Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Oceanic and mesopelagic, found between 375-750 m during the day; between 40-225 m at night (maximum abundance at 100 m depth) (Ref. 4479).
  • Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

USA in the Gulf Stream to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: between 30°N and about 19°N and between 7°N and 11°S (uncommon over the Mauritanian Upwelling Region). Western Atlantic: USA in the Gulf Stream to Brazil. Indian Ocean: 7°N and 23°S; Agulhas Current (Ref. 4066). Western Pacific: to 35°N in Kuroshio and Tushima currents. Eastern Pacific: 8° and 12°S.
  • Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic and Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 15; Analspines: 0; Analsoft rays: 16 - 17
  • Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 90 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.0 cm SL (male/unsexed; (Ref. 4479))
  • Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Diaphus splendidus
Catalog Number: USNM 93155
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: North Island, Philippines, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Diaphus splendidus
Catalog Number: USNM 93164
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1909
Locality: Onkona Pt., Sulawesi, Indonesia, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 40- 3872 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 0 - 8000 m (Ref. 58018)
  • Bogutskaya, N.G. 2007 Preliminary assignment of coordinates to type localities in the Catalog of Fishes. Unpublished dbf file. (Ref. 58018)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 114 samples.

Environmental ranges
  Depth range (m): 50 - 4100
  Temperature range (°C): 1.749 - 26.896
  Nitrate (umol/L): 0.217 - 37.869
  Salinity (PPS): 34.419 - 37.009
  Oxygen (ml/l): 0.360 - 6.024
  Phosphate (umol/l): 0.038 - 2.655
  Silicate (umol/l): 0.830 - 145.704

Graphical representation

Depth range (m): 50 - 4100

Temperature range (°C): 1.749 - 26.896

Nitrate (umol/L): 0.217 - 37.869

Salinity (PPS): 34.419 - 37.009

Oxygen (ml/l): 0.360 - 6.024

Phosphate (umol/l): 0.038 - 2.655

Silicate (umol/l): 0.830 - 145.704
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 40 - 3872m.
From 40 to 3872 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic and mesopelagic, found between 375-750 m during the day; between 40-225 m at night (maximum abundance at 100 m depth) (Ref. 4479).
  • Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Diaphus splendidus (lanternfish) is prey of:
Gempylus serpens
Cephalopoda
Coryphaena
Thunninae
Trachurus
Scomber japonicus
Actinopterygii
Merluccius
Scombridae
Thyrsites atun
Cetacea
Aves
Phocidae
Chondrichthyes

Based on studies in:
unknown (epipelagic zone, Tropical)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
  • Yodzis P (2000) Diffuse effects in food webs. Ecology 81:261–266
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Diaphus splendidus (lanternfish) preys on:
Copepoda
Hyperiidae
mesozooplankton
macrozooplankton

Based on studies in:
unknown (epipelagic zone, Tropical)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
  • Yodzis P (2000) Diffuse effects in food webs. Ecology 81:261–266
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diaphus splendidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGCTGATTTTTCTCAACCAATCACAAAGACATTGGCACCCTCTACCTAATTTTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTTCTAATCCGAGCTGAACTGAGCCAACCTGGGGCCCTCCTCGGAGACGATCAGATCTACAACGTAATCGTAACAGCTCACGCCTTCGTAATAATTTTCTTCATGGTTATGCCCATCATGATTGGGGGCTTTGGAAACTGACTAATCCCCCTTATGATCGGCGCCCCCGACATAGCATTCCCTCGAATAAACAACATGAGCTTCTGGCTCCTACCCCCTTCCTTCCTTCTCCTCCTGGCCTCATCTGGCGTAGAAGCCGGGGCCGGAACCGGATGAACAGTCTACCCACCTCTCGCAGGCAATCTAGCCCACGCCGGAGCCTCTGTCGATCTAACAATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCTATCCTGGGAGCAATTAACTTCATTACAACCATCATCAACATGAAACCCCCTGCAATTACACAATATCAAACCCCTCTATTCGTGTGAGCAGTTCTTATTACAGCTGTACTTCTCCTTCTCTCGCTTCCAGTCCTAGCCGCTGGCATCACTATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGCGGAGACCCCATTCTCTACCAGCACCTATTCTGATTCTTCGGTCATCCCGAAGTCTACATTCTTATCCTTCCCGGCTTCGGCATGATCTCTCACATCGTAGCATACTACTCAGGCAAAAAAGAGCCTTTCGGCTACATGGGCATGGTCTGAGCAATGATGGCCATCGGCTTCCTTGGCTTTATCGTCTGAGCTCACCACATGTTCACCGTCGGAATGGACGTAGACACACGAGCTTACTTTACATCCGCCACAATGATTATTGCCATCCCTACAGGGGTAAAAGTATTTAGCTGACTAGCCACCCTCCACGGAGGAACCATTAAGTGAGAAACCCCTATGCTATGAGCCCTGGGATTCATCTTCCTATTTACAGTCGGGGGCCTAACTGGAATTGTCCTAGCTAACTCCTCGCTAGACATTGTCTTACACGACACCTATTACGTAGTCGCCCACTTCCACTACGTACTATCTATGGGAGCAGTCTTTGCCATCCTAGCCGCTTTCGTTCACTGATTCCCCCTATTCTCAGGATACACCCTTCACGGCACATGAACTAAAATCCACTTCGCAGTTATGTTTGTAGGCGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTCGCAGGTATGCCTCGTCGATACTCAGACTACCCGGACGCCTACACCCTTTGAAATACAGTATCCTCAATCGGATCCCTTATTTCCCTAGTCGCAGTAATCATGTTCCTATTTATTATCTGAGAAGCATTTGCCTCCAAACGAGAAGTCCTCTCAGTCGAGCTAACTACAACCAATGTAGAATGACTCCACGGCTGCCCTCCTCCATACCACACATTTGAAGAGCCAGCCTTTGTCCAAATTCGAACAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diaphus splendidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!