Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: remora (English), rémora (Espanol)
 
Remora brachyptera (Lowe, 1839)

Spearfish remora



Body elongate, robust; dorsal and anal bases < 2x head length; head disc short, reaches ~ middle of pectorals, 14-17 plates; gill rakers 14-17, 12-14 lower rakers; pectoral broad, blunt 23-27 rays, outer 2/3 of fin flexible; dorsal and anal bases similar length, notably longer than head; dorsal 27-34 rays; anal 23-27 rays; tail W shaped (forked in juvenile); pelvics pointed, broadly joined to belly. 


Overall brown.

Size: 40 cm.

Habitat: oceanic, hosts are billfishes.

Depth: 0-200 m?.

Circumtropical; throughout our region except for the upper Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Found on the body and inside gill chamber of billfishes and swordfishes, rarely on any other fishes (Ref. 2850); also in the gill cavities and mouths of sharks (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Worldwide in warm seas; Western Atlantic: Nova Scotia, Canada to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Remora brachyptera has a circumglobal distribution throughout all warm waters. Its most southerly limit reaches Otago in New Zealand. In the western Atlantic it ranges from Nova Scotia to Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in warm seas. Western Atlantic: Nova Scotia, Canada to Brazil. Eastern Central Atlantic: Madeira Island (Ref. 74541).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas, including Red Sea, Mascarenes, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in warm seas. Western Atlantic: Nova Scotia, Canada to Brazil.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 200 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 27 - 34; Analspines: 0; Analsoft rays: 25 - 34
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 40.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 55763))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 40.0 cm TL (male/unsexed).
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found on the body and inside gill chamber of billfishes and swordfishes, rarely on any other fishes (Ref. 2850).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body cylindrical and elongate; possessing an oblong cephalic disk with 14 to 17 transverse laminae; cranium depressed (supporting cephalic disk); dorsal fin with 27 to 44 rays; first gill arch with fewer than 21 gill rakers; body entirely white to pale blue (Ref. 55763).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found on the body and inside gill chamber of billfishes and swordfishes, rarely on any other fishes.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Remora brachyptera is commonly found attached on to sharks, particularly blue sharks and in the gill chambers of swordfish and billfishes (O'Toole 2002). This is an epipelagic species, like the host species. This species is found to a maximum depth of 200 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 2377
  Temperature range (°C): 3.817 - 24.554
  Nitrate (umol/L): 0.162 - 20.996
  Salinity (PPS): 33.249 - 34.976
  Oxygen (ml/l): 4.733 - 5.951
  Phosphate (umol/l): 0.429 - 1.413
  Silicate (umol/l): 3.286 - 25.571

Graphical representation

Depth range (m): 0 - 2377

Temperature range (°C): 3.817 - 24.554

Nitrate (umol/L): 0.162 - 20.996

Salinity (PPS): 33.249 - 34.976

Oxygen (ml/l): 4.733 - 5.951

Phosphate (umol/l): 0.429 - 1.413

Silicate (umol/l): 3.286 - 25.571
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; marine. Found on the body and inside gill chamber of billfishes and swordfishes, rarely on other species of fishes.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Water column, Large fishes (billfishes, rays, sharks, etc), turtles & whales

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the body and inside gill chamber of billfishes and swordfishes, rarely on any other fishes (Ref. 2850); also in the gill cavities and mouths of sharks (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No information
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore, Planktivore, Ectoparasite cleaner

Diet: Pelagic crustacea, zooplankton, pelagic fish larvae, ectoparasites, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

No information.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Paxton, J.R., D.F. Hoese, G.R. Allen and J.E. Hanley, 1989.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Remora brachyptera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTCGGGGCCTGAGCCGGGATAGTGGGAACCGCACTAAGCCTGCTTATTCGAGCTGAACTTAGCCAACCAGGTTCTCTACTGGGCGATGATCAAGTTTACAACGTTATCGTTACAGCCCATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGTTTCGGAAATTGACTTGTACCCCTTATAATTGGTGCACCCGATATGGCATTTCCCCGAATAAACAACATAAGCTTCTGATTACTACCCCCTTCTTTTCTCCTATTATTAACATCCTCAGGTGTAGAAGCAGGAGCAGGTACCGGCTGAACCGTTTACCCTCCTTTAGCAGGTAATCTTGCCCATGCAGGAGCCTCTGTAGATCTTACCATTTTTTCCCTCCATTTGGCGGGTGTTTCATCAATTCTTGGAGCAATCAACTTCATTACAACAATTATTAATATGAAGCCTGCAGCTGCCTCCATATATCAACTTCCTCTGTTTGTATGAGCTGTACTTATTACAGCCGTCCTTCTCCTTCTCTCCCTCCCTGTCTTAGCTGCCGGTATTACAATACTTTTAACAGACCGAAATCTTAATACTGCCTTTTTCGATCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Remora brachyptera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Collette, B.B.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
Remora brachyptera is listed as Least Concern. It is common and widely distributed. There are no known specific threats to the species, but it may be affected by threats directed at the host species. Further research is needed on the threats and population trends of this species to determined how it is being impacted by indirect threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to Remora brachyptera. This species may be indirectly impacted due to the harvesting of its host species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, this species distribution coincides with a number of marine protected areas.

Further research is needed on the population trends and threats of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spearfish remora

The spearfish remora, Remora brachyptera, is a species of remora found around the world in tropical and subtropical seas, where they are almost exclusively found on billfishes and swordfishes, sometimes on sharks. This species can reach 50 cm (20 in) in total length, though most do not exceed 25 cm (9.8 in).[2]

References[edit]

  1. ^ Collette, B.B. 2010. Remora brachyptera. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. <www.iucnredlist.org>. Downloaded on 01 July 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Remora brachyptera" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!