Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Oceanic and mesopelagic, found between 375-750 m during the day; between 40-225 m at night (maximum abundance at 100 m depth) (Ref. 4479).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

USA in the Gulf Stream to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: between 30°N and about 19°N and between 7°N and 11°S (uncommon over the Mauritanian Upwelling Region). Western Atlantic: USA in the Gulf Stream to Brazil. Indian Ocean: 7°N and 23°S; Agulhas Current (Ref. 4066). Western Pacific: to 35°N in Kuroshio and Tushima currents. Eastern Pacific: 8° and 12°S.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic and Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 15; Analspines: 0; Analsoft rays: 16 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 90 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.0 cm SL (male/unsexed; (Ref. 4479))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Diaphus splendidus
Catalog Number: USNM 93155
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1909
Locality: North Island, Philippines, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Diaphus splendidus
Catalog Number: USNM 93164
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1909
Locality: Onkona Pt., Sulawesi, Indonesia, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 40- 3872 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 0 - 8000 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 114 samples.

Environmental ranges
  Depth range (m): 50 - 4100
  Temperature range (°C): 1.749 - 26.896
  Nitrate (umol/L): 0.217 - 37.869
  Salinity (PPS): 34.419 - 37.009
  Oxygen (ml/l): 0.360 - 6.024
  Phosphate (umol/l): 0.038 - 2.655
  Silicate (umol/l): 0.830 - 145.704

Graphical representation

Depth range (m): 50 - 4100

Temperature range (°C): 1.749 - 26.896

Nitrate (umol/L): 0.217 - 37.869

Salinity (PPS): 34.419 - 37.009

Oxygen (ml/l): 0.360 - 6.024

Phosphate (umol/l): 0.038 - 2.655

Silicate (umol/l): 0.830 - 145.704
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 40 - 3872m.
From 40 to 3872 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic and mesopelagic, found between 375-750 m during the day; between 40-225 m at night (maximum abundance at 100 m depth) (Ref. 4479).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Diaphus splendidus (lanternfish) is prey of:
Gempylus serpens
Cephalopoda
Coryphaena
Thunninae
Trachurus
Scomber japonicus
Actinopterygii
Merluccius
Scombridae
Thyrsites atun
Cetacea
Aves
Phocidae
Chondrichthyes

Based on studies in:
unknown (epipelagic zone, Tropical)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
  • Yodzis P (2000) Diffuse effects in food webs. Ecology 81:261–266
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Diaphus splendidus (lanternfish) preys on:
Copepoda
Hyperiidae
mesozooplankton
macrozooplankton

Based on studies in:
unknown (epipelagic zone, Tropical)
South Africa, Southwest coast (Marine)

This list may not be complete but is based on published studies.
  • N. V. Parin, Ichthyofauna of the Epipelagic Zone (Israel Program for Scientific Translations, Jerusalem, 1970; U.S. Department of Commerce Clearinghouse for Federal Scientific and Technical Information, Springfield, VA 22151), from p. 154.
  • Yodzis P (2000) Diffuse effects in food webs. Ecology 81:261–266
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diaphus splendidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGCTGATTTTTCTCAACCAATCACAAAGACATTGGCACCCTCTACCTAATTTTCGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTTCTAATCCGAGCTGAACTGAGCCAACCTGGGGCCCTCCTCGGAGACGATCAGATCTACAACGTAATCGTAACAGCTCACGCCTTCGTAATAATTTTCTTCATGGTTATGCCCATCATGATTGGGGGCTTTGGAAACTGACTAATCCCCCTTATGATCGGCGCCCCCGACATAGCATTCCCTCGAATAAACAACATGAGCTTCTGGCTCCTACCCCCTTCCTTCCTTCTCCTCCTGGCCTCATCTGGCGTAGAAGCCGGGGCCGGAACCGGATGAACAGTCTACCCACCTCTCGCAGGCAATCTAGCCCACGCCGGAGCCTCTGTCGATCTAACAATTTTCTCCCTTCACCTAGCAGGTGTCTCCTCTATCCTGGGAGCAATTAACTTCATTACAACCATCATCAACATGAAACCCCCTGCAATTACACAATATCAAACCCCTCTATTCGTGTGAGCAGTTCTTATTACAGCTGTACTTCTCCTTCTCTCGCTTCCAGTCCTAGCCGCTGGCATCACTATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGCGGAGACCCCATTCTCTACCAGCACCTATTCTGATTCTTCGGTCATCCCGAAGTCTACATTCTTATCCTTCCCGGCTTCGGCATGATCTCTCACATCGTAGCATACTACTCAGGCAAAAAAGAGCCTTTCGGCTACATGGGCATGGTCTGAGCAATGATGGCCATCGGCTTCCTTGGCTTTATCGTCTGAGCTCACCACATGTTCACCGTCGGAATGGACGTAGACACACGAGCTTACTTTACATCCGCCACAATGATTATTGCCATCCCTACAGGGGTAAAAGTATTTAGCTGACTAGCCACCCTCCACGGAGGAACCATTAAGTGAGAAACCCCTATGCTATGAGCCCTGGGATTCATCTTCCTATTTACAGTCGGGGGCCTAACTGGAATTGTCCTAGCTAACTCCTCGCTAGACATTGTCTTACACGACACCTATTACGTAGTCGCCCACTTCCACTACGTACTATCTATGGGAGCAGTCTTTGCCATCCTAGCCGCTTTCGTTCACTGATTCCCCCTATTCTCAGGATACACCCTTCACGGCACATGAACTAAAATCCACTTCGCAGTTATGTTTGTAGGCGTAAACCTAACATTCTTCCCACAACACTTCCTAGGCCTCGCAGGTATGCCTCGTCGATACTCAGACTACCCGGACGCCTACACCCTTTGAAATACAGTATCCTCAATCGGATCCCTTATTTCCCTAGTCGCAGTAATCATGTTCCTATTTATTATCTGAGAAGCATTTGCCTCCAAACGAGAAGTCCTCTCAGTCGAGCTAACTACAACCAATGTAGAATGACTCCACGGCTGCCCTCCTCCATACCACACATTTGAAGAGCCAGCCTTTGTCCAAATTCGAACAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diaphus splendidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!