Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: marlinsucker (English), rémora (Espanol)
 
Remora osteochir (Cuvier, 1829)

Marlinsucker

Body elongate; dorsal and anal bases < 2x head length; head disc with 15-19  plates, long, reaches well beyond pectorals, but less than ½ body length; 11-17 gill rakers; pectoral medium, blunt, 20-24 rays, fin stiff to tip; dorsal and anal bases similar length, almost 2x head length; dorsal 21-27 rays, anal 20-26 rays; tail edge straight (forked in juvenile); pelvics pointed, widely joined to belly.



Overall brown.


Size: 40 cm.

Habitat: oceanic, hosts are billfishes.

Depth: 0-200 m?

Circumtropical; throughout our region except for the upper Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Oceanic species with a strong preference for marlins and sailfish as hosts, but may occasionally cling to other large fishes. Attaches to the body or gill chamber of the host (Ref. 10791). Oviparous. Distinct pairing during breeding (Ref. 57896).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: 52°N and northern Gulf of Mexico to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Warm and temperate seas of all oceans. Western Central Pacific: Guam (Ref. 35721). Eastern Pacific: southern California, USA to Peru (Ref. 2850). Western Atlantic: Massachusetts, USA and northern Gulf of Mexico to Brazil (Ref. 7251). Eastern Central Atlantic: Madeira Island (Ref. 74541).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Mediterranean Sea, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 200 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 40.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 5288))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

oceanic species with a strong preference for marlins and sailfish as hosts, but may occasionally cling to other large fishes. Attaches to the body or gill chamber of the host.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 3109
  Temperature range (°C): 4.273 - 19.818
  Nitrate (umol/L): 0.495 - 31.476
  Salinity (PPS): 34.855 - 36.588
  Oxygen (ml/l): 0.495 - 5.206
  Phosphate (umol/l): 0.046 - 2.378
  Silicate (umol/l): 0.908 - 25.988

Graphical representation

Depth range (m): 0 - 3109

Temperature range (°C): 4.273 - 19.818

Nitrate (umol/L): 0.495 - 31.476

Salinity (PPS): 34.855 - 36.588

Oxygen (ml/l): 0.495 - 5.206

Phosphate (umol/l): 0.046 - 2.378

Silicate (umol/l): 0.908 - 25.988
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Water column, Large fishes (billfishes, rays, sharks, etc), turtles & whales

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic species with a strong preference for marlins and sailfish as hosts, but may occasionally cling to other large fishes. Attaches to the body or gill chamber of the host (Ref. 10791).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore, Ectoparasite cleaner

Diet: Pelagic crustacea, zooplankton, pelagic fish larvae, ectoparasites, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous. From collection study observations, a mature pair is often found attached to a single host, most often a billfish, indicative of distinct pairing during breeding (Ref. 57896).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Remora osteochir

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGGGCCTGAGCCGGGATAGTGGGAACTGCACTAAGCCTTCTTATTCGGGCAGAACTTAGCCAGCCAGGCTCCCTGCTGGGCGATGACCAAGTTTATAATGTCATCGTTACAGCCCACGCCTTTGTAATAATTTTCTTTATGGTTATACCCGTTATAATTGGGGGCTTTGGGAACTGACTCATTCCCCTTATAATTGGCGCACCTGACATAGCCTTCCCTCGAATAAATAATATAAGCTTCTGGCTACTACCCCCCTCCTTTCTTTTGCTGTTAACATCTTCAGGCGTAGAAGCAGGGGCAGGTACCGGTTGAACCGTATATCCTCCTCTAGCTGGAAACCTTGCCCATGCAGGGGCCTCTGTAGATCTTACCATTTTCTCTCTCCACTTAGCAGGAATTTCGTCAATTCTAGGAGCAATTAATTTCATTACAACAATTATTAATATAAAACCCGCAGCTGCCTCTATGTACCAGCTCCCCTTATTTGTTTGAGCTGTTCTTATTACAGCTGTACTACTTCTCCTCTCCCTCCCTGTCCTAGCTGCCGGAATTACAATACTTCTAACAGACCGAAATCTTAATACTGCCTTTTTCGACCCCGCAGGAGGAGGAGACCCCATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Remora osteochir

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Marlin sucker

The marlin sucker, Remora osteochir, is a species of remora found all over the world in tropical and temperate seas. It can reach up to 40 cm (16 in) in standard length. Its host preference is for marlins (as the name implies) and sailfishes, but will attach to other large fish.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Remora osteochir" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!