Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: whalesucker (English), rémora (Espanol)
 
Remora australis (Bennett, 1840)


Whalesucker

Body elongate, robust; dorsal and anal bases < 2x head length; head disc very long (almost ½ body length), reaches beyond pectorals, with 24-28 plates; gill rakers 17-20, 13-19 lower rakers; pectoral short, blunt, 21-24 rays; dorsal and anal bases similar length, a little longer than head; dorsal 22-26 rays, anal 21-26 rays; tail slightly concave (forked in juvenile); pelvics long, pointed, broadly attached to belly. 

Dark blue to slate grey, dorsal and anal fins with narrow white margin.


Size: 76 cm.

Habitat: oceanic, hosts are whales.

Depth: 0-200 m?

A circumtropical species, found throughout our region except for the upper Gulf of California.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Oceanic, mostly in warm seas. Attaches itself only to whales and porpoises (Ref. 7251). One adult couple was recorded attached to the same individual spinner dolphin for a period of about 3 months (Ref. 50801). A common associate of spinner dolphins at Fernando de Noronha Archipelago, southeast Atlantic, where it occurs year-round. Recorded feeding on spinner dolphins’ feces and vomits (Ref. 48727).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in tropical and warm waters. Western Atlantic: Texas, USA to Brazil. Eastern Pacific: Vancouver Island in British Columbia, Canada to Chile (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and warm temperate seas, including Mediterranean Sea, Réunion (Mascarenes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (F) - 200 (F)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 25 - 27; Dorsal soft rays (total): 20 - 23; Analspines: 0; Analsoft rays: 20 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 76.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dark blue to slate grey; fins with narrow white edge (Ref. 4389).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 235 - 235
  Temperature range (°C): 14.230 - 14.230
  Nitrate (umol/L): 16.740 - 16.740
  Salinity (PPS): 35.746 - 35.746
  Oxygen (ml/l): 3.350 - 3.350
  Phosphate (umol/l): 1.218 - 1.218
  Silicate (umol/l): 8.021 - 8.021
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Near Surface, Mid Water, Water column only

Habitat: Water column, Large fishes (billfishes, rays, sharks, etc), turtles & whales

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore, Planktivore, Ectoparasite cleaner

Diet: Pelagic crustacea, zooplankton, pelagic fish larvae, ectoparasites, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Remora australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAATTTTCGGGGCCTGAGCCGGAATAGTGGGCACCGCACTAAGCCTGCTAATTCGAGCAGAACTTAGCCAGCCGGGCTCTCTCCTCGGTGATGATCAAGTATATAATGTTATCGTTACAGCCCATGCCTTTGTAATAATTTTCTTTATGGTTATACCAGTTATGATCGGAGGCTTTGGAAACTGACTGATCCCTCTTATAATTGGCGCACCTGACATAGCCTTCCCTCGTATAAATAATATAAGTTTCTGACTACTACCCCCCTCTTTTCTTCTCCTTTTAACATCTTCCGGCGTAGAAGCTGGGGCAGGTACCGGTTGAACCGTCTACCCCCCACTAGCAGGAAATCTTGCCCACGCAGGGGCCTCTGTAGATTTAACTATTTTCTCCCTACATTTAGCAGGAATTTCTTCAATCCTCGGGGCAATTAACTTTATTACAACAATTATTAATATAAAACCTGCAGCTGCCTCCATATATCAATTACCTCTATTTGTCTGAGCCGTCCTTATCACGGCTGTCCTCCTCCTCCTATCCCTCCCTGTTCTAGCCGCTGGTATTACAATACTTCTAACTGACCGAAACCTTAACACTGCCTTTTTTGACCCGGCAGGAGGAGGAGACCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Remora australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Whalesucker

The whalesucker, Remora australis, is a species of remora in the family Echeneidae, so named because it attaches itself exclusively to cetaceans. It is found worldwide in tropical and warm waters; in the Gulf of Mexico and western Atlantic Ocean, it occurs from Texas to Brazil, and in the eastern Pacific Ocean, it occurs from Vancouver Island to Chile.[1] It is the rarest member of the remora family, though this may reflect more the uncommon collection of cetaceans in the wild rather than the whalesucker's actual abundance.[2]

The adhesive disk atop the head of the whalesucker is the largest amongst the remoras, bearing 25-28 lamellae and measuring 47-59% of the standard length. The head itself measures 26-28% of the standard length. The dorsal fin rays number 23-26, the anal fin rays 24-26, and the pectoral fin rays 22-24. The jaws contain numerous large, stout canine teeth; the palatine and lingual patches are absent, and there are 17-20 gill rakers. The coloration is uniform brown, dark brown, or greyish-brown on the head, trunk, and fins.[3] Whalesuckers observed off Fernando de Noronha ranged from light grey to slate grey, with lighter fin margins. The smaller individuals are barred or blotched, while individuals over 35 cm long have yellowish fins.[4] This species can reach 76 cm (30 in) in total length.[1]

The most common host of the whalesucker appears to be the blue whale. Chitinous material indicative of parasitic copepods or amphipods have been found in the stomachs of whalesuckers, suggesting a mutualistic relationship with their hosts.[2] Off Fernando de Noronha, whalesuckers down to small (4 to 9 cm (1.6 to 3.5 in)) juveniles are associated with spinner dolphins, and are likely recruited year-round from flotsam. The whalesuckers, no more than three to a host, usually attach to the flanks or belly of the dolphin, which may serve to minimize drag and facilitate feeding. When approached, they, especially small individuals, will shift to the opposite side of the host for protection. Whalesuckers impose a hydrodynamic cost to their host, their adhesive disks can abrade the skin, and they sometimes attach to inconvenient locations, such as near the blowhole or the genitals. The spinning behavior of dolphins, sharks, and other remora hosts has been proposed as a means of dislodging them. The whalesuckers feed on parasites and sloughed-off skin, and also forage on feces and vomit from the dolphins.[4]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Remora australis" in FishBase. April 2013 version.
  2. ^ a b O'Toole, B (Apr 2002). "Phylogeny of the species of the superfamily Echeneoidea (Perciformes: Carangoidei: Echeneidae, Rachycentridae, and Coryphaenidae), with an interpretation of echeneid hitchhiking behaviour". Canadian Journal of Zoology 80 (4): 596–823. doi:10.1139/z02-031. 
  3. ^ Lachner, E.A. (1986). "Echeneididae". In Whitehead, P.J.P, et al.. Fishes of the North-eastern Atlantic and the Mediterranean. Paris: United Nations Educational, Scientific and Cultural Organization. ISBN 92-3-002309-4. 
  4. ^ a b Silva-Jr., J. M. and Sazima, I. (2006). Whalesuckers on spinner dolphins: an underwater view. JMBA2-Biodiversity Records: 1-6. [1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!