the Benue river), Ogun, Ouémé, Mono, Sio, Volta, Bia, Comoé, Agnébi, Bandama, Sassandra, Konkouré, Gambia, Tominé (Corubal) and Senegal basins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 3; Analsoft rays: 10 - 15
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 3799)); max. published weight: 200 g (Ref. 3799)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Parietal fontanelle absent in adults, ponctiform in juveniles. Jaws equal. Sexual dimorphism on anal form of male adults. Humeral and precaudal spots black. Back greenish, sides silvery and ventral part white. Paired fins bright red, pectorals and ventral not colored or light orange. Part above eye red.
  • Paugy, D. 1990 Characidae. p. 195-236. In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douces et saumâtres de l'Afrique de l'Ouest. Tome I. Coll. Faune Tropicale n° XXVIII. Musée Royal de l'Afrique Centrale, Tervuren et O.R.S.T.O.M., Paris, 384 p. (Ref. 2880)   http://www.fishbase.org/references/FBRefSummary.php?id=2880&speccode=5229 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic; potamodromous (Ref. 51243); freshwater; pH range: 6.0 - 7.8; dH range: 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Brycinus nurse is a pelagic, potamodromous species. It inhabits rivers, lakes, irrigation canals and fringing vegetation. It feeds on zooplankton, Caridina, insects, snails and vegetation (Bailey 1994), and less frequently small fishes mainly Haplochromis spp. Dwarf populations are described in lake basins. It spawns at the beginning of the rainy season.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on invertebrates and plants (Ref. 6160)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycinus nurse

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTTGTATTTGGTGCCTGAGCCGGGATGGTCGGAACTGCCCTGAGTCTTTTAATCCGGGCAGAGCTGAGCCAACCCGGATCCCTTCTAGGGGACGATCAGATTTATAATGTTATCGTCACAGCACATGCATTTGTAATAATTTTCTTCATGGTAATACCAATTATAATTGGCGGCTTCGGAAATTGACTTGTCCCCCTAATAATTGGGGCCCCCGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGGCTTCTCCCCCCATCCTTCCTTCTCCTTTTAGCCTCTTCCGGGGTTGAAGCGGGGGCTGGAACAGGCTGAACTGTTTATCCTCCCCTTGCCGGAAACCTTGCCCACGCAGGGGCCTCTGTAGATCTGACTATTTTTTCACTTCATCTCGCAGGTGTCTCCTCCATCCTGGGTGCAATTAACTTTATTACAACCATCGTAAACATAAAACCTCCTGCCATCTCACAGTACCAAACCCCTCTATTTGTTTGAGCTGTCTTAGTGACCGCTGTCCTTTTACTTCTTTCCCTACCCGTTCTGGCTGCAGGAATTACTATACTTCTAACAGACCGAAATCTAAACACCACCTTCTTTGACCCCGCAGGCGGAGGGGATCCAATTCTTTACCAGCACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Brycinus nurse

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A. & Moelants, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for eastern Africa. Due to uncertainty of this species distribution, it has been assessed as Data Deficient for northern and north eastern Africa. In the central Africa regional assessment it has been categorised as Not Applicable as it is thought that less than 5% of this species range falls within this region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Little information available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Populations of this species are threatened by heavy commercial fishing pressure for the aquarium trade. In northern Africa, dams, water pollution (agriculture, domestic and commercial/industrial), groundwater extraction and drought all pose possible threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available. More research is needed into this species population numbers and range, biology and ecology, habitat status and threats, as well as monitoring and potential conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!